
                   comp.os.os2.apps                 (Usenet)

                 Saturday, 16-Oct-1999 to Friday, 22-Oct-1999

+----------------------------------------------------------------------------+

From: hjmurray@home.com                                 15-Oct-99 22:24:16
  To: All                                               16-Oct-99 04:21:28
Subj: Re: Current Java

From: "Hal Murray" <hjmurray@home.com>

 > I haven't kept current with OS/2 and Java.  What's the current
level
 > of Java available under Warp 4.0?  Is it automatically updated in
 > the Warp 4.0 Fixpacks?  If not, where are updates to be found?
 > 
 > 
 > Thanks - Will
 > cwr@crash.cts.com
 > 

Will

In addition to all the other advice provided by others you have to
have FixPak 5 or above applied to Warp 4.

Hal Murray
Calgary, AB

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: lomholt@post8.tele.dk                             15-Oct-99 23:19:00
  To: All                                               16-Oct-99 04:21:28
Subj: Re: CHKDSK problem 

From: Johannes Lomholt <lomholt@post8.tele.dk>

Siobhan Perricone skrev:
> 
> In article <38065ba5$2$lllp186.vyyrtnygbfcnz$mr2ice@news-
> s01.ny.us.ibm.net>,
>   yyyc186.illegaltospam@ibm.net wrote:
> > In <7u4q4f$m8r$1@nnrp1.deja.com>, on 10/14/99
> >    at 02:42 PM, Siobhan Perricone <morgannalefey@my-deja.com> said:
> >
> > Clean your floppy drive, then buy a new floppy.  That error is caused
> by
> > dirt on the floppy head or a damaged floppy disk.
> 
> Thank you for this helpful response. :)
> 
> Turns out y'all were right (not that I expected anything less).  I made
> a new set of recovery disks with fresh new floppies and it works fine.
> 
> NOW I have a stupid chkdsk thing that's coming up.
> 
> I'm going through the notes people have sent me on the best way to
> procede with this back up and restore test I'm going.  So I obediently
> try to do a chkdsk on the c: drive (that's my boot drive and the only
> drive with anything on it, the other two are blank).  I get a message
> telling me there's an allocation error in c:\os2
> \help\_<somefilename>.db but it can't fix it because I didn't use
> the /f switch.
> 
> So I do help on chkdsk and read about the /f switch (someone had
> suggested I use /f:2 so I look that up as well).  My interpretation of
> what the help file says is that you need the /f (or /f:n) switch in
> order for chkdsk to fix the errors it finds, but that you can't use it
> from the drive you boot from.  I say "OH" and reboot using the utility
> disks.  After some wrangling with commands and finally putting the
> right disk into the drive, I try the chkdsk /f:2 thing.  It tells me
> the disk is locked.  I try chkdsk /f.  Disk is locked.  Then just
> chkdsk.  It goes through the process and tells me there were no errors
> reported.  So I try booting back up normally, and running chkdsk again
> on the c: drive and it gives me the SAME allocation error on that file.
> 
> So what am I doing wrong?
> 
> --
> Siobhan Perricone
> PC Technician
> Alltel Information Services
> (I only speak for myself, not for Alltel)
> 
> Sent via Deja.com http://www.deja.com/
> Before you buy.

Try to check your service diskettes, look for the file chkdsk.*
I made a set where chkdsk wasn't made correct.
try to use the youngest chkdsk file on the system and put that 
on service diskette # 4.  Then test and start from drive C: and up.

greetings

Johs.Lomholt

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: My own (1:109/42)

+----------------------------------------------------------------------------+

From: lomholt@post8.tele.dk                             15-Oct-99 23:33:23
  To: All                                               16-Oct-99 04:21:28
Subj: Re: Current Java?

From: Johannes Lomholt <lomholt@post8.tele.dk>

Will Rose skrev:
> 
> I haven't kept current with OS/2 and Java.  What's the current level
> of Java available under Warp 4.0?  Is it automatically updated in
> the Warp 4.0 Fixpacks?  If not, where are updates to be found?
> 
> Thanks - Will
> cwr@crash.cts.com

Hello.

The Java JDK is now version 1.1.8 which is available at Software Choice.

Periodical updates consist of 3 files, Runtime, Toolkit and Samples
that has to be downloaded to the OS/2 Drive (C or other actual)
in the root, then run the 3 files sequentally.

The new versions are normally announced on OS2EZINE.COM

Greetings

 Johs. Lomholt

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: My own (1:109/42)

+----------------------------------------------------------------------------+

From: gczerw@home.No-Spam.com                           15-Oct-99 22:58:12
  To: All                                               16-Oct-99 04:21:28
Subj: Re: Pronews/2

From: gczerw@home.No-Spam.com (George Czerw)

On Fri, 15 Oct 1999 10:46:57, psmedley@my-deja.com (Paul Smedley) 
wrote:

> Hi,
> Just wondering if anyone knows a way in Pronews/2 to set it to 
> automatically download the bodies of all messages on startup?  I know 
> that I can hit the A key on startup to download all bodies for all 
> groups but this is a pain.  I may be blind, but I can't see a way to 
> do this in the default Group settings.
> 
> Thanks in advance for any help.
> 
> Seeya,
> 
> Paul Smedley

Under ProNews/2, Settings,  goto the Group Defaults Tab and check Auto
retrieve bodies, then click Apply, then OK!

George

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: uh45@rz.uni-karlsruhe.de                          15-Oct-99 23:21:07
  To: All                                               16-Oct-99 04:21:28
Subj: cdrecord

From: uh45@rz.uni-karlsruhe.de

Hi folks!

I'm wondering if you can burn CD's with cdrecord and a ATAPI-Drive.
If so, how do you associate your IDE-CD-Writer to a SCSI-ID??
Is that possible??

Thanxx for your help!

Cu!

Andi

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Karlsruhe (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    15-Oct-99 23:44:06
  To: All                                               16-Oct-99 04:21:28
Subj: Re: cdrecord

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

uh45@rz.uni-karlsruhe.de wrote:

: I'm wondering if you can burn CD's with cdrecord and a ATAPI-Drive.
: If so, how do you associate your IDE-CD-Writer to a SCSI-ID??
: Is that possible??

	Not possible with OS/2 since there is ATAPI router.  If someone 
were to make one, though...


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: jsant@interaccess.com                             15-Oct-99 18:42:05
  To: All                                               16-Oct-99 04:21:28
Subj: Recording Records

From: "Jon Santarelli" <jsant@interaccess.com>

Hi all,

Recently I purchased a CD recorder (Plextor 8/2/20 SCSI) for the intent on
recording my records.  I also purchased RSJ.

What do I need to do to record these records?  Some how I'll have to hook the
stereo up to the sound card and go from there, but what software to use to
capture the sound I don't know.

All help is appreciated.
Jon


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 15-Oct-99 23:39:17
  To: All                                               16-Oct-99 04:21:28
Subj: Re: another OT about e-mail addresses

From: hamei@pacbell.net

In <380771ef$1$zpunffba$mr2ice@news3.ibm.net>, mchasson@ibm.net writes:
>In <3805E176.72815DBA@ibm.net>, on 10/14/99 at 02:58 PM,
>   Tony Wright <horseman@ibm.net> said:
>
>>Buddy Donnelly wrote:
>
>>> complaining that newcomers to your address couldn't figure out how to mail
>>> to you.
>>>
>
>>Tch, Tch.... "Methinks he doth protest too much"! 
>>Stop pursuing and defending the fact of why you jumped to an invalid
>>conclusion - you're straying out of character now...Benedick Prince of
>>Padua:
>> "I'll tell thee what prince;  a college of wit-crackers  cannot flout me
>>out of my humour. Does thou think I care for a satire or epigram? No: if
>>a man will be beaten with brains, a' shall wear nothing handsome about
>>him.  ("Much ado about Nothing")  <g>
>
>>--
>>Rgds Tony W   Email: horseman@attglobal.net
>
>
>Ah...of course.  I know now that Buddy is a candidate for the HLAS
>newsgroup.  (Humanities.Lit.Authors.Shakespeare).  There are truly mind
>boogling and bending types populating that territory who Buddy could use
>to vent his spleen upon and therefor save us to enjoy the benefit of his
>excellent insights on op sys questions.  
>
>Of course Buddy may be one of them.  That is Oxfordians, and Baconians,
>and anyone but WS wrote those plays, but I think not, and  he will enjoy
>the many enlightened and illuminating discussions from people who really
>know the Bard. -- 
>----------------------------------------------------
>------
>Monroe Chasson
>mchasson@ibm.net
>-----------------------------------------------------------
>


this thread should be retitled much ado about nothing . . . it was I 
who chopped down the cherry tree, sneering rudely at the Welsh
guerrilla enchantress pseudo-apparent address, Buddy was an
innocent bystander (for once) giving witness. It DID look like a 
phony address, and I SAID I was SORRY. 

and maybe Siobhan is correct, morgan was a free spirit slandered
by that fascist pig Arthur and his evil history-twisting minions . . .

 
--
Hrad ngravvrd



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: mcmorran@norfolk.infi.net                         15-Oct-99 21:23:00
  To: All                                               16-Oct-99 04:21:28
Subj: Re: cdwriter support

From: mcmorran@norfolk.infi.net (Peter McMorran)

In <7u4rvp$r5t$1@news.panix.com>, on 10/14/99 
   at 03:14 PM, rcpj@panix.com (Pierre Jelenc) said: <snip of old
stuff>

>[C:\]cdrecord dev=3,0 -inq
>Cdrecord release 1.8a24 Copyright (C) 1995-1999 J rg Schilling
>scsidev: '3,0'
>scsibus: 0 target: 3 lun: 0
>Device type    : Removable CD-ROM
>Version        : 2
>Response Format: 2
>Capabilities   : SYNC
>Vendor_info    : 'YAMAHA  '
>Identifikation : 'CRW6416S        '
>Revision       : '1.0b'
>Device seems to be: Generic mmc CD-RW.

This looks fine. So, your hardware/software configuration is
working.

>Looks like this works. But...

>CDWriter:

>Cdrecord release 1.8a24 Copyright (C) 1995-1999 J rg Schilling
>TOC Type: 0 = CD-DA
>scsidev: '3'
>devname: '3'
>scsibus: -2 target: -2 lun: -2
>D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe: No such file or
>directory. Cannot open SCSI driver.

>Quite obviously these "-2" are wrong compared to the successful
>test above. But there are no "-2" that I can see anywhere in
>CDWriter.

In another post, you showed the CDWriter configuration as

Program Path: D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe SCSI
Device: 3
Speed: 4
Pregap: 0
Other options: (blank)
Command file: makedisc.cmd

Unfortunately, none of us seems to know what CDWriter expects
here. As Anssi suggested, you might try 3,0 for the device.
Because the specified dev is only '3', cdrecord may be
interpreting it as a devname and leaving the scsi parameters
uninitialized -- just a guess.

Cheers,
Peter

-- 
-----------------------------------------------------------
mcmorran@norfolk.infi.net (Peter McMorran)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: cfellows@execpc.com                               15-Oct-99 20:47:14
  To: All                                               16-Oct-99 04:21:28
Subj: Re: Beta vs GA

From: Cliff Fellows <cfellows@execpc.com>

There! I made the update/upgrade/change and it works. Easy deal, no problems.
Seems
a bit quicker than the beta, especially when loading the mail/newsgroups
screen.
I'll keep you posted...
Cliff

lifedata@xxvol.com wrote:

> "Gordon A. Stripling" <gordon.nospam@gadsnet.com> said:
> >> Many have found the GA to be somewhat superior
> >>to the GA.
>
> >I presume you meant "GA to be somewhat superior to the BETA".
>
> Arrrrrrrrrrrrrgh.  Yep.  I've seen lots of comments to this effect.  They
really
> removed a bunch of junk in the GA release.  Of course that doesn't guarantee
> anything on a given machine.
>
> Jim L
> Remove XX from address to Email
> Crooks and kooks will get guns regardless of laws.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ExecPC Internet - Milwaukee, WI (1:109/42)

+----------------------------------------------------------------------------+

From: rsteiner@visi.com                                 15-Oct-99 23:07:14
  To: All                                               16-Oct-99 04:21:29
Subj: Re: Best way to get Wordpro Documents into StarOffice?

From: rsteiner@visi.com (Richard Steiner)

Here in comp.os.os2.apps, John Abraham <jabraham@ucalgary.ca>
spake unto us, saying:

>I've installed StarOffice and want to give it a try.  But it doesn't
>convert my Lotus WordPro files (it just launches WordPro when I try to
>open them.)

Have you tried to use the Open option in the File menu?

-- 
   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
          I know it all.  I just can't remember it all at once!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    16-Oct-99 05:25:15
  To: All                                               16-Oct-99 04:21:29
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

Peter McMorran <mcmorran@norfolk.infi.net> writes:
> 
> In another post, you showed the CDWriter configuration as
> 
> Program Path: D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe SCSI
> Device: 3
> Speed: 4
> Pregap: 0
> Other options: (blank)
> Command file: makedisc.cmd
> 
> Unfortunately, none of us seems to know what CDWriter expects
> here. As Anssi suggested, you might try 3,0 for the device.
> Because the specified dev is only '3', cdrecord may be
> interpreting it as a devname and leaving the scsi parameters
> uninitialized -- just a guess.

Bingo! If I put 3,0 in the Device, it looks like it's working. At least in
"dummy write" mode. There is some progress...

On the other hand, I've discovered that CD rippers seem to believe that
the drive does not allow direct read of audio tracks, even though the
drive is clearly labelled "CD-DA" (Yamaha CRW6416sz). I can play audio CDs
and read CD-ROM without any problem, though, so there must be something a
lot more subtle going on.

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: parnott@brooknet.com.au                           16-Oct-99 16:01:16
  To: All                                               16-Oct-99 04:21:29
Subj: Re: OD - alternatives?

From: Paul Arnott <parnott@brooknet.com.au>

I have dragged unzip.exe to Warpcenter,given it a pretty icon,then when u
drag/drop a zip file onto it it unzips the zipfile into the folder it (the
zip) is in. Simple!
Paul.

Steve Drewell wrote:

> The main (and probably only) things I use Object Desktop for are the
> enhanced folders and the zip/rar/etc archive utilities. I already use
> Xfolder and can therefore do away with the OD enhanced folders. However,
> it is the zip/rar/etc archive utilities which I'd miss the most should I
> uninstall OD. Are there any decent alternatives to this functionality of
> OD where an archive is shown and treated in a similar way to a normal
> folder, and files can be dragged and dropped to or from the archive?
>
> Cheers,
> Steve

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jpolt@bradnet.legend.co.uk                        16-Oct-99 08:34:22
  To: All                                               16-Oct-99 10:34:11
Subj: Audio CD writer

From: jpolt@bradnet.legend.co.uk (John Poltorak)

Is there a CD writer that can write wav files as an audio CD?

--
John

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Legend Internet Ltd (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   16-Oct-99 03:40:27
  To: All                                               16-Oct-99 10:34:11
Subj: Re: 3D graphics programs?

From: Kris Kadela <kris@dgraph.com>

Expensive but good - MicroStation from Bentley. Don't know if they still
sell it since MicroStationJ came out.

williamd wrote:
> 
> Could anyone recommend some good 3D graphics programs that would work
> under Warp 3? Especially those that can easily be used in website
> creation?
> 
> Thanks for any suggestions.
> 
> Bill
> 
> __
> william1@teleport.com

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   16-Oct-99 03:45:17
  To: All                                               16-Oct-99 10:34:11
Subj: Re: Recording Records

From: Kris Kadela <kris@dgraph.com>

Use your sound editor that came with Warp. It captures large WAVs nicely
if you have enough RAM. Then edit the file to cut out any pops and you
are set. There is also a Win only pacakge called denoise that will do
wonders on old noisy recordings. It manages to restore old recordings
from 60-70 years ago to almost noiseless condition.

Jon Santarelli wrote:
> 
> Hi all,
> 
> Recently I purchased a CD recorder (Plextor 8/2/20 SCSI) for the intent on
> recording my records.  I also purchased RSJ.
> 
> What do I need to do to record these records?  Some how I'll have to hook
the
> stereo up to the sound card and go from there, but what software to use to
> capture the sound I don't know.
> 
> All help is appreciated.
> Jon

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   16-Oct-99 03:47:22
  To: All                                               16-Oct-99 10:34:11
Subj: Re: Audio CD writer

From: Kris Kadela <kris@dgraph.com>

They all do

John Poltorak wrote:
> 
> Is there a CD writer that can write wav files as an audio CD?
> 
> --
> John

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: victori@exis.net                                  16-Oct-99 08:41:29
  To: All                                               16-Oct-99 14:29:06
Subj: SYS3175 at startup of NC 4.61

From: victori@exis.net

I have installed NC 4.61 with no problems.  When I start the NC 4.61 I
get SYS3175 from OS/2.  This only occurs on one OS/2 machine and I 
have not been able to resolve it.  Any ideas?

This machine has Warp4 FP12, 128MegRAM, Object Desktop 2.0, Process 
Commander 1.01...  NC 4.61 works fine on all the other OS/2 machines.

Thanks in advance,
----Pat.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Exis Net Inc (1:109/42)

+----------------------------------------------------------------------------+

From: jhong@morgan.ucs.mun.ca                           16-Oct-99 13:40:28
  To: All                                               16-Oct-99 14:29:07
Subj: Re: Describe 4.0 : How to print ?

From: jhong@morgan.ucs.mun.ca (John Hong)

Frank@get-lost.spam (Frank) writes:

>On Wed, 13 Oct 1999 00:41:53, jdc0014@InfoNET.st-johns.nf.ca (John 
>Hong) wrote:

>>You're not running a shareware copy of Describe 4.0, what you are 
>> running is a workable demo.  

>But..is it possible to have this demo version print anything ?

	I doubt it.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Memorial University of Newfoundland (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          16-Oct-99 14:11:08
  To: All                                               16-Oct-99 14:29:07
Subj: Re: OD - alternatives?

From: piquant00@uswestmail.net (Annie K.)

On Fri, 15 Oct 1999 16:34:00, Steve Drewell <bd83h@bedford.waii.com> 
wrote:

:The main (and probably only) things I use Object Desktop for are the
:enhanced folders and the zip/rar/etc archive utilities. I already use
:Xfolder and can therefore do away with the OD enhanced folders. However,
:it is the zip/rar/etc archive utilities which I'd miss the most should I
:uninstall OD. Are there any decent alternatives to this functionality of
:OD where an archive is shown and treated in a similar way to a normal
:folder, and files can be dragged and dropped to or from the archive?

 I like Warpzip. It doesn't treat zip files as folders, but it is 
quite functional, and it also supports OS/2 packed files, if that 
makes a difference to you. The author, Wayne Swanson, is responsive as
much as he can be (I understand he's a busy guy).

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          16-Oct-99 14:13:28
  To: All                                               16-Oct-99 14:29:07
Subj: Re: CHKDSK problem 

From: piquant00@uswestmail.net (Annie K.)

On Fri, 15 Oct 1999 18:06:42, doug.bissett"at"attglobal.net (Doug 
Bissett) wrote:

:I see (from another post) that you figured out your problem. I just 
:wanted to emphasize that "/F", is used on a FAT formatted drive, while
:"/F:2" is used on a HPFS formatted drive.

 Chkdsk /f and chkdsk /f:2 are equivalent.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: wkim@bellatlantic.net                             16-Oct-99 15:37:11
  To: All                                               16-Oct-99 14:29:07
Subj: NS 4.61 - Sorting mail folders

From: Wonkoo Kim <wkim@bellatlantic.net>

In Netscape Communicator 4.61, newly created mail subfolders are 
appended at the bottom of a folder.  How can I change the order 
of mail subfolders?  Until the v4.04, I could manually change
the order of subfolders by dragging a subfolder with the right 
mouse button.  I had a thin line between two adjacent subfolders
as destination while dragging, but now this new version doesn't 
give me such a thin line but only a subfolder highlighted.
How can I sort the subfolders by their name?

Thanks.

// ------------------------------------------------------------------
// Wonkoo Kim <wkim@bellatlantic.net>
// http://members.bellatlantic.net/~wkim

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: centus@coqui.net                                  16-Oct-99 16:19:25
  To: All                                               16-Oct-99 16:44:01
Subj: Java 1.1.8 -Manual Installation-, Is this right?

From: centus@coqui.net

Hi

I am unable to install java 1.1.8 through the normal mechanism.  I 
have WArp v4, Communicator 4.61 (latest) and FP #11.  The problem is 
that the install program 
the HTML pages don't display properly the check boxes for the various 
JAVA 11 components.  I use SDD beta 7 with an ATI Fury 128 AGP card.

Because I have a backup of the complete JAVA11 directory, I am trying 
a manual installation making the appropiate changes in the config.sys 
path and other settings. My question is, This is right? .

I don't know HOW to do the folders on the WPS.  I hope JAVA don't 
requires settings in the INI files or registry ones.

Could some kind person tell me How to complete a MANUAL installation 
or HOW could be the problem with the Feat 1.2.5, Comm 4.61 and SDD 
beta 7.

Thanks

Edfel Rivera

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: mkyuen@attglobal.net                              16-Oct-99 17:13:15
  To: All                                               16-Oct-99 16:44:01
Subj: Set Win-OS2 font to be small

From: mkyuen@attglobal.net

Hi, all,

I'm running my PM in 1024 x 768.  It seems that Win-os2 automatically sets
its font size to be large at that resolution.  I'd like to know how I can set
it
to be small, since some of my software requires this setting.
The "Win-OS2 Setting" in the Main group leaves only the `Network Setting'
there.  I tried running the PM in 800 x 600 and things went fine but
everything 
looks too big:<

Any suggestion is welcome.

M.K.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: michael.warmuth@wu-wien.ac.at                     16-Oct-99 19:16:11
  To: All                                               16-Oct-99 16:44:01
Subj: Solved: NS 4.61 uses 100% CPU 

From: Michael Warmuth <michael.warmuth@wu-wien.ac.at>

> > In message <ogfvnruiay.fjiwnq0.pminews@martin> - "Martin Bartelds"
> > <bts@iaehv.nl>Wed, 13 Oct 1999 00:04:38 +0200 (CDT) writes:
> > :>
> > :>A lot of sites do contain animations. Loading such a site
> > :>with Netscape 4.61 gives a 100% CPU load and a stalled
> > :>Netscape.
> > :>
> > :>Giving a "Stop animations" solves this problem, however
> > :>the page loading also stops.
[...]

The problem are not the animations. You can get this behaviour on 
complex pages without animated GIFs.


Here is a description of the problem:

When downloading a page with NS 4.04 or 4.61 all of a sudden CPU 
utilization goes to 100%. The CPU meter and the watch in WarpCenter 
stop. Netscape itself responds to user interaction absolutely normal 
(e.g. opening a menu or the preferences dialog) and the process 
indicator of NS works smoothly. In most cases, opening the preferences 
dialog and keeping it open until the pages is completely loaded brings 
down the CPU utilization to normal values. If you switch to another 
applications while this problem occurs there is a high chance that the 
system stalls completely with the need to reboot.

This problem is very similar to the '100% CPU load while calculating 
complex tables' problem. The big difference is, that the latter is not 
a real bug - there is no system stability problem. While the table is 
rendered NS's interface is not very responsive (e.g. the status 
information stops and jumps a lot), and after completing the table the 
system reverts to a normal state.


The environment:

Only under special circumstances the problem occurs. This is the 
reason why many people (and IBM) don't seem to be able to reproduce 
this. First you need a complex page. Then your system has to be 
configured like this:

+ You use a proxy on the same machine (like WBI).

+ You have a DNS running on the same computer (like BIND).

+ You use a 32bit TCP/IP stack (e.g. TCP/IP 4.1 or MPTS WR8610 or 
WR8620).

I am not quite sure if all of the above is required to run into the 
problem. Nor do I know if this happens if you use another proxy (like 
SQUID) or another nameserver.


The solution:

If you use a local proxy there is a high chance that you have turned 
off the file cache within NS since this would be a second time caching 
beside what the proxy does. Most likely you have turned on the memory 
cache of NS so that pages visited in a session will be redisplayed 
faster (e.g. when using the back button). To cure the problem you now 
should do this:

TURN OFF NETSCAPE'S MEMORY CACHE!!! (set it to 0)

The drawback is, that animations will only run once. Configuring the 
file cache, so that it holds some amount of data (e.g. 1 to 2 MB) will 
bring back the animations.


I hope this clarifies the situation and solves a problem some of you 
encountered.

Greetings
Michael

-- 
Michael Warmuth                   Austria  - The place in the 
http://www.os2forum.or.at/        heart of Europe where no 
http://www.osiconsult.co.at/      kangaroos are hopping around





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Customer of EUnet Austria (1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    16-Oct-99 11:50:23
  To: All                                               16-Oct-99 16:44:01
Subj: Bios/Large HD Install Question

From: "seth berk" <snberk@ibm.net>

Hello:

I hope you Gurus will tolerate an slightly off topic post. 

I recently upgraded my computer system from an old P90 system to a
350 PII one by moving the hard-drives (a 2 gig and a 1 gig) and other
useful cards from the old box to the new box.  No problems there. 
OS/2 handled it beautifully.  However...   Now the computer store has
convinced me that I should turn the old P90 box into a Linux box, and
sold me the required hardware which included an 8 gig Harddrive
(Smallest one they had on the shelves!  By the way did you see that
IBM is now selling a *73*!!! Gig HD??).  I am using Warp 4 FP11.

Of course before I install Linux I need to install OS/2.  (I am a
Linux idiot, so I want something familiar to fall back on).  Problems
now.

1)  The Bios won't  auto detect past 2 gigs.  It has 3 settings for a
2 gig HD (normal, Large, LBA),  if I can partition the HD to an
intial 2 gig size, can I use the Bios anyway?  It is an old (1995)
Award Bios.

I have updated the OS/2 Install diskettes with the FDISK and
IBM1S506.ADD on my boot partition.  I am hoping that if I can install
OS/2 in the first 1024 cylinders that it will look beyond the 2 gigs
that the BIOS is limited to.  Is this right?

My thinking is that if I can get BootManager and/or LILO to install
in the first part of the HD then I can install Data and Swap
partitions in the other part.

Anything else I need to do or watch out for?

Is there a central repository for BIOS updates if I can't find my
Mother Board's manufacturer?

Thanks for listening to this OT post - I have come to trust the
advice given here, and didn't want to start with a new NG.

Seth

(could you cc any replies to this weekend to snberk@ibm.net please? 
I won't be able to check NGs until monday.  Thanks again)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: gmcleod@idirect.com                               16-Oct-99 19:06:25
  To: All                                               16-Oct-99 16:44:01
Subj: IBM CAD

From: "gordon mcleod" <gmcleod@idirect.com>

Looking for a copy of IBM CAD (not Cad3x) for OS2
gordon mcleod



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: roenigk@ibm.net                                   16-Oct-99 14:24:24
  To: All                                               16-Oct-99 16:44:01
Subj: Slow system response/font mixup after Netscape/Java 1.1.8 install

From: John Roenigk <roenigk@ibm.net>

I'm experiencing a very slow system response to commands after having
installed Netscape 4.61 with strong encryption and Java 1.1.8 from
Indelible Blue's WarpUp CD. There were a couple of botched installs then
finally (success?) after having read through the thread here on "Java
install failure". Accompanying this slowness is a whirring sound from
what I believe to be the hard drive, kind of like the whir of a jet
engine, only quieter. Cursor response is slowed during, for example, the
typing of this note.

I noticed that the font had changed briefly on WarpCenter from Helv 10
to something larger and bolder and that the font in my IBM Dialer had
changed likewise from Helv 10 to something larger and bolder. Also, the
fonts in my font palette do not correspond to those displayed: 10 Helv
is displayed as 12 Helv, there are two 12 Helv, one at 10 and one at 14,
14 Helv is displayed at 10...

There was some confusion in one of the earlier unsuccessful installs
wherein my FI.INI file that had some INV_UniCode statements pointing at
large graphic files in on a completely unrelated data drive and
directory. The following statements in my FI.INI file might be relevant
to this:

INV_Unicode     : Unable to resolv 36A1E
INV_UnicodeConfig : Unable to resolv 3357D
INV_Unifont     : D:\OS2\INSTALL\INSTALLED FEATURES\JAVA 1.1.001\8
UNIFON
INV_TTEngine    : Unable to resolv 3C859
INV_TTEngineConfig : Unable to resolv 3630E
INV_UnifontConfig : D:\OS2\INSTALL\INSTALLED FEATURES\JAVA 1.1.001\8
UNIFON\UNIFONT

Any ideas as to what is going on here?

Help greatly appreciated!

John Roenigk, Austin, Texas

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: heloman@my-deja.com                               16-Oct-99 19:40:20
  To: All                                               16-Oct-99 16:44:01
Subj: StarOffice 5.1

From: heloman@my-deja.com

While I don't wish to look a gift horse in the mouth or be
critical of any product/vendor producing for OS/2 I need a
little help with StarOffice 5.1  Having only been able to 'play'
with it for a few days it appears the "HELP" portion is either
very lacking and user unfriendly or I am not in tune with being
able to use it. I was trying to import a file/export a file with
conversion to other format(s) and delete a previously saved
file. Trying to get this information from help was about as
helpful as the error msg from os/2 when trying to format a
floppy (and you find it is write protected). Is there a printed
document, PDF or can someone plese tell me how to get the
information from it in a more useable form. I thank anyone for
their response.....


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   16-Oct-99 14:02:17
  To: All                                               16-Oct-99 16:44:01
Subj: Re: StarOffice 5.1

From: Kris Kadela <kris@dgraph.com>


heloman@my-deja.com wrote:
> 
> While I don't wish to look a gift horse in the mouth or be
> critical of any product/vendor producing for OS/2 I need a
> little help with StarOffice 5.1  Having only been able to 'play'
> with it for a few days it appears the "HELP" portion is either
> very lacking and user unfriendly or I am not in tune with being
> able to use it. I was trying to import a file/export a file with
> conversion to other format(s) and delete a previously saved
> file. Trying to get this information from help was about as
> helpful as the error msg from os/2 when trying to format a
> floppy (and you find it is write protected). Is there a printed
> document, PDF or can someone plese tell me how to get the
> information from it in a more useable form. I thank anyone for
> their response.....
> 

Help in StarOffice really sux. On the other hand, just open the file and
save as a different format.

> Sent via Deja.com http://www.deja.com/
> Before you buy.

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   16-Oct-99 14:09:10
  To: All                                               16-Oct-99 16:44:01
Subj: Re: Set Win-OS2 font to be small

From: Kris Kadela <kris@dgraph.com>


mkyuen@attglobal.net wrote:
> 
> Hi, all,
> 
> I'm running my PM in 1024 x 768.  It seems that Win-os2 automatically sets
> its font size to be large at that resolution.  I'd like to know how I can
set it
> to be small, since some of my software requires this setting.
> The "Win-OS2 Setting" in the Main group leaves only the `Network Setting'
> there.  I tried running the PM in 800 x 600 and things went fine but
everything
> looks too big:<
> 
> Any suggestion is welcome.
> 
> M.K.

This is controlled by the display driver. I find this very annoying too
as some drivers use nice small fonts.
One thing to check is that in the system.ini fonts are set to:

fixedfon.fon=vgafix.fon
oemfonts.fon=vgaoem.fon

and in win.ini

MS Scans Serif 8,10,12,14,18,24 (vga res)=sserife.fon
MS Sans Serif 8,10,12,14,18,24 (VGA res)=sserife.fon
Courier 10,12,15 (vga res)=coure.fon
MS Serif 8,10,12,14,18,24 (vga res)=serife.fon
Symbol 8,10,12,14,18,24 (vga res)=symbole.fon
Small Fonts (vga res)=smalle.fon



-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: swsnyder@home.com                                 16-Oct-99 20:20:29
  To: All                                               16-Oct-99 19:52:07
Subj: Upgrade PMMail from v2.0 to v2.1?

From: "Steve Snyder" <swsnyder@home.com>

Where to we registered PMMail v2.0 users stand in relation to PMMail 
v2.1?  Is it a free upgrade?  Cheap upgrade?  Total new product?

Do I just installed the new version over my existing PMMail v2.0 
installation?

And, in case there's not enough question marks in the above text, why
has SouthSoft's Web site not been updated to reflect these new
goings-on?


***** Steve Snyder *****



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: helle05@ibm.net                                   16-Oct-99 13:20:20
  To: All                                               16-Oct-99 19:52:07
Subj: Re: Java 1.1.8 -Manual Installation-, Is this right?

From: "Thomas A. Heller" <helle05@ibm.net>

Since I just overcame suffering several rounds of
failed installs of Java 1.1.8 using N/S 461 and
Feature Install 1.25, let me try to advise you.  The
problem with check boxes not appearing has nothing
to do with video cards.  (I don't know what the SDD
beta 7 is, but I suspect it also has nothing to do
with your problem either.)

First, make *absolutely certain* you have the GA
version of N/S 461.  That was the root of my
inability to complete installation of 1.1.8. (For
instance, check in the unzipped Netscape directory
for the NS46DRAG.dll file; it should show the date
9/16/99.  The NS461 zip file I downloaded 9/24/99
had this file at 8/12/99!)

That alone may get you what you need.  But you may
want to update to FixPak 12 also (that's where I'm
at.)

Once I got the correct version of N/S 461 up, the
Java install went just fine.  

(You may wish to remove all references to Java in
your Config.sys file before installing 1.1.8, but
I'm not certain that is necessary.)

I am also presuming you have the Feature Install v
1.25 in its own [x:}\Feature\Fisetup directory tree
and that you have run Fisetup.exe.


centus@coqui.net wrote:
> 
> Hi
> 
> I am unable to install java 1.1.8 through the normal mechanism.  I
> have WArp v4, Communicator 4.61 (latest) and FP #11.  The problem is
> that the install program
> the HTML pages don't display properly the check boxes for the various
> JAVA 11 components.  I use SDD beta 7 with an ATI Fury 128 AGP card.
> 
> Because I have a backup of the complete JAVA11 directory, I am trying
> a manual installation making the appropiate changes in the config.sys
> path and other settings. My question is, This is right? .
> 
> I don't know HOW to do the folders on the WPS.  I hope JAVA don't
> requires settings in the INI files or registry ones.
> 
> Could some kind person tell me How to complete a MANUAL installation
> or HOW could be the problem with the Feat 1.2.5, Comm 4.61 and SDD
> beta 7.
> 
> Thanks
> 
> Edfel Rivera

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            16-Oct-99 22:36:10
  To: All                                               16-Oct-99 19:52:07
Subj: Re: trouble with DeScribe and PS printer driver

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Sat, 16 Oct 1999 11:28:27 +0100 (CET), Menno Tillema wrote:

>On Sun, 10 Oct 1999 22:23:06 +0300 (EES), Esko Kauppinen wrote:
>
>>Too simple..hmm ?  I tried to use this pdfwrite.pdr but no luck.
>>
>>- I installed a postscript driver ( Apple laser one ).  OK
>>- installed the pdfwrite.pdr as a new port. It reports that all 
>>   selected ports were successfully installed but it does not show 
>>   anywhere. Have tried MANY times but always the same.
>
>The docs state that installing the port driver twice should be enough. It
>worked here anyway.
>
>Select the properties of the new installed postscript printer and look at the
>tab "Output Port". There you should find the PDF port driver. Change the
>settings with RMB.

Yes I have it now. I had the problem which many seemed to have that
I didn't get any PDF port driver icon to the Output port window.

The fixed version installed OK.

Still haven't got anything successfully printed but it could be
that I have something still wrong.

Thanks for your reply / Esko


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: gsahca@newulmtel.net                              16-Oct-99 15:41:08
  To: All                                               16-Oct-99 19:52:07
Subj: Re: 1999 tax preparation software for OS/2???

From: Herb & Gloria Anderson <gsahca@newulmtel.net>

This is a multi-part message in MIME format.
--------------AAF133DDE53B29E852A26863
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit

AM-Tax, a DOS program, works well in OS/2.

http://www.amtax.com

--------------AAF133DDE53B29E852A26863
Content-Type: text/x-vcard; charset=us-ascii;
 name="gsahca.vcf"
Content-Transfer-Encoding: 7bit
Content-Description: Card for Herb & Gloria Anderson
Content-Disposition: attachment;
 filename="gsahca.vcf"

begin:vcard 
n:Anderson;Herb & Gloria
x-mozilla-html:FALSE
version:2.1
email;internet:gsahca@newulmtel.net
x-mozilla-cpt:;0
fn:Anderson, Herb & Gloria
end:vcard

--------------AAF133DDE53B29E852A26863--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Onvoy (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             16-Oct-99 14:13:21
  To: All                                               16-Oct-99 19:52:07
Subj: Re: 1999 tax preparation software for OS/2???

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Sat, 16 Oct 1999 15:38:12 -0400, Herb & Gloria Anderson wrote:

>AM-Tax is a DOS program that runs well in DOS.  I used it last year and
>reordered it for 1999.

Unfortunately, this may be (probably WILL be) the last year for AM-Tax.
They say they're only going to offer a Windows98 version for next year
due to problems getting support for DOS these days. I pointed them at
Caldera and OpenDOS but I've heard nothing back from them. Anyone else
checking into AM-Tax, please do the same and hopefully we'll still be
able to use it in OS/2 in the future.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: virobik@MAPS.onr.com                              16-Oct-99 21:19:12
  To: All                                               16-Oct-99 19:52:07
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: virobik@MAPS.onr.com

On Sat, 16 Oct 1999 20:20:59, "Steve Snyder" <swsnyder@home.com> 
wrote:

> Where to we registered PMMail v2.0 users stand in relation to PMMail 
> v2.1?  Is it a free upgrade?  Cheap upgrade?  Total new product?
> 
> Do I just installed the new version over my existing PMMail v2.0 
> installation?
> 
> And, in case there's not enough question marks in the above text, why
> has SouthSoft's Web site not been updated to reflect these new
> goings-on?
> 
> 
> ***** Steve Snyder *****
> 
> 
> 

Because PMMail is no longer Southsoft's product. It's development and 
support has been taken over by another firm.

kevin

virobik@MAPS.onr.com
Please remove "MAPS." when replying

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Onramp Access, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: sma.spam-not@rtd.com                              16-Oct-99 21:46:02
  To: All                                               16-Oct-99 19:52:08
Subj: Re: os2 as cleint to linux samba really slow compared to win95

From: James Moe <sma.spam-not@rtd.com>


Sean Hennessy - Geishan wrote:
> 
> I'm in the act of setting up a small network (7 stations) to replace an
> os/2 peer server with linuxand samba.  The workstations are mainly os/2
> but with 2 win machines(1 95; 1 NT).
> 
> Problem.
> current access for a particular page:
>     using os/2 server = 3.5 secs - All machines
>     using Samba = 3 secs windows   = 22 secs OS/2
> 
> Now 22 secs is just a little bit on the slowwww side.
> 
> This reeks of an adjustment somewhere, but I'm just not cluey enough to
> know what it is.
> 

    Have you tried the Linux networking newsgroup(s)? They are a helpful
bunch.


-- 

sma at rtd dot com
Remove ".spam-not" for email

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sohnen-Moe Associates, Inc (1:109/42)

+----------------------------------------------------------------------------+

From: dtander@agts.net                                  16-Oct-99 22:15:01
  To: All                                               16-Oct-99 21:21:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: dtander@agts.net (David T. Anderson)

On Sat, 16 Oct 1999 20:20:59, "Steve Snyder" <swsnyder@home.com> 
wrote:

> Where to we registered PMMail v2.0 users stand in relation to PMMail 
> v2.1?  Is it a free upgrade?  Cheap upgrade?  Total new product?
> 
> Do I just installed the new version over my existing PMMail v2.0 
> installation?

I threw caution to the winds today and simply installed 2.1 into my 
PMMail directory...all went well....I lost no data, and my 
registration info was untouched.  So -- I would call this a free 
upgrade.  Exactly what it upgrades I'm not sure about...there didn't 
seem to anything in the readme file to indicate new or improved 
features [but then I was just home after working a nightshift, so my 
consciousness was slightly altered...].


> And, in case there's not enough question marks in the above text, why
> has SouthSoft's Web site not been updated to reflect these new
> goings-on?

Well, obviously SouthSoft has sold PMMail to BluePrint Software Works,
so looking at the SouthSoft pages won't tell you too much.  I dunno if
this is a good thing or a bad thing, but I guess time will tell.

While I will be forever grateful to Bob Novitsky for creating PMMail 
(I happened on an early beta just as my frustration with UltiMail Lite
was reaching a climax) I must say that I don't much admire SouthSoft's
behavior over the last few months.  Bob and Icon used to frequent the 
newsgroups, and keep their webpages up-to-date, but lately we've been 
starved for news and  [according to some] support.  Given that email 
is the #1 application for the Net, people care _a lot_ about their 
email apps, and I think it behooves the creator of a popular email app
to keep his/their customers in the loop.

Anyhow, it looks like we now have BluePrint to deal with...I hope 
they'll be more open than SouthSoft has been....  

David T. Anderson
Calgary, Alberta
http://www.agt.net/public/dtander/

Using ProNews/2 for OS/2 Warp

**NOSPAM**  To email me, remove the 's' from my address...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rlwalsh@packet.net                                16-Oct-99 22:24:00
  To: All                                               16-Oct-99 21:21:02
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: rlwalsh@packet.net (Rich Walsh)

On Sat, 16 Oct 1999 19:16:23, Michael Warmuth <michael.warmuth@wu-wien.ac.at>
wrote:
> > > In message <ogfvnruiay.fjiwnq0.pminews@martin> - "Martin Bartelds"
> > > <bts@iaehv.nl>Wed, 13 Oct 1999 00:04:38 +0200 (CDT) writes:
> > > :>
> > > :>A lot of sites do contain animations. Loading such a site
> > > :>with Netscape 4.61 gives a 100% CPU load and a stalled
> > > :>Netscape.
> > > :>
> > > :>Giving a "Stop animations" solves this problem, however
> > > :>the page loading also stops.
> [...]
> 
> The problem are not the animations. You can get this behaviour on 
> complex pages without animated GIFs.
> 
> Here is a description of the problem:
> 
> When downloading a page with NS 4.04 or 4.61 all of a sudden CPU 
> utilization goes to 100%. The CPU meter and the watch in WarpCenter 
> stop. Netscape itself responds to user interaction absolutely normal 
> (e.g. opening a menu or the preferences dialog) and the process 
> indicator of NS works smoothly.
> 
[extraneous factors snipped]
> 
> The solution:
> If you use a local proxy there is a high chance that you have turned 
> off the file cache within NS since this would be a second time caching 
> beside what the proxy does. Most likely you have turned on the memory 
> cache of NS so that pages visited in a session will be redisplayed 
> faster (e.g. when using the back button). To cure the problem you now 
> should do this:
> 
> TURN OFF NETSCAPE'S MEMORY CACHE!!! (set it to 0)

By George, he's got it!!! (or pretty close).  I did a bunch of testing
that seems to confirm that the problem lies in the interaction between
the disk and memory caches.  If you have a memory cache but no disk cache,
you'll get 100% CPU usage.  Setting memory cache to zero _or_ reenabling
a nominal disk cache solves the problem.

The other factors that Michael mentioned (which I snipped, i.e. a 32-bit
stack, a DNS running on your system) appear not to be relevant.  Use of
a proxy is only relevant to the extent that its use is what would prompt
you to set disk caching to zero.

FWIW, I wanted to retain my 2mb memory cache, so I set the disk cache
at 64kb.  When I had it at 1kb, there was nonstop disk activity as
NS kept filling and emptying it.  You'll probably want to set yours
to the size of a typical web page.

Thanks, Michael!


   == == almost usable email address:  rlwalshATpacket.net == ==
___________________________________________________________________

                |             - DragText v3.1 -
Rich Walsh      |  A Distinctly Different Desktop Enhancement
Ft Myers, FL    |  New!  Pickup & Drop for text, and more...
                |  http://www.usacomputers.net/personal/rlwalsh/
___________________________________________________________________

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://extra.newsguy.com (1:109/42)

+----------------------------------------------------------------------------+

From: !2020hindsight@usa.net                            16-Oct-99 20:17:17
  To: All                                               16-Oct-99 21:21:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: !2020hindsight@usa.net (Bill Clark)

David T. Anderson wrote:

> I threw caution to the winds today and simply installed 2.1 

Where does one find 2.1?

TIA!

-bc-
 
User Friendly Software:
  That which makes friends among those trying to use it
	

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  16-Oct-99 20:18:23
  To: All                                               17-Oct-99 03:47:11
Subj: Re: Java 1.1.8 -Manual Installation-, Is this right?

From: mchasson@ibm.net

In <bMdIjtzv3XGu-pn2-7QIusJZOvxeI@ppp-196-42-34-159.coqui.net>, on
10/16/99 at 04:19 PM,
   centus@coqui.net said:

>Hi

>I am unable to install java 1.1.8 through the normal mechanism.  I  have
>WArp v4, Communicator 4.61 (latest) and FP #11.  The problem is  that the
>install program 
>the HTML pages don't display properly the check boxes for the various 
>JAVA 11 components.  I use SDD beta 7 with an ATI Fury 128 AGP card.

>Because I have a backup of the complete JAVA11 directory, I am trying  a
>manual installation making the appropiate changes in the config.sys  path
>and other settings. My question is, This is right? .

>I don't know HOW to do the folders on the WPS.  I hope JAVA don't 
>requires settings in the INI files or registry ones.

>Could some kind person tell me How to complete a MANUAL installation  or
>HOW could be the problem with the Feat 1.2.5, Comm 4.61 and SDD  beta 7.

>Thanks

>Edfel Rivera

You know I could not make it work either until...I put everything into the
directory structure they show in the readme including the same names.

Then I ran FIsetup again and then ran install in the Java directory and
all is well. -- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             16-Oct-99 21:38:24
  To: All                                               17-Oct-99 03:47:11
Subj: Seagate SCSI  tape drive  problems

From: Alan Beagley <abeagley@datatone.com>

I have an Archive/Conner/Seagate SCSI tape drive (actually an
autoloader: Archive model 4586NP) that worked fine on the SCSI port of a
SoundBlaster 16 SCSI-2 card in my old computer. Connected to the 50-pin
connector of my Asus P2B-LS (on-board Adaptec U2W SCSI), I got an
appalling number of "CRC mismatch" errors when I tried to verify/compare
the backup -- IOW, the data on the tape was corrupt (and I established
that this was true by restoring some reportedly corrupt .zip and .rar
files and finding that they did not pass the test using the -t or t
parameters).

I tried a PCI SCSI card with a Symbios Logic chip and found that things
were not a whole lot better.

The old SoundBlaster SCSI card is no longer available to try, but I did
try several backups using an ancient 8-bit ISA-bus Trantor T130B. Not a
single error! The problem is, of course, that using this card "pins" the
CPU meter, and it is impossible to do anything else much with the
computer while a backup is running.

The operating system is OS/2 Warp 4 (with the latest fixes), and the
backup software is Back Again/2 Professional ver. 4.0i by Computer Data
Strategies.

The on-board Adaptec SCSI seems to have no problems with the U2W hard
disk, or with the SCSI-2 CD-ROM and Syquest drives

Any ideas?

Alan


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: tiemannj@gmx.de                                   17-Oct-99 01:44:21
  To: All                                               17-Oct-99 03:47:11
Subj: Re: OD - alternatives?

From: Joerg Tiemann <tiemannj@gmx.de>

On Fri, 15 Oct 1999 17:34:00 +0100, Steve Drewell wrote:
> The main (and probably only) things I use Object Desktop for are the
> enhanced folders and the zip/rar/etc archive utilities. [...] 
> Are there any decent alternatives to this functionality of
> OD where an archive is shown and treated in a similar way to a normal
> folder, and files can be dragged and dropped to or from the archive?

  I'm not familiar with OD and its' features, so this is a wild guess. 
On hobbes (and probably pretty much everywhere else) there is an archive
named af0_32b.zip.  The File_ID.DIZ:

# AF - The Archive Folder, v. 0.32.
# 32-bit, multithreaded PM archive
# manager. Supports EA's and Drag'n'Drop.
# Simulates a standard WPS folder.
# Uses the ARCHIVER.BB2 file format.
# Includes Archive Registry to define new archivers.
# FreeWare.

	HTH, Joerg
-- 
"History shows that Microsoft can be beaten." 
 -- John C. Dvorak, September 10, 1996 PC Magazine

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Heinrich Heine Universitaet Duesseldorf (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       17-Oct-99 03:05:04
  To: All                                               17-Oct-99 03:47:12
Subj: Re: Current Java?

From: Will Rose <cwr@cts.com>

Lorne Sunley <lsunley@mb.sympatico.ca> wrote:
: On Fri, 15 Oct 1999 09:50:28, Will Rose <cwr@cts.com> wrote:

:> I haven't kept current with OS/2 and Java.  What's the current level
:> of Java available under Warp 4.0?  Is it automatically updated in
:> the Warp 4.0 Fixpacks?  If not, where are updates to be found?
:> 
:> 

: The current GA release of Java for Warp 4 (and all the other
: Warp platforms) is version 1.1.8. You can download it from
: Software Choice (do it now because Software Choice will
: be "paid subscription only" as of January 1 2000).

: URL http://www-4.ibm.com/software/os/warp/swchoice/

: While you're there you can also download the latest
: Feature Installer (version 1.2.5) and the GA Netscape
: 4.61 release as well. The FI is "required" (I think) to
: install the 1.1.8 version of Java.

: There is also a set of patches to 1.1.8 that is available
: at the Husley FTP site that you might want to apply.

: URL ftp://ftp.hursley.ibm.com/pub/java/fixes/os2/11/118/

Thanks.  I'll pick them up asap.  I've dug around a bit, and the
only (free) stuff I can't get at that I might need is the JavaBeans
release 1.0.  What are JavaBeans?


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          17-Oct-99 10:59:09
  To: All                                               17-Oct-99 03:47:12
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

I just installed it over PMMail/2 and clicking on "Help - About" shows
it's registered to me. The help still mentions something about it being
shareware and limited (Can't print, etc) but it printed to Faxworks so I
guess it's OK.

Cheers

Wayne


On Sat, 16 Oct 1999 20:20:59 GMT, Steve Snyder wrote:

:>Where to we registered PMMail v2.0 users stand in relation to PMMail 
:>v2.1?  Is it a free upgrade?  Cheap upgrade?  Total new product?
:>
:>Do I just installed the new version over my existing PMMail v2.0 
:>installation?
:>
:>And, in case there's not enough question marks in the above text, why
:>has SouthSoft's Web site not been updated to reflect these new
:>goings-on?
:>
:>
:>***** Steve Snyder *****
:>
:>
:>

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
  Running on OS/2 Warp 4 (UK)  + FixPak 9
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          17-Oct-99 11:02:04
  To: All                                               17-Oct-99 03:47:12
Subj: Re: Set Win-OS2 font to be small

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

It can depend on what video card you're using. I have a Matrox
G400 and the drivers allow you to choose either large or small
text for OS/2 and Win-OS/2 apps independantly. 

Cheers

Wayne


On 16 Oct 1999 17:13:31 GMT, mkyuen@attglobal.net wrote:

:>Hi, all,
:>
:>I'm running my PM in 1024 x 768.  It seems that Win-os2 automatically sets
:>its font size to be large at that resolution.  I'd like to know how I can
set it
:>to be small, since some of my software requires this setting.
:>The "Win-OS2 Setting" in the Main group leaves only the `Network Setting'
:>there.  I tried running the PM in 800 x 600 and things went fine but
everything 
:>looks too big:<
:>
:>Any suggestion is welcome.
:>
:>M.K.

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
  Running on OS/2 Warp 4 (UK)  + FixPak 9
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: isaacl@bulls.ece.ubc.ca                           17-Oct-99 04:35:28
  To: All                                               17-Oct-99 03:47:12
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: isaacl@bulls.ece.ubc.ca (e-frog)

Steve Snyder (swsnyder@home.com) wrote:
: Where to we registered PMMail v2.0 users stand in relation to PMMail 
: v2.1?  Is it a free upgrade?  Cheap upgrade?  Total new product?
	According to the info via the PMMail list, it is a _free_ upgrade
to v2.0
I installed it right over my v2.0 and it remains to be registered, so I'll
assume that to be true.
	Other than a new icon, and possibly some invisible bug fixes,
feature changes, it is nearly the same as v2.0
	PMMail has been taken over by another software company that is
promising to take care of it.

: Do I just installed the new version over my existing PMMail v2.0 
: installation?

: And, in case there's not enough question marks in the above text, why
: has SouthSoft's Web site not been updated to reflect these new
: goings-on?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ITServices, University of British Columbia (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          17-Oct-99 04:35:26
  To: All                                               17-Oct-99 03:47:12
Subj: Re: Bios/Large HD Install Question

From: piquant00@uswestmail.net (Annie K.)

On Sat, 16 Oct 1999 18:50:47, "seth berk" <snberk@ibm.net> wrote:

[snip]

: The Bios won't  auto detect past 2 gigs. 

[snip]

 Why not see if there's a BIOS update for it? Might be the best 
solution.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          17-Oct-99 04:39:17
  To: All                                               17-Oct-99 03:47:12
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: piquant00@uswestmail.net (Annie K.)

On Sun, 17 Oct 1999 01:17:34, !2020hindsight@usa.net (Bill Clark) 
wrote:

:Where does one find 2.1?

 Hobbes /incoming, http://hobbes.nmsu.edu/pub/incoming

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: tgarson@auraltekihatespam.com                     16-Oct-99 22:58:11
  To: All                                               17-Oct-99 05:16:23
Subj: Re: os2 as cleint to linux samba really slow compared to win95

From: "Tom Garson" <tgarson@auraltekihatespam.com>

On Sat, 16 Oct 1999 21:46:05 GMT, James Moe wrote:

>
>
>Sean Hennessy - Geishan wrote:
>> 
>> I'm in the act of setting up a small network (7 stations) to replace an
>> os/2 peer server with linuxand samba.  The workstations are mainly os/2
>> but with 2 win machines(1 95; 1 NT).
>> 
>> Problem.
>> current access for a particular page:
>>     using os/2 server = 3.5 secs - All machines
>>     using Samba = 3 secs windows   = 22 secs OS/2
>> 
>> Now 22 secs is just a little bit on the slowwww side.
>> 
>> This reeks of an adjustment somewhere, but I'm just not cluey enough to
>> know what it is.
>> 
>
>    Have you tried the Linux networking newsgroup(s)? They are a helpful
>bunch.

I'm doing the same thing (Linux serving Warp via Samba) and had the same
experience. I thought it was a network or client problem, but was wrong. Once
I got samba correctly setup, everything began to work wonderfully. A word of
caution, I don't trust "swat" to correctly configure Samba. Once I studdied
the available docs and subsequently set up samba.conf by hand things went
vastly better. Among other good resources, there is a website called
www.Troubleshooters.com that you should check out.

Tom



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Aural Technology (1:109/42)

+----------------------------------------------------------------------------+

From: beve@dds.nl                                       17-Oct-99 08:59:06
  To: All                                               17-Oct-99 05:16:23
Subj: help!!! PGCC is not working

From: "G. van der Veer" <beve@dds.nl>

Hi,

When I run any program (for example Squid) compiled in PGCC 1.1.3 or
below I get the following message:

SYS0191: GCC29166 cannot be run in an OS/2 session.

I installed the files which i got from http://www.goof.com/pcg/os2/
according the instructions.
I have ensured myself that all paths are in the path and libpath in my
config.sys (and of course EMX 0.9D fix 2 had already been installed).
When I toggle of protectonly it does not work either, so gcc29166.dll is
not a dos-executable either.  Maybe I need to install XFree86 for the
runtime libraries?

current system:

Processor:              Intel Pentium II 350 MHz
Motherboard:        Gateway 2000
Internal memory:  320 MB
Operating system: OS/2 Aurora

PS. I had the same troubles when using OS/2 Warp 4.0 Fixpak 6 with
earlier versions of PGCC.
I hope that I can get the runtime libraries working. Otherwise I have to
say goodbye till Star Office too  :-(

Another option might be to recompile the sources for PGCC... has anybody
an idea on how to do this?

I hope someone can help me out of this mess,

kind regards,

Berry van der Veer

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET-NL (http://www.nl.uu.net) (1:109/42)

+----------------------------------------------------------------------------+

From: henkvandyk@euronet.nl                             17-Oct-99 10:23:02
  To: All                                               17-Oct-99 10:24:05
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: H van Dyk <henkvandyk@euronet.nl>

"Annie K." wrote:
> 
> On Sun, 17 Oct 1999 01:17:34, !2020hindsight@usa.net (Bill Clark)
> wrote:
> 
> :Where does one find 2.1?
> 
>  Hobbes /incoming, http://hobbes.nmsu.edu/pub/incoming
> 
> --
> Klaatu barada nikto

I don't see any updates available. It looks like
the version number of the program has changed
because the name of the company has changed...

Henk

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EuroNet Internet (1:109/42)

+----------------------------------------------------------------------------+

From: rjf@yyycomasia.com                                17-Oct-99 09:08:07
  To: All                                               17-Oct-99 10:24:05
Subj: Re: OD - alternatives?

From: rjf@yyycomasia.com (rj friedman)

On Fri, 15 Oct 1999 16:34:00, Steve Drewell 
<bd83h@bedford.waii.com> wrote:

The main (and probably only) things I use Object Desktop for are the
enhanced folders and the zip/rar/etc archive utilities. I already use
Xfolder and can therefore do away with the OD enhanced folders. However,
it is the zip/rar/etc archive utilities which I'd miss the most should I
uninstall OD. Are there any decent alternatives to this functionality of
OD where an archive is shown and treated in a similar way to a normal
folder, and files can be dragged and dropped to or from the archive?


I'm like you - I think the OD implementation of archiving is
the best I've ever seen - and have seen nothing else to 
compare with it.

It's the only thing I have of OD left. Having found 
shareware and freeware that does everything OD does - only 
(IMO) lots better, I wiped off OD and only reinstalled the 
archiving function.



________________________________________________________

[RJ]                 OS/2 - Live it, or live with it. 
rj friedman          Team ABW              
Taipei, Taiwan       rjf@yyycomasia.com 

To send email - remove the `yyy'
________________________________________________________

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SEEDNet News Service (1:109/42)

+----------------------------------------------------------------------------+

From: no-one@nospam                                     17-Oct-99 10:18:24
  To: All                                               17-Oct-99 10:24:05
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: no-one@nospam

On Sat, 16 Oct 1999 20:20:59 GMT, "Steve Snyder" <swsnyder@home.com>
wrote:

>Where to we registered PMMail v2.0 users stand in relation to PMMail 
>v2.1?  Is it a free upgrade?  Cheap upgrade?  Total new product?
>
>Do I just installed the new version over my existing PMMail v2.0 
>installation?
>

Version 2.1 is a free upgrade to users of version 2.0     Users of the
1.* series of PMMail/2 will have to purhase an upgrade.   If I read
the docs correctly, if you install 2.1 over an existing 1.* then it
will become an unregistered version.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: kasommer@sherrill.kiva.net                        17-Oct-99 10:25:26
  To: All                                               17-Oct-99 14:29:26
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: kasommer@sherrill.kiva.net (Kim A. Sommer)

In article <YmSPgjx6zsY1-pn2-d6TL4nlrGx4m@pmnet1-65.onr.com>,
 <virobik@onr.com> wrote:
>On Sat, 16 Oct 1999 20:20:59, "Steve Snyder" <swsnyder@home.com> 
>wrote:
>
[snip]
>> 
>> And, in case there's not enough question marks in the above text, why
>> has SouthSoft's Web site not been updated to reflect these new
>> goings-on?
>> 
[snip]
>
>Because PMMail is no longer Southsoft's product. It's development and 
>support has been taken over by another firm.
>

Who took over PMMAil?  Is ther a URL, email, or phone #?

Regards,
Kim
-- 
-------
Kim A. Sommer   
Humans do it Better!  The Open Directory Project - http://dmoz.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Kiva Networking (1:109/42)

+----------------------------------------------------------------------------+

From: centus@coqui.net                                  17-Oct-99 15:52:24
  To: All                                               17-Oct-99 14:29:26
Subj: Re: Java 1.1.8 -Manual Installation-, Is this right?

From: centus@coqui.net

Well, after two days I was able to install 1.1.8 AFTER installing 
1.1.7 over the re-installation I did of OS/2 v4.  Thanks everybody for
the reco's.

Edfel

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: nick@secant.com                                   17-Oct-99 11:52:12
  To: All                                               17-Oct-99 14:29:26
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: Nick Knight <nick@secant.com>

In <3809c00e.82297305@news.omen.net.au>, on 10/17/99 
   at 12:30 PM, zayne@omen.com.au (Mooo) said:

>>upgrade.  Exactly what it upgrades I'm not sure about...there didn't 
>>seem to anything in the readme file to indicate new or improved 
>>features

>There is at least one improvement.  You no longer get black 'blobs' at
>the end of every line when you print an email on an HP LJ :)

That's a relief!  At first I though this might be just some marketing ploy
to try to convince people there is life in the product simply by upping a
version number a full point.

Now, it's completely obvious to me that this was a full maintenance
release :)

Perhaps I'm being too stingy with my release versions increments? <grin>

Nick
-- 
-----------------------------------------------------------
Nick Knight  <nick@secant.com>       http://nick.secant.com
Senior Software Engineer
Secant Technologies, Inc.             http://www.secant.com
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: hharris@netcomuk.co.uk                            17-Oct-99 17:24:22
  To: All                                               17-Oct-99 16:35:05
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: Howard Harris <hharris@netcomuk.co.uk>

On 17 Oct 1999 10:25:53 -0500, kasommer@sherrill.kiva.net (Kim A. Sommer)
wrote:


>Who took over PMMAil?  Is ther a URL, email, or phone #?

http://www.blueprintsoftwareworks.com

--
Howard

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: . (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             17-Oct-99 09:53:08
  To: All                                               17-Oct-99 16:35:05
Subj: Re: Seagate SCSI  tape drive  problems

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Sat, 16 Oct 1999 21:38:48 -0400, Alan Beagley wrote:

>I have an Archive/Conner/Seagate SCSI tape drive (actually an
>autoloader: Archive model 4586NP) that worked fine on the SCSI port of a
>SoundBlaster 16 SCSI-2 card in my old computer. Connected to the 50-pin
>connector of my Asus P2B-LS (on-board Adaptec U2W SCSI), I got an
>appalling number of "CRC mismatch" errors when I tried to verify/compare
>the backup -- IOW, the data on the tape was corrupt (and I established
>that this was true by restoring some reportedly corrupt .zip and .rar
>files and finding that they did not pass the test using the -t or t
>parameters).
>
>I tried a PCI SCSI card with a Symbios Logic chip and found that things
>were not a whole lot better.

I suspect that the problem comes from the tape drive being and old
8-bit SCSI (slow) device. Those old original SCSI devices don't play
well when sharing a controller with any of the newer types of devices.
Did you try it on the SymBIOS controller all by itself? and did you
slow it down to 5M/s?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             17-Oct-99 09:58:16
  To: All                                               17-Oct-99 16:35:05
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Sat, 16 Oct 1999 21:19:25 GMT, virobik@MAPS.onr.com wrote:

>Because PMMail is no longer Southsoft's product. It's development and 
>support has been taken over by another firm.

The press releases I've seen didn't say anything about _development_
being taken over; just publishing and support. I think BoB and Icon are
still doing the development, they're just turning over the marketing
and support -> Blue Print Software like they did with PMINews ->
StarDock.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             17-Oct-99 13:30:14
  To: All                                               17-Oct-99 16:35:05
Subj: Re: Seagate SCSI  tape drive  problems

From: Alan Beagley <abeagley@datatone.com>

Yes, the tape drive is now the only device on the Symbios Logic card, and the
speed is set to 5Mb/s.

A private e-mail from another user tells of using a different Seagate tape
drive with the same motherboard, same operating system and same backup
software without experiencing any problems.

Alan


Doug Darrow wrote:

> On Sat, 16 Oct 1999 21:38:48 -0400, Alan Beagley wrote:
>
> >I have an Archive/Conner/Seagate SCSI tape drive (actually an
> >autoloader: Archive model 4586NP) that worked fine on the SCSI port of a
> >SoundBlaster 16 SCSI-2 card in my old computer. Connected to the 50-pin
> >connector of my Asus P2B-LS (on-board Adaptec U2W SCSI), I got an
> >appalling number of "CRC mismatch" errors when I tried to verify/compare
> >the backup -- IOW, the data on the tape was corrupt (and I established
> >that this was true by restoring some reportedly corrupt .zip and .rar
> >files and finding that they did not pass the test using the -t or t
> >parameters).
> >
> >I tried a PCI SCSI card with a Symbios Logic chip and found that things
> >were not a whole lot better.
>
> I suspect that the problem comes from the tape drive being and old
> 8-bit SCSI (slow) device. Those old original SCSI devices don't play
> well when sharing a controller with any of the newer types of devices.
> Did you try it on the SymBIOS controller all by itself? and did you
> slow it down to 5M/s?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: mcbrides@erols.com                                17-Oct-99 13:43:05
  To: All                                               17-Oct-99 16:35:05
Subj: Re: Java 1.1.8 -Manual Installation-, Is this right?

From: mcbrides@erols.com (Jerry McBride)

In article <38091659$1$zpunffba$mr2ice@news3.ibm.net>, mchasson@ibm.net wrote:
>In <bMdIjtzv3XGu-pn2-7QIusJZOvxeI@ppp-196-42-34-159.coqui.net>, on
>10/16/99 at 04:19 PM,
>   centus@coqui.net said:
>
>>Hi
>
>>I am unable to install java 1.1.8 through the normal mechanism.  I  have
>>WArp v4, Communicator 4.61 (latest) and FP #11.  The problem is  that the
>>install program
>>the HTML pages don't display properly the check boxes for the various
>>JAVA 11 components.  I use SDD beta 7 with an ATI Fury 128 AGP card.
>
>>Because I have a backup of the complete JAVA11 directory, I am trying  a
>>manual installation making the appropiate changes in the config.sys  path
>>and other settings. My question is, This is right? .
>
>>I don't know HOW to do the folders on the WPS.  I hope JAVA don't
>>requires settings in the INI files or registry ones.
>

It doesn't.

>>Could some kind person tell me How to complete a MANUAL installation  or
>>HOW could be the problem with the Feat 1.2.5, Comm 4.61 and SDD  beta 7.
>

I'd be willing to tackle that, with a little help from "you guys". It appears
that the jdk installer simply copies files to the correct locations, adds a
few
entries in the config.sys, creates a folder and some objects on the desktop
and... reboot. The last part, folders and objects, is a piece of cake.
Figuring
out if the various version of warps all use the same files is tough...
copying the files where they belong is easy enough... Adding entries to
config.sys is a snap...

It looks like a simple enough project, one that I'd be willing to participate
in. The short story is, I'll do anything to get rid of the Feature
Installer...


--

*******************************************************************************

*            Sometimes, the BEST things in life really ARE free...           
*
*       Get a FREE copy of NetRexx 1.151 for your next java project at:      
*
*                                                                            
*
*                      GET IT NOW! WHILE IT'S STILL FREE!                    
*
*                                                                            
*
*                     http://www2.hursley.ibm.com/netrexx                    
*
*******************************************************************************


/----------------------------------------\
| From the desktop of: Jerome D. McBride |
|         mcbrides@erols.com             |
\----------------------------------------/

--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TEAM-NETREXX (1:109/42)

+----------------------------------------------------------------------------+

From: noway@all.to.spam                                 17-Oct-99 19:10:04
  To: All                                               17-Oct-99 19:56:06
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: "Bill Scarlett" <noway@all.to.spam>

On Sat, 16 Oct 1999 20:20:59 GMT, Steve Snyder wrote:

>Where to we registered PMMail v2.0 users stand in relation to PMMail 
>v2.1?  Is it a free upgrade?  Cheap upgrade?  Total new product?

	The product is free if you registered it at v2.0 upwards.  It worked
for me when I installed it separately from my previous 2.1 and registered it
with the 5 line block I received in a msg from BMT Software.  Well, after I
deleted a space character or two at the end of the block :-(

	In passing, the address of the new company is:-

Blueprint Software Works, Inc. 
5019 Carolina Beach Rd. Ste. 102
Wilmington, NC 28412
USA 

and its president is one Thomas Bradford, so I think we get the picture on
where it is coming from.   It is an independent company 'tho'.

	73 Bill in the West Riding of Yorkshire, U.K.
		bill@eldwick.u-net.com

	




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: (Posted via) U-NET Internet Ltd. (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  17-Oct-99 19:31:22
  To: All                                               17-Oct-99 19:56:06
Subj: Crystal "TidalWave128" sound card

From: l_luciano@da.mob (Stan Goodman)

I have a new Crystal sound card (see the subject line). According to the 
box it came in, the Web page for information about the product is at 
http://crystalcomputer.com, but the box is wrong. That page contains only a
prediction that it will be occupied in the future by a company interested 
in Internet Telephony.

But the CDROM that came in the package calls out a different URL, namely: 
http;//www.crystal.com. That page is unhelpful, because it is concerned 
exclusively with chips and drivers for them. Searches for "TidalWave" and 
"TidalWave128" turn up nothing. 

There is nothing like getting off on the right foot.

If somebody -- ANYBODY -- knows where the card's manufacturer discusses the
card, I hope he will let me in on the well-kept secret. There are enough 
inconsistencies in the documentation on the CDROM, and between the 
documentation and the way Warp4 actually behaves, that I would like to see 
up to date information, and even to discuss the product with a live support
person.

Many thanks.

----------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: xyxmadxyx@xyxziplinkxyx.xyxnetxyx                 17-Oct-99 19:40:28
  To: All                                               17-Oct-99 19:56:06
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: xyxmadxyx@xyxziplinkxyx.xyxnetxyx (mark davidson)

On Sun, 17 Oct 1999 12:30:40, zayne@omen.com.au (Mooo) wrote:

> >upgrade.  Exactly what it upgrades I'm not sure about...there didn't 
> >seem to anything in the readme file to indicate new or improved 
> >features [but then I was just home after working a nightshift, so my 
> >consciousness was slightly altered...].
> 
> There is at least one improvement.  You no longer get black 'blobs' at
> the end of every line when you print an email on an HP LJ :)

here's another improvement.  mark some text in the body of a message 
and click the right mouse button.  you're now able to 'copy' it to the
clipboard whereas in the past (and unlike the win9x version) that 
wasn't possible.

regards, ..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      17-Oct-99 15:27:07
  To: All                                               17-Oct-99 19:56:07
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: nospam@savebandwidth.invalid       (John Thompson)

In <3809c00e.82297305@news.omen.net.au>, zayne@omen.com.au (Mooo) writes:

>There is at least one improvement.  You no longer get black 'blobs' at
>the end of every line when you print an email on an HP LJ :)
>
>That was pretty much the last bug in my list - its looking real nice.

PMMAIL v2.10 still pegs cpu at 100% until PMMAIL is killed when I
click MB3 (remapped as MB1 double-click) on PMMAIL.  I was really
hoping that bug would have been dealt with as PMMAIL is the only 
program that does this with MB3.  XIT's exclude list can work 
around this, but I am loath the spend $25 for just that.  Better to 
fix the problem at the source than fix the symptom anyway.

-John (John.Thompson@attglobal.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             17-Oct-99 17:03:13
  To: All                                               17-Oct-99 19:56:07
Subj: Re: Crystal "TidalWave128" sound card

From: Alan Beagley <abeagley@datatone.com>

Try NewCom (www.newcominc.com) and Cirrus Logic (www.cirrus.com), the latter
being the manufacturer of the chipset.

Alan


Stan Goodman wrote:

> I have a new Crystal sound card (see the subject line). According to the
> box it came in, the Web page for information about the product is at
> http://crystalcomputer.com, but the box is wrong. That page contains only a
> prediction that it will be occupied in the future by a company interested
> in Internet Telephony.
>
> But the CDROM that came in the package calls out a different URL, namely:
> http;//www.crystal.com. That page is unhelpful, because it is concerned
> exclusively with chips and drivers for them. Searches for "TidalWave" and
> "TidalWave128" turn up nothing.
>
> There is nothing like getting off on the right foot.
>
> If somebody -- ANYBODY -- knows where the card's manufacturer discusses the
> card, I hope he will let me in on the well-kept secret. There are enough
> inconsistencies in the documentation on the CDROM, and between the
> documentation and the way Warp4 actually behaves, that I would like to see
> up to date information, and even to discuss the product with a live support
> person.
>
> Many thanks.
>
> ----------
> Stan Goodman
> Qiryat Tiv'on
> Israel
>
> Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
>
> 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: operagost@e-mail.com                              17-Oct-99 21:08:09
  To: All                                               17-Oct-99 19:56:07
Subj: Re: Crystal "TidalWave128" sound card

From: "Stephen Eickhoff (remove the - to reply)" <operagost@e-mail.com>

This is a multi-part message in MIME format.
--------------24097E0C9E398CD5DD037EF8
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit

Try http://www.tabi.org/timur/crystalos2.html for more information.

I don't know what the status of that company is. I'd say you're stuck with
using the drivers in the
box or the generic Crystal drivers.

Stan Goodman wrote:

> I have a new Crystal sound card (see the subject line). According to the
> box it came in, the Web page for information about the product is at
> http://crystalcomputer.com, but the box is wrong. That page contains only a
> prediction that it will be occupied in the future by a company interested
> in Internet Telephony.
>
> But the CDROM that came in the package calls out a different URL, namely:
> http;//www.crystal.com. That page is unhelpful, because it is concerned
> exclusively with chips and drivers for them. Searches for "TidalWave" and
> "TidalWave128" turn up nothing.
>
> There is nothing like getting off on the right foot.
>
> If somebody -- ANYBODY -- knows where the card's manufacturer discusses the
> card, I hope he will let me in on the well-kept secret. There are enough
> inconsistencies in the documentation on the CDROM, and between the
> documentation and the way Warp4 actually behaves, that I would like to see
> up to date information, and even to discuss the product with a live support
> person.
>
> Many thanks.
>
> ----------
> Stan Goodman
> Qiryat Tiv'on
> Israel
>
> Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
>
> 

--
----------------------------------
         Stephen Eickhoff
          Havertown, PA
----------------------------------


--------------24097E0C9E398CD5DD037EF8
Content-Type: text/x-vcard; charset=us-ascii;
 name="operagost.vcf"
Content-Transfer-Encoding: 7bit
Content-Description: Card for Stephen Eickhoff  (remove the - to reply)
Content-Disposition: attachment;
 filename="operagost.vcf"

begin:vcard 
n:Eickhoff;Stephen
tel;work:610-341-8571
x-mozilla-html:FALSE
org:Johnson Matthey, CSD NA;Information Technology
adr:;;456 Devon Park Drive;wayne;PA;19087;
version:2.1
email;internet:operagost@email.com
title:PC Support Analyst
end:vcard

--------------24097E0C9E398CD5DD037EF8--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: j.welton@mailcity.com                             17-Oct-99 21:24:14
  To: All                                               17-Oct-99 19:56:07
Subj: LoadDskF.exe & IBMWorks CSD 2.1

From: j.welton@mailcity.com

Even though I have all the other OS/2 suites at my disposal, I'm
fascinated with IBMWorks.  It works very well on my system.  I looked
around to see if any updates were available and I found:

1. CSD 2.1, works-csd.zip, ~8 Meg, dated 6/18/96

2. Add RFT text filter (16 bit) to IBM Works - README readrft.txt, ~1k,
   11/1/95

3. Add RFT text filter (16 bit) to IBM Works, wksrft.zip, ~86K, 11/1/95

4. Spreadsheet rounding problems Fix, wksfix1.zip, ~409K, 12/2/95

My current Warp 4 version of IBMWorks appears to be newer then the
files released above.  Example:

 8-12-96   3:12a     15593           0  fpwobj.dll
 8-12-96   3:12a     20687       28128  ibmworks.exe
 8-12-96   3:12a     25385          61  ien30pxx.dll
 8-12-96   3:15a     44993          61  about.exe
 8-12-96   3:21a     52552          61  fpwmon.exe
 8-12-96   3:21a    385516          61  fpwpim.exe
 8-12-96   3:22a    109080        2736  pimrl.dll
 8-12-96   3:23a    205444           0  fpwpim.hlp
 8-25-96   1:05p    392137          61  ien30pwp.dll
      112 file(s)    8384313 bytes used
                   1854432 K bytes free

So my question may not be applicable.  Unzipping the CSD file above I
find:

 5-21-96   9:59a   1884160           0  WKS21_1.DSK
 5-21-96  10:03a   1884160           0  WKS21_2.DSK
 5-21-96  10:04a   1884160           0  WKS21_3.DSK
 5-21-96  10:05a   1884160           0  WKS21_4.DSK
 5-21-96  10:07a   1884160           0  WKS21_5.DSK

And when I issue the following command using the with the latest
LoadDskF.exe

[F:\work]LoadDskF F:\work\WKS21_1.DSK A: /f

I get the error message:

Unsupported disk type

I am trying to create a set of floppies on standard 1.44kb disks.  When
I look at the size of the DSK files above I see they are larger than
1.44kb and assume the system is telling me my floppy is insufficient to
support the volume needed.  I tried issuing the same command to have
the data created on another (fixed) partition only to receive an error
that the program is unable to write to a fixed disk.

So how does one get these DSK files over to floppies?

And last but not least, you'll see the unzipped DSK files are dated
5/1/96 whereas my IBMWorks files are dated 8/12/96 so I'm assuming my
current Wapr 4 IBMWorks is updated with all of the files found in the
5/1/96 package.  Am I assuming correctly?


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  17-Oct-99 21:56:24
  To: All                                               17-Oct-99 19:56:07
Subj: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

I have replaced my AWE32 soundcard with a Crystal card (see subject line). 
Before the installation, as instructed by the User's Manual, I wanted to 
uninstall the AWE drivers using Selective Install; unfortunately, Warp4 
Selective Install does not behave according to the manual's instructions, 
so I deleted the two AWE drivers from config.sys, then began Selective 
Install in order to install the new drivers. Because the system correctly 
identified the card as "Crystal Audio CS-4232/36 PNP", I permitted it to 
install from the OS/2 CDROM, which may have been a mistake. After reboot, 
the sound system is silent.

There is a README file in the OS/2 directory of the CDROM, which is much 
more specific about how previous audio cards must be uninstalled, as 
follows:

----------------------Quote follows-------------------
If your system presently has Sound Blaster OS/2 device drivers installed
and you do not have a Sound Blaster device installed, then you should
de-install the Sound Blaster OS/2 drivers prior to running this 
installation.

The de-installation of the Sound Blaster OS/2 device drivers requires
the following steps:

a) ERASE \MMOS2 and all subdirectories (this removes OS/2 multimedia 
support)
   Some files won't delete, this is okay.
b) Use OS/2 selective install to re-install OS/2 multimedia support.
   It will auto-detect the wrong device.  You should override
   the auto-detection to remove the Sound Blaster device driver.
   When correct, the installation panel will have no audio devices listed.
c) Complete selective installation and reboot
d) You are now prepared to use this diskette to install Crystal drivers.
----------------------ends----------------------

I am very reluctant to follow these directions, because I would be deleting
an MMOS2 directory which has been updated to FP10, and then reinstalling it
from the original Warp4 distribution CDROM. If the instructions had said 
something about updating specific files, one would have felt more 
comfortable.

Has someone installed this card as a replacement to AWE32, or any other 
Soundblaster card? If so, I would appreciate knowing how you accomplished 
the feat.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     17-Oct-99 12:38:24
  To: All                                               18-Oct-99 02:24:12
Subj: Re: CHKDSK problem 

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On 15 Oct 1999 18:06:42 GMT, Doug Bissett wrote:

->I see (from another post) that you figured out your problem. I just 
->wanted to emphasize that "/F", is used on a FAT formatted drive, while
->"/F:2" is used on a HPFS formatted drive.

They are the SAME thing.


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 17-Oct-99 12:30:20
  To: All                                               18-Oct-99 02:24:12
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: zayne@omen.com.au (Mooo)

dtander@agts.net (David T. Anderson) wrote:

>I threw caution to the winds today and simply installed 2.1 into my 
>PMMail directory...all went well....I lost no data, and my 
>registration info was untouched.  So -- I would call this a free 
>upgrade.  Exactly what it upgrades I'm not sure about...there didn't 
>seem to anything in the readme file to indicate new or improved 
>features [but then I was just home after working a nightshift, so my 
>consciousness was slightly altered...].

There is at least one improvement.  You no longer get black 'blobs' at
the end of every line when you print an email on an HP LJ :)

That was pretty much the last bug in my list - its looking real nice.
The new icon is cool too hehehe.


Craig

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nothing I say is my own opinion (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          17-Oct-99 14:04:14
  To: All                                               18-Oct-99 02:24:12
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: piquant00@uswestmail.net (Annie K.)

On Sun, 17 Oct 1999 09:23:05, H van Dyk <henkvandyk@euronet.nl> wrote:

:"Annie K." wrote:
:> 
:> On Sun, 17 Oct 1999 01:17:34, !2020hindsight@usa.net (Bill Clark)
:> wrote:
:> 
:> :Where does one find 2.1?
:> 
:>  Hobbes /incoming, http://hobbes.nmsu.edu/pub/incoming
:> 
:> --
:> Klaatu barada nikto
: 
:I don't see any updates available. 

 ftp://hobbes.nmsu.edu/pub/incoming/pmmail210.exe

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: rascho@nospam.iname.com                           17-Oct-99 16:05:17
  To: All                                               18-Oct-99 02:24:12
Subj: Enhanced E

From: "Rade Popovic" <rascho@nospam.iname.com>

Hi

One quick question. Enhanced E beeps every time I start it. Is it
normal and how can I make it stop (it is annoying)?
And also help doesn't work. I can't evan see it when typing viewhelp
eee.hlp; it says help is not available at this time; hyperview can't
open it either.

TIA

Rascho
e-mail:rascho@iname.com
ICQ# 49354974

------------------------
Hal 9000: "Dave, put those Windows disks down....Dave...DAVE!"


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Dugoprsti & Co. (1:109/42)

+----------------------------------------------------------------------------+

From: stephen@turboweb.splat.spam.net.au                17-Oct-99 20:11:24
  To: All                                               18-Oct-99 02:24:12
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: stephen@turboweb.splat.spam.net.au (stephen)

On Sat, 16 Oct 1999 19:16:23, Michael Warmuth 
<michael.warmuth@wu-wien.ac.at> wrote:

> TURN OFF NETSCAPE'S MEMORY CACHE!!! (set it to 0)
>  

Finally someone else has confirmed for me what I have posted on a 
couple of occasions as seeming to work for me! I have been wondering 
if it was just coincidental in some weird way, or if setting memory 
cache to zero did the trick, but nobody ever responded to my comment 
(or I missed the response).

Regards,

Stephen

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Customer of Connect.com.au Pty. Ltd. (1:109/42)

+----------------------------------------------------------------------------+

From: mcmorran@norfolk.infi.net                         17-Oct-99 18:26:16
  To: All                                               18-Oct-99 03:19:21
Subj: Re: cdwriter support

From: mcmorran@norfolk.infi.net (Peter McMorran)

In <7u928b$7ee$1@news.panix.com>, on 10/16/99 
   at 05:25 AM, rcpj@panix.com (Pierre Jelenc) said:

>Peter McMorran <mcmorran@norfolk.infi.net> writes:
>> 
>> In another post, you showed the CDWriter configuration as
>> 
>> Program Path: D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe SCSI
>> Device: 3
>> Speed: 4
>> Pregap: 0
>> Other options: (blank)
>> Command file: makedisc.cmd
>> 
>> Unfortunately, none of us seems to know what CDWriter expects
>> here. As Anssi suggested, you might try 3,0 for the device.
>> Because the specified dev is only '3', cdrecord may be
>> interpreting it as a devname and leaving the scsi parameters
>> uninitialized -- just a guess.

>Bingo! If I put 3,0 in the Device, it looks like it's working.
>At least in "dummy write" mode. There is some progress...

>On the other hand, I've discovered that CD rippers seem to
>believe that the drive does not allow direct read of audio
>tracks, even though the drive is clearly labelled "CD-DA"
>(Yamaha CRW6416sz). I can play audio CDs and read CD-ROM without
>any problem, though, so there must be something a lot more
>subtle going on.

Which CD rippers are you using? cdrecord/2 includes cdda2wav,
which works with the Yamaha CRW4416, so I expect it ought to work
with the 64616 also.

Cheers,
Peter

-- 
-----------------------------------------------------------
mcmorran@norfolk.infi.net (Peter McMorran)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              17-Oct-99 16:06:21
  To: All                                               18-Oct-99 03:19:21
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: "J. R. Fox" <jr_fox@earthlink.net>

Rich Walsh wrote:

> FWIW, I wanted to retain my 2mb memory cache, so I set the disk cache
> at 64kb.  When I had it at 1kb, there was nonstop disk activity as
> NS kept filling and emptying it.  You'll probably want to set yours
> to the size of a typical web page.

_______________________________________________________________

What if you have a large amount of memory, and wanted to mini-
mize the amount of transitory junk written to your H/D ?  If
there was a way to have most of that stuff cached in RAM, and
not written to disk at all, that would interest me (for some,
maybe most sessions).  I've only been using 4.61 for a few 
weeks now.  There used to be problems in earlier versions when
your disk cache got too large, esp. FAT.DB and the History 
file.  So far, I'm carrying over the settings I used in 2.02 -- 
7.5M Memory Cache, 2.5M Disk cache.  This may not be such a 
great idea, for reasons I'm not aware of yet, but it seems to
be working.

Haven't noted the freezes yet mentioned in the original post,
due to complex web pages, but it may just be too early yet
in my usage of 4.61.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              17-Oct-99 16:15:22
  To: All                                               18-Oct-99 03:19:22
Subj: Re: Pronews/2

From: "J. R. Fox" <jr_fox@earthlink.net>

Hi -- 

I would be interested in hearing from anyone who is familiar
with News Harvest, PM-News, ProNews/2, and can make compara-
tive recommendations between them.  Do they swallow large 
blocks of messages, for OLR-style processing, or are they
strictly real-time, like the NS Mail I'm using now ?  I think
one or more of these may be off the market now, with reports
here that their websites are no longer answering.  I would
be inclined to steer clear of the orphaned product . . .  
though I recognize that is an occupational hazard with OS/2
s/w.

TIA.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              17-Oct-99 16:28:15
  To: All                                               18-Oct-99 03:19:22
Subj: Re: Recording Records

From: "J. R. Fox" <jr_fox@earthlink.net>

Jon Santarelli wrote:
 
> What do I need to do to record these records?  Some how I'll have to hook
the
> stereo up to the sound card and go from there, but what software to use to
> capture the sound I don't know.

I have no personal knowledge or experience to apply here (my
stereo is in a different room, and the only practical way to
do this, I think, would be to purchase a good laptop and take
it to the stereo rig), but some users on Compuserve mentioned
doing what you have in mind, on a regular basis.  I believe 
they were using a shareware pkg. called TWAVE.  You might 
check on Hobbes, the OS/2 Supersite, etc.  If necessary, I 
might have the developer's URL or e-mail addr. somewhere.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: nemo@union.edu                                    17-Oct-99 19:59:22
  To: All                                               18-Oct-99 03:19:22
Subj: no audio from cdplayer

From: nemo@union.edu

Greetings!

I just discovered that my music cd-player isn't working in Warp, FP10. It
works when booted to Win95 when I can't get a sound out of it when booted
to OS/2. I do have system sounds and can play wav's, midi's, etc.

Just need a fast tip where to look for trouble-shooting. Couldn't find
anything on deja.com.

I sent this message to comp.os.os2.misc and have gotten a couple of
helpful replies. One was to reinstall Multimedia which I may end up doing,
but I'm hoping for another solution before that. (I should install FP12
anyway, I guess.) It occurred to me today that the cdplayer _used_ to work
a couple of weeks ago. I can't think of what I may have done to change the
system since I've been very conservative (that is, no time for 'playing').

F.


-----------------------------------------------------------
      Felmon John Davis		
     davisf@union.edu	|  davisf@capital.net     
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack 
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: forgitaboutit@fake.com                            17-Oct-99 21:15:21
  To: All                                               18-Oct-99 03:19:22
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: David H. McCoy <forgitaboutit@fake.com>

In article <fIF9M9pMNugl-pn2-ThlELdJwjuUH@camb0620.capecod.net>, 
xyxmadxyx@xyxziplinkxyx.xyxnetxyx says...
>On Sun, 17 Oct 1999 12:30:40, zayne@omen.com.au (Mooo) wrote:
>
>> >upgrade.  Exactly what it upgrades I'm not sure about...there didn't 
>> >seem to anything in the readme file to indicate new or improved 
>> >features [but then I was just home after working a nightshift, so my 
>> >consciousness was slightly altered...].
>> 
>> There is at least one improvement.  You no longer get black 'blobs' at
>> the end of every line when you print an email on an HP LJ :)
>
>here's another improvement.  mark some text in the body of a message 
>and click the right mouse button.  you're now able to 'copy' it to the
>clipboard whereas in the past (and unlike the win9x version) that 
>wasn't possible.
>
>regards, ..
>

Hello, but I've got the Windows version and you can right-click and copy text. 

You get a popup menu and one of the options is 'Copy'.

In you cse, user error may the problem.

-- 
---------------------------------------
David H. McCoy
dmccoy@EXTRACT_THIS_mnsinc.com
---------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: OminorTech (1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          18-Oct-99 10:08:29
  To: All                                               18-Oct-99 03:19:22
Subj: Checkini

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

I've sent mail to Henk Kelder but if anyone here has any
idea I'd be grateful.

I've recently changed my system to a Celeron 400 with
128Mb RAM on a Aopen AX6BC Type R motherboard
and a Matrox G-400 16Mb video card. Now when I run
Checkini it gets to:

    PM_Abstract:Objects & PM_Abstract:FldrContents

and then I get an error message:

֯
           GetProfileData                                                   
      
                                                                            
                      
 Not enough memory for profile data!                            
  
          Druk op een toets                                                 
    
֬

Anyone have any idea what's going on?

Cheers

Wayne

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
  Running on OS/2 Warp 4 (UK)  + FixPak 9
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    18-Oct-99 01:39:20
  To: All                                               18-Oct-99 03:19:22
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

Peter McMorran <mcmorran@norfolk.infi.net> writes:
> 
> Which CD rippers are you using? cdrecord/2 includes cdda2wav,
> which works with the Yamaha CRW4416, so I expect it ought to work
> with the 64616 also.

It does. I had not thought of it because I used to use others when I had
my old IDE drive and they were set up ready to use. So far cdda2wav is the
only one that works, all the others either say the drive does not support
CD-DA or they grab nothing (one got 44 bytes, another got the full length,
but it was all zeros! I don't remember which is which but I tried Leech,
CD2MP3, CD Audio Dump/2, JCDread/2, Alfons, and PMCD2WAV.)

Do you know where or how I can find the defaults for the many options in
cdda2wav? 

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: Jan.Danielsson@falun.mail.telia.com               18-Oct-99 02:13:04
  To: All                                               18-Oct-99 03:19:22
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: "Jan Danielsson" <Jan.Danielsson@falun.mail.telia.com>

>>here's another improvement.  mark some text in the body of a message 
>>and click the right mouse button.  you're now able to 'copy' it to the
>>clipboard whereas in the past (and unlike the win9x version) that 
>>wasn't possible.
>
>Hello, but I've got the Windows version and you can right-click and copy
text. 
>You get a popup menu and one of the options is 'Copy'.

Was that not what he said?


 /j



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telia Internet (1:109/42)

+----------------------------------------------------------------------------+

From: bd83h@bedford.waii.com                            18-Oct-99 10:05:04
  To: All                                               18-Oct-99 10:22:24
Subj: Re: Best way to get Wordpro Documents into StarOffice?

From: Steve Drewell <bd83h@bedford.waii.com>

On Fri, 15 Oct 1999, Richard Steiner wrote:

 Here in comp.os.os2.apps, John Abraham <jabraham@ucalgary.ca>
 spake unto us, saying:
 
 >I've installed StarOffice and want to give it a try.  But it doesn't
 >convert my Lotus WordPro files (it just launches WordPro when I try to
 >open them.)
 
 Have you tried to use the Open option in the File menu?


The same behaviour can be seen when trying to open a 123 file. As far as I
remember, I tried 'Open' from the 'File' menu within StarOffice and
instead of the document being loaded, 123 was launched instead.

Steve

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Western Geophysical, Houston, TX (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  18-Oct-99 09:35:28
  To: All                                               18-Oct-99 10:22:24
Subj: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

I posted the following previously, but it has for some reason not made it 
to Usenet. Please pardon if the first version shows up later.
 
I have replaced my AWE32 soundcard with a Crystal card (see subject line). 
Before the installation, as instructed by the User's Manual, I wanted to 
uninstall the AWE drivers using Selective Install; unfortunately, Warp4 
Selective Install does not behave according to the manual's instructions, 
so I deleted the two AWE drivers from config.sys, then began Selective 
Install in order to install the new drivers. Because the system correctly 
identified the card as "Crystal Audio CS-4232/36 PNP", I permitted it to 
install from the OS/2 CDROM, which may have been a mistake. After reboot, 
the sound system is silent.
 
There is a README file in the OS/2 directory of the CDROM, which is much 
more specific about how previous audio cards must be uninstalled, as 
follows:
 
----------------------Quote follows-------------------
If your system presently has Sound Blaster OS/2 device drivers installed
and you do not have a Sound Blaster device installed, then you should
de-install the Sound Blaster OS/2 drivers prior to running this 
installation.
 
The de-installation of the Sound Blaster OS/2 device drivers requires
the following steps:
 
a) ERASE \MMOS2 and all subdirectories (this removes OS/2 multimedia 
support)
   Some files won't delete, this is okay.
b) Use OS/2 selective install to re-install OS/2 multimedia support.
   It will auto-detect the wrong device.  You should override
   the auto-detection to remove the Sound Blaster device driver.
   When correct, the installation panel will have no audio devices listed.
c) Complete selective installation and reboot
d) You are now prepared to use this diskette to install Crystal drivers.
----------------------ends----------------------
 
I am very reluctant to follow these directions, because I would be deleting
an MMOS2 directory which has been updated to FP10, and then reinstalling it
from the original Warp4 distribution CDROM. If the instructions had said 
something about updating specific files, one would have felt more 
comfortable.
 
Has someone installed this card as a replacement to AWE32, or any other 
Soundblaster card? If so, I would appreciate knowing how you accomplished 
the feat.
 


-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: bd83h@bedford.waii.com                            18-Oct-99 10:22:17
  To: All                                               18-Oct-99 10:22:24
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: Steve Drewell <bd83h@bedford.waii.com>

On Sun, 17 Oct 1999, J. R. Fox wrote:

 What if you have a large amount of memory, and wanted to mini-
 mize the amount of transitory junk written to your H/D ?  If
 there was a way to have most of that stuff cached in RAM, and
 not written to disk at all, that would interest me (for some,
 maybe most sessions).

How about setting up a RAM disk and setting your Netscape disk cache to
point to the virtual disk? The only drawback to that, as far as I know, is
that you permanently 'lose' the memory used for the virtual disk (correct 
me if I'm wrong....I've never actually set one up myself!).

Cheers,
Steve

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Western Geophysical, Houston, TX (1:109/42)

+----------------------------------------------------------------------------+

From: maxikins@os2bbs.com                               18-Oct-99 10:29:27
  To: All                                               18-Oct-99 10:22:24
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: maxikins@os2bbs.com (Mark Klebanoff)

On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> I just did this yesterday - it took about a half hour total. Selective
> uninstalled multimedia, about five minutes. Reboot. Find the CD, about an 
> hour. Selective reinstall, about another five minutes. Reboot. Find where
> I put the fixpack files, start Service, choose Multimedia, another maybe
> ten minutes. Reboot. Sort of a pain, but not that big a deal. Service will
> let you Fix the old MMPM install easily. I use something from Hobbes - 
> fastkick141 I think ? that makes the fpak situation relatively painless.
> You might try it. DIUNPAK the .dsk files first, then the Fix.cmd runs you
> right through no muss, no fuss, *and* you have the disk images if you 
> need them again later. good luck
> 
> >

Many programs add files such as dll's to the mmos2 directory.  2 
examples are quickflick, anpocodec and the netscape plugin pack.  If 
you do an uninstall and reinstall, what happens to those files.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: martin.schaffoener@student.uni-m...               18-Oct-99 13:03:25
  To: All                                               18-Oct-99 10:22:24
Subj: Re: Sun StarOffice and PGP???

Message sender: martin.schaffoener@student.uni-magdeburg.de

From: martin.schaffoener@student.uni-magdeburg.de (Martin Schaffner)

On Mon, 4 Oct 1999 01:30:04, "RichS" <worlock@frontiernet.net> wrote:

 >I just talked to one of the StarOffice developers this weekend and 
> >here is what I picked up "by accident":  The hooks are all in there 
> >and they would work if there was a native PGP interface in os/2.  
> >There is one on Windows in the winpgp.dll or something like that.  
> >Now, he said that SUN would not sit down and write this interface, 
> >which I can understand as it is not their job, but if we could find 
> >anybody to do it, we would have pgp-enabled staroffice.
> 
> That's great news! Thanks... Now if we could find someone to write it? And
> would Sun be willing to give up the information needed? Or a StarOffice api
> library of sorts... At least there's hope...
>

Well, there actually seems to be an api planned, called StarOne or so.
 There used to be a c-toolkit and starone is supposed to be based on 
that.  I'll be in contact with somebody from stardivision, I hope ...

Martin Schaffner

Suzuki GS650G Katana
OS/2 Warp 4 with FixPak 11
There are currently 33 processes
with 135 threads active.
This machine's uptime 5h 43min 57sec.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Otto-von-Guericke-Universitaet Magdeburg (1:109/42)

+----------------------------------------------------------------------------+

From: blevins@sisna.com                                 17-Oct-99 23:06:15
  To: All                                               18-Oct-99 10:22:24
Subj: How do you commit FixPak40 installed by RSU

From: blevins@sisna.com

Receiving and installing the Fixpak was a breeze. When I run SERVICE from
C:\$rsutmp$\csf I'm prompted to choose drive A or E (CDrom) I've tried
everything I can think of with no success, including trying csf files on a
floppy. I succeeded accidentally once before, but after 2 days of trying I
can't duplicate my success. Thanks 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: xyxmadxyx@xyxziplinkxyx.xyxnetxyx                 18-Oct-99 08:39:21
  To: All                                               18-Oct-99 11:10:16
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: mark davidson <xyxmadxyx@xyxziplinkxyx.xyxnetxyx>

On Sun, 17 Oct 1999 21:15:43 -0400, David H. McCoy
<forgitaboutit@fake.com> wrote:

>>here's another improvement.  mark some text in the body of a message 
>>and click the right mouse button.  you're now able to 'copy' it to the
>>clipboard whereas in the past (and unlike the win9x version) that 
>>wasn't possible.

>Hello, but I've got the Windows version and you can right-click and copy
text. 
>You get a popup menu and one of the options is 'Copy'.

>In you cse, user error may the problem.

you obviously didn't get the point.  let me try again with smaller
words.

using the os/2 version until 2.1 there wasn't any 'copy' option using
the right mouse button.  that was UNLIKE the win9x version where there
always was a 'copy' option using the right mouse button.  get it now? 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: dmhills@ibm.net                                   19-Oct-99 00:37:27
  To: All                                               18-Oct-99 11:10:16
Subj: Re: How do you commit FixPak40 installed by RSU

From: dmhills@ibm.net (Don Hills)

In article <380aaad6@news.sisna.com>, blevins@sisna.com wrote:
>Receiving and installing the Fixpak was a breeze. When I run SERVICE
>from C:\$rsutmp$\csf I'm prompted to choose drive A or E (CDrom) I've
>tried everything I can think of with no success, including trying csf
>files on a floppy. I succeeded accidentally once before, but after 2
>days of trying I can't duplicate my success. Thanks

It's a bug- no, it's a feature- of SERVICE. It insists on finding a fix
at startup time, before it will let you change the action.

Copy the C:\OS2\INSTALL\SYSLEVEL.OS2 file to a floppy (or a temp
directory on the hard disk). Set the source to there. Do this at an OS/2
command prompt:

CD \$RSUTMP$\CSF
SET CSFCDROMDIR=A:\ (or C:\TEMP, or wherever the SYSLEVEL file is)
SERVICE

The trick of setting CSFCDROMDIR is documented in the README for the CSF
tool, it comes in handy if you have the CSD on hard disk or a Zip disk
etc.

--
Don Hills      (dmhills at ibmdotnet)     Wellington, New Zealand

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               18-Oct-99 15:41:11
  To: All                                               18-Oct-99 11:10:16
Subj: Network security questions

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Hello all!

My neighbour just told me that recently some people repeatedly tried to
get access to his computer while he was online via a dial-up connection,
but his security software blocked them. He is using a security
application named "AT-Guard" under Windows 98 which you can configure to
show and block access from outside and also from within (e.g. say your
e-mail client tries to send something via FTP which it shouldn't be
allowed to do). You can configure it for each application your are using
and also to block adverts like with Junkbuster.

Is there any OS/2 app that can do the same? Firewalls? Gateways? Any
recommendations?

Thanks

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: heafnerj@interpath.com                            18-Oct-99 10:08:10
  To: All                                               18-Oct-99 11:10:16
Subj: can't download Java 1.1.8 stuff from service...

From: Joe Heafner <heafnerj@interpath.com>

Hi.

After nearly 12 hours of trying, I can't download the Java 1.1.8 files
from the service ftp site. The downloads always hang or terminate
prematurely. This happens both with ftp browser and NS 4.04. The "time
remaining" counter just happily counts off towards infinity. 

Any suggestions?


-- 

                        -- Joe Heafner

Joe Heafner, Astronomy and Physics Instructor. Work:(828)327-7000 x4246
my surname with my first initial at interpath dot com
http://home.interpath.com/heafnerj/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Interpath Communications, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: huffd@nls.net                                     18-Oct-99 03:17:20
  To: All                                               18-Oct-99 11:10:16
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: "David D. Huff Jr." <huffd@nls.net>

Stan,
Help will be slow in coming for the next week. Many of the major players
are at Warpstock99. But the following URL has all you will ever need to
know about the Crystal chips: http://www.tabi.org/timur/crystalos2.html
Here is where you get the drivers:
ftp://ftp.cirrus.com/pub/drivers/audio/
cwos2202.zip for ISA cards
cwos2303.zip for PCI cards.

I was one of the early users. My Tidalwave128 was replaced due to faulty
plumbing and my new one was #15 hand stamped by the tester. I wouldn't
part with it.

Have fun,
Dave Huff

Stan Goodman wrote:

> I have replaced my AWE32 soundcard with a Crystal card (see subject line).
> Before the installation, as instructed by the User's Manual, I wanted to
> uninstall the AWE drivers using Selective Install; unfortunately, Warp4
> Selective Install does not behave according to the manual's instructions,
> so I deleted the two AWE drivers from config.sys, then began Selective
> Install in order to install the new drivers. Because the system correctly
> identified the card as "Crystal Audio CS-4232/36 PNP", I permitted it to
> install from the OS/2 CDROM, which may have been a mistake. After reboot,
> the sound system is silent.
>
> There is a README file in the OS/2 directory of the CDROM, which is much
> more specific about how previous audio cards must be uninstalled, as
> follows:
>
> ----------------------Quote follows-------------------
> If your system presently has Sound Blaster OS/2 device drivers installed
> and you do not have a Sound Blaster device installed, then you should
> de-install the Sound Blaster OS/2 drivers prior to running this
> installation.
>
> The de-installation of the Sound Blaster OS/2 device drivers requires
> the following steps:
>
> a) ERASE \MMOS2 and all subdirectories (this removes OS/2 multimedia
> support)
>    Some files won't delete, this is okay.
> b) Use OS/2 selective install to re-install OS/2 multimedia support.
>    It will auto-detect the wrong device.  You should override
>    the auto-detection to remove the Sound Blaster device driver.
>    When correct, the installation panel will have no audio devices listed.
> c) Complete selective installation and reboot
> d) You are now prepared to use this diskette to install Crystal drivers.
> ----------------------ends----------------------
>
> I am very reluctant to follow these directions, because I would be deleting
> an MMOS2 directory which has been updated to FP10, and then reinstalling it
> from the original Warp4 distribution CDROM. If the instructions had said
> something about updating specific files, one would have felt more
> comfortable.
>
> Has someone installed this card as a replacement to AWE32, or any other
> Soundblaster card? If so, I would appreciate knowing how you accomplished
> the feat.
>
> -------------
> Stan Goodman
> Qiryat Tiv'on
> Israel
>
> Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
>
> 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             17-Oct-99 20:43:06
  To: All                                               18-Oct-99 11:10:17
Subj: Re: LoadDskF.exe & IBMWorks CSD 2.1

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Sun, 17 Oct 1999 21:24:28 GMT, j.welton@mailcity.com wrote:

>So how does one get these DSK files over to floppies?

First, that update is for the Warp 3 version of IBM Works, which was
available on floppy disks. The Bonus Pack apps all came on IBM's
Extended Floppy disks, (XDFLOPPY) which could put about 1.8M onto a
1.4M floppy. So you need to be running the XDFLOPPY driver in
config.sys in order to read and write them.
>
>And last but not least, you'll see the unzipped DSK files are dated
>5/1/96 whereas my IBMWorks files are dated 8/12/96 so I'm assuming my
>current Wapr 4 IBMWorks is updated with all of the files found in the
>5/1/96 package.  Am I assuming correctly?

You are. Warp 4's IBMWorks is newer, and has more features/bug fixes
than that old update. There IS no update for IBMWorks in Warp 4. 



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             17-Oct-99 20:52:20
  To: All                                               18-Oct-99 11:10:17
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Sun, 17 Oct 1999 21:56:49 GMT, Stan Goodman wrote:

>I am very reluctant to follow these directions, because I would be deleting
>an MMOS2 directory which has been updated to FP10, and then reinstalling it
>from the original Warp4 distribution CDROM. If the instructions had said 
>something about updating specific files, one would have felt more 
>comfortable.

You're right, reinstalling MM support from the cd will back-level the
updates from the fixpacks. But go ahead and do it. Once the original MM
support has been installed, and the Crystal drivers have been
installed, you can run FP10 again and it will then re-update ONLY the
MM files to FP10 level.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 18-Oct-99 04:39:10
  To: All                                               18-Oct-99 11:10:17
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: hamei@pacbell.net

In <yHQxxE9f8dqd-pn2-kHNmoslY4mCm@POBLANO>, l_luciano@da.mob (Stan Goodman)
writes:
snipped instructions to selective uninstall/reinstall mmos2
>
>I am very reluctant to follow these directions, because I would be deleting
>an MMOS2 directory which has been updated to FP10, and then reinstalling it
>from the original Warp4 distribution CDROM.

I just did this yesterday - it took about a half hour total. Selective
uninstalled multimedia, about five minutes. Reboot. Find the CD, about an 
hour. Selective reinstall, about another five minutes. Reboot. Find where
I put the fixpack files, start Service, choose Multimedia, another maybe
ten minutes. Reboot. Sort of a pain, but not that big a deal. Service will
let you Fix the old MMPM install easily. I use something from Hobbes - 
fastkick141 I think ? that makes the fpak situation relatively painless.
You might try it. DIUNPAK the .dsk files first, then the Fix.cmd runs you
right through no muss, no fuss, *and* you have the disk images if you 
need them again later. good luck

>
>Has someone installed this card as a replacement to AWE32, or any other 
>Soundblaster card? If so, I would appreciate knowing how you accomplished 
>the feat.
>
>-------------
>Stan Goodman
>Qiryat Tiv'on
>Israel

--
Hrad ngravvrd



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 18-Oct-99 04:43:15
  To: All                                               18-Oct-99 11:10:17
Subj: Re: LoadDskF.exe & IBMWorks CSD 2.1

From: hamei@pacbell.net

In <7udeq6$dde$1@nnrp1.deja.com>, j.welton@mailcity.com writes:
snip
>
>I get the error message:
>
>Unsupported disk type
>
>I am trying to create a set of floppies on standard 1.44kb disks.  When
>I look at the size of the DSK files above I see they are larger than
>1.44kb and assume the system is telling me my floppy is insufficient to
>support the volume needed.  I tried issuing the same command to have
>the data created on another (fixed) partition only to receive an error
>that the program is unable to write to a fixed disk.
>
>So how does one get these DSK files over to floppies?

you probably have remmed BASEDEV=XDFLOPPY.FLT from your config.sys ?
you need it to make Xtended Density images, I think.


--
Hrad ngravvrd



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 18-Oct-99 04:50:05
  To: All                                               18-Oct-99 11:10:17
Subj: Re: Recording Records

From: hamei@pacbell.net

In <380A316F.603D@earthlink.net>, "J. R. Fox" <jr_fox@earthlink.net> writes:
>Jon Santarelli wrote:
> 
>> What do I need to do to record these records?  Some how I'll have to hook
the
>> stereo up to the sound card and go from there, but what software to use to
>> capture the sound I don't know.
>
>I have no personal knowledge or experience to apply here (my
>stereo is in a different room, and the only practical way to
>do this, I think, would be to purchase a good laptop and take
>it to the stereo rig), but some users on Compuserve mentioned
>doing what you have in mind, on a regular basis.  I believe 
>they were using a shareware pkg. called TWAVE.  You might 
>check on Hobbes, the OS/2 Supersite, etc.  If necessary, I 
>might have the developer's URL or e-mail addr. somewhere.

tWave/gWave: full-duplex wave player, recorder,
digital audio extracter (DAE of audio CDs), MPEG
audio decoders, and CD player. Includes real-time
frequency analysis. Console and PM apps. For OS/2
Warp 4, or Warp 3 w/DART. Ver 1.23. 8-Jan-99.

http://www.40th.com
Cornel Huth

one of the most visually appealing OS/2 apps around
>
><jf>
>

--
Hrad ngravvrd



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: jyouells@lifestream.microserve.com                18-Oct-99 01:43:21
  To: All                                               18-Oct-99 11:10:17
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: John Youells <jyouells@lifestream.microserve.com>

l_luciano@da.mob (Stan Goodman) wrote:

>I have replaced my AWE32 soundcard with a Crystal card (see subject line). 
>Before the installation, as instructed by the User's Manual, I wanted to 
>uninstall the AWE drivers using Selective Install; unfortunately, Warp4 
snip
>
>The de-installation of the Sound Blaster OS/2 device drivers requires
>the following steps:
>
>a) ERASE \MMOS2 and all subdirectories (this removes OS/2 multimedia 
>support)
>   Some files won't delete, this is okay.
>b) Use OS/2 selective install to re-install OS/2 multimedia support.
>   It will auto-detect the wrong device.  You should override
>   the auto-detection to remove the Sound Blaster device driver.
>   When correct, the installation panel will have no audio devices listed.
>c) Complete selective installation and reboot
>d) You are now prepared to use this diskette to install Crystal drivers.
>----------------------ends----------------------
>
>I am very reluctant to follow these directions, because I would be deleting
>an MMOS2 directory which has been updated to FP10, and then reinstalling it
>from the original Warp4 distribution CDROM. If the instructions had said 
>something about updating specific files, one would have felt more 
>comfortable.
>
>Has someone installed this card as a replacement to AWE32, or any other 
>Soundblaster card? If so, I would appreciate knowing how you accomplished 
>the feat.
>
>-------------
>Stan Goodman
>Qiryat Tiv'on
>Israel
>
I installed an Acer AW35pro after an AWE32 following the above directions.
When
you reinstall original mmos2 and the crystal drivers just reinstall FP10 and
it
will just update the files in MMOS2 that need updating. Don't worry - it
works. 



John Youells
LifeStream Computing

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: LifeStream Computing (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     18-Oct-99 07:26:17
  To: All                                               18-Oct-99 11:10:17
Subj: Re: SYS3175 at startup of NC 4.61

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

victori@exis.net wrote:

> I have installed NC 4.61 with no problems.  When I start the NC 4.61 I
> get SYS3175 from OS/2.  This only occurs on one OS/2 machine and I
> have not been able to resolve it.  Any ideas?

Could be a corrupted certification file (pcert7.db) in your user
directory.  If the file is 0 bytes, just delete it and it will be
recreated; otherwise, try renaming it temporarily to see if the
problem goes away.

If that isn't the problem, you'll need to post the contents of
the SYS3175 information from your POPUPLOG.OS2 file.

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: s135989@studenti.ing.unipi.it                     18-Oct-99 09:16:19
  To: All                                               18-Oct-99 11:10:17
Subj: Re: cdwriter support

From: Mentore #cat# Siesto <s135989@studenti.ing.unipi.it>

On 15 Oct 1999, Pierre Jelenc wrote:

+Anssi Saari  <as@sci.fi> writes:
+> 
+> Oh sorry, now I understand. You're using some weird front end. Just a
+> guess, but maybe you should specify the device in cdrecord syntax,
+> 3,0? Or maybe, if you just set the environment variable CDR_DEVICE you
+> don't need to guess what the author had in mind?
+
+It's CDwriter. 
+
I had a system hang with my Yamaha 6/4/16 using cdrecord 1.8 a24, so I'll
try with the new (a24b) version and with the 1.8a19. 
I noticed cdrecord and mkisofs seem to be really "sensible" to the order
in wn writing down the options, isn't it? I think I'll write some REXX
script to ease the operations of making the ISO image and burning the CD,
if I'll have the time.

BTW, may somebody help me with the problem of system hanging?

Mentore

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universita' di Pisa (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          18-Oct-99 14:25:08
  To: All                                               18-Oct-99 14:36:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: piquant00@uswestmail.net (Annie K.)

On Sun, 17 Oct 1999 19:40:56, xyxmadxyx@xyxziplinkxyx.xyxnetxyx (mark 
davidson) wrote:

:here's another improvement.  mark some text in the body of a message 
:and click the right mouse button.  you're now able to 'copy' it to the
:clipboard whereas in the past (and unlike the win9x version) that 
:wasn't possible.

 I hope you're joking. That 'copy' menu needs to be done away with, 
fast.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: gczerw@home.No-Spam.com                           18-Oct-99 14:37:26
  To: All                                               18-Oct-99 14:36:02
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: gczerw@home.No-Spam.com (George Czerw)

On Mon, 18 Oct 1999 09:35:57, l_luciano@da.mob (Stan Goodman) wrote:

> I posted the following previously, but it has for some reason not made it 
> to Usenet. Please pardon if the first version shows up later.
>  
> I have replaced my AWE32 soundcard with a Crystal card (see subject line). 
> Before the installation, as instructed by the User's Manual, I wanted to 
> uninstall the AWE drivers using Selective Install; unfortunately, Warp4 
> Selective Install does not behave according to the manual's instructions, 
> so I deleted the two AWE drivers from config.sys, then began Selective 
> Install in order to install the new drivers. Because the system correctly 
> identified the card as "Crystal Audio CS-4232/36 PNP", I permitted it to 
> install from the OS/2 CDROM, which may have been a mistake. After reboot, 
> the sound system is silent.
>  
> There is a README file in the OS/2 directory of the CDROM, which is much 
> more specific about how previous audio cards must be uninstalled, as 
> follows:
>  
> ----------------------Quote follows-------------------
> If your system presently has Sound Blaster OS/2 device drivers installed
> and you do not have a Sound Blaster device installed, then you should
> de-install the Sound Blaster OS/2 drivers prior to running this 
> installation.
>  
> The de-installation of the Sound Blaster OS/2 device drivers requires
> the following steps:
>  
> a) ERASE \MMOS2 and all subdirectories (this removes OS/2 multimedia 
> support)
>    Some files won't delete, this is okay.
> b) Use OS/2 selective install to re-install OS/2 multimedia support.
>    It will auto-detect the wrong device.  You should override
>    the auto-detection to remove the Sound Blaster device driver.
>    When correct, the installation panel will have no audio devices listed.
> c) Complete selective installation and reboot
> d) You are now prepared to use this diskette to install Crystal drivers.
> ----------------------ends----------------------
>  
> I am very reluctant to follow these directions, because I would be deleting
> an MMOS2 directory which has been updated to FP10, and then reinstalling it
> from the original Warp4 distribution CDROM. If the instructions had said 
> something about updating specific files, one would have felt more 
> comfortable.
>  
> Has someone installed this card as a replacement to AWE32, or any other 
> Soundblaster card? If so, I would appreciate knowing how you accomplished 
> the feat.
>  
> 
> 
> -------------
> Stan Goodman
> Qiryat Tiv'on
> Israel
> 
> Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
> 
> 

Follow the "quoted instructions" in the readme file, then install the 
latest, appropriate Crystal drivers, (which you were advised in an 
earlier post, to download from the web site), then reinstall FP #10, 
which will update the MMOS2 files.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          18-Oct-99 14:33:13
  To: All                                               18-Oct-99 14:36:02
Subj: Re: Pronews/2

From: piquant00@uswestmail.net (Annie K.)

On Sun, 17 Oct 1999 20:15:44, "J. R. Fox" <jr_fox@earthlink.net> 
wrote:

:Hi -- 
:
:I would be interested in hearing from anyone who is familiar
:with News Harvest, PM-News, ProNews/2, and can make compara-
:tive recommendations between them.  Do they swallow large 
:blocks of messages, for OLR-style processing, or are they
:strictly real-time, like the NS Mail I'm using now ?  I think
:one or more of these may be off the market now, with reports
:here that their websites are no longer answering.  I would
:be inclined to steer clear of the orphaned product . . .  
:though I recognize that is an occupational hazard with OS/2
:s/w.

 Pronews/2 has both on- and offline capabilities. It's true that its 
creators have long since flown the coop, but IMO it's still the best 
GUI newsreader there is for OS/2. Can't comment on the other two 
programs you mentioned as I haven't used them.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: mohd.k.yusof@bohm.anu.edu.au                      19-Oct-99 00:41:06
  To: All                                               18-Oct-99 14:36:02
Subj: Re: Network security questions

From: mohd.k.yusof@bohm.anu.edu.au (Khairil Yusof)

On Mon, 18 Oct 1999 13:41:22, Christian Hennecke 
<christian.hennecke@ruhr-uni-bochum.de> wrote:

> My neighbour just told me that recently some people repeatedly tried to
> get access to his computer while he was online via a dial-up connection,
> but his security software blocked them. He is using a security
> application named "AT-Guard" under Windows 98 which you can configure to
> show and block access from outside and also from within (e.g. say your
> e-mail client tries to send something via FTP which it shouldn't be
> allowed to do). You can configure it for each application your are using
> and also to block adverts like with Junkbuster.

Let's see, if you don't run any daemons, then I don't think anybody can get 
access to your computer. eg. telnet, ftp etc. 

OS/2's tcpip stack is resistant to stupid DOS attacks.

If you do have telnet then you can configure a firewall if you have TCP/IP 4.1 

and only allow access for certain ports. To be safe:

no anonymous ftp uploads, a few users, with good passwords set to expire every 

month or so.

ditto for your webserver, disable put command

if you don't need it, don't run a telnet daemon.

People can only get into your computer, if you open the door. No daemons or
open
ports, no doors :)

Unless you run a major site with multiple users, simple precautions like the 
above will do. It's VERY unlikely somebody is even going to bother hacking
into 
your personal computer.

---

"A true friend knows who you really are, but still likes you anyway"
____________________________________________________________________

HTTP : http://hayai.freeshell.org         [external]
       http://fenner50.anu.edu.au         [internal]

ICQ  : 5783742  

PGP Key Id: 0x6FFEFD7F 
PGP Key available from public key servers


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Australian National University (1:109/42)

+----------------------------------------------------------------------------+

From: mamodeo@stny.rr.com                               18-Oct-99 10:50:14
  To: All                                               18-Oct-99 14:36:02
Subj: Re: help!!! PGCC is not working

From: Marty <mamodeo@stny.rr.com>

"G. van der Veer" wrote:
> 
> Hi,
> 
> When I run any program (for example Squid) compiled in PGCC 1.1.3 or
> below I get the following message:
> 
> SYS0191: GCC29166 cannot be run in an OS/2 session.

This can happen in a DLL when the DLL itself is dynamically linked to
other DLLs and it can't find one of them.

For example:
My_Exe.EXE is linked to GCC29166.DLL which is dynamically linked to
BLAH.DLL which can't be found.  This error message would be reported if
you tried to run My_Exe.EXE.

- Marty

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Global Services North -- Burlington, Vermont,
(1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  18-Oct-99 15:08:20
  To: All                                               18-Oct-99 14:36:03
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

On Mon, 18 Oct 1999 03:52:40, "Doug Darrow" <d.s.darrow@nvinet.com> wrote:

> On Sun, 17 Oct 1999 21:56:49 GMT, Stan Goodman wrote:
> 
> >I am very reluctant to follow these directions, because I would be deleting
> >an MMOS2 directory which has been updated to FP10, and then reinstalling it
> >from the original Warp4 distribution CDROM. If the instructions had said 
> >something about updating specific files, one would have felt more 
> >comfortable.
> 
> You're right, reinstalling MM support from the cd will back-level the
> updates from the fixpacks. But go ahead and do it. Once the original MM
> support has been installed, and the Crystal drivers have been
> installed, you can run FP10 again and it will then re-update ONLY the
> MM files to FP10 level.

If it turns out that I HAVE to do that, I would update to FP12. I don't 
feel any other need to do FP12, but what the Hey.

My advice to Crystal, if anybody from the company is reading this, is to 
get its act together, and provide a minimum level of support forits 
products. 

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  18-Oct-99 15:08:22
  To: All                                               18-Oct-99 14:36:03
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

Really, all I wanted to do was to get a better sound card. If it was going 
to entail living on the edge, or hunting for a fixpack that may or may not 
be around anymore, or trying to make sense of the basic discrepancies 
between the manual and the CDROM, or filter out the patently incorrect 
instructions, I probably would not have done it. I should have stuck with 
Creative Labs.

I understand the Crystal to be a good card. There is more to the product 
than just the card, and Crystal doesn't give it.


On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:

> In <yHQxxE9f8dqd-pn2-kHNmoslY4mCm@POBLANO>, l_luciano@da.mob (Stan Goodman)
writes:
> snipped instructions to selective uninstall/reinstall mmos2
> >
> >I am very reluctant to follow these directions, because I would be deleting
> >an MMOS2 directory which has been updated to FP10, and then reinstalling it
> >from the original Warp4 distribution CDROM.
> 
> I just did this yesterday - it took about a half hour total. Selective
> uninstalled multimedia, about five minutes. Reboot. Find the CD, about an 
> hour. Selective reinstall, about another five minutes. Reboot. Find where
> I put the fixpack files, start Service, choose Multimedia, another maybe
> ten minutes. Reboot. Sort of a pain, but not that big a deal. Service will
> let you Fix the old MMPM install easily. I use something from Hobbes - 
> fastkick141 I think ? that makes the fpak situation relatively painless.
> You might try it. DIUNPAK the .dsk files first, then the Fix.cmd runs you
> right through no muss, no fuss, *and* you have the disk images if you 
> need them again later. good luck
> 
> >
> >Has someone installed this card as a replacement to AWE32, or any other 
> >Soundblaster card? If so, I would appreciate knowing how you accomplished 
> >the feat.
> >
> >-------------
> >Stan Goodman
> >Qiryat Tiv'on
> >Israel
> 
> --
> H?rad ?ngravv?rd
> 
> 
> 

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: rascho@nospam.iname.com                           18-Oct-99 17:10:03
  To: All                                               18-Oct-99 14:36:03
Subj: Photo>Graphics

From: "Rade Popovic" <rascho@nospam.iname.com>

Hi

Maybe this question was asked before, but as I don't know the solution
of the problem I will ask it.
I am using Warp3 + FP42 + GRADD 0.80 + VIRGE DX + Photo>Graphics and
this combination gives me wierd pointer. I have black square with white
arrow in it for pointer, and it looks really ugly. Is there any way of
heaving nice little arrow for pointer (as it should be). Of course it
happens only in PG.

TIA

Rascho
e-mail:rascho@iname.com
ICQ# 49354974

------------------------
Hal 9000: "Dave, put those Windows disks down....Dave...DAVE!"


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Dugoprsti & Co. (1:109/42)

+----------------------------------------------------------------------------+

From: !2020hindsight@usa.net                            18-Oct-99 12:41:25
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: !2020hindsight@usa.net (Bill Clark)

Annie K. wrote:

> :Where does one find 2.1?
  
>  Hobbes /incoming, http://hobbes.nmsu.edu/pub/incoming

Thanks!... Now that  I have it, I'm curious as to what the newest and 
greatest, that we have been anxiously holding our breath for, amounts 
to...

TIA 

-bc-
 
User Friendly Software:
  That which makes friends among those trying to use it
	

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: engs0011@sable.ox.ac.uk                           18-Oct-99 16:34:13
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: engs0011@sable.ox.ac.uk (Ian Johnston)

Steve Snyder (swsnyder@home.com) wrote:

: Do I just installed the new version over my existing PMMail v2.0 
: installation?

I downloaded the file, ran it, specified my PMMail directory and it's 
working just fine. No need to enter my unlocking code, either.

Ian

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Oxford University, England (1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 18-Oct-99 16:02:10
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: zayne@omen.com.au (Mooo)

nospam@savebandwidth.invalid       (John Thompson) wrote:

>PMMAIL v2.10 still pegs cpu at 100% until PMMAIL 

Aha, yes, I spoke too soon actually.  Speaking of 100% CPU...I don't
have the same problem as you do, but it irks me that Pmmail (and a
coupla other programs) block other processes whilst they start.
Netscape pretty much does this as well - looks like its a problem that
here to stay :(

Craig

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nothing I say is my own opinion (1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 18-Oct-99 16:02:11
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: zayne@omen.com.au (Mooo)

Nick Knight <nick@secant.com> wrote:

>>There is at least one improvement.  You no longer get black 'blobs' at
>>the end of every line when you print an email on an HP LJ :)
>
>That's a relief!  At first I though this might be just some marketing ploy
>to try to convince people there is life in the product simply by upping a
>version number a full point.
>
>Now, it's completely obvious to me that this was a full maintenance
>release :)

hehehe.  Its a small thing to most I suppose, but this little problem
really bugged the hell outa me


>Perhaps I'm being too stingy with my release versions increments? <grin>

heh :)  Why not do what all the 'big guns' now do...which is to say,
just release major revisions, like go from V3 to V4 and V4 to V5 (or
the currently popular V2000) :)))

Craig


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nothing I say is my own opinion (1:109/42)

+----------------------------------------------------------------------------+

From: st@bonn.iz-soz.de                                 18-Oct-99 18:42:22
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Pronews/2

From: "Maximilian Stempfhuber" <st@bonn.iz-soz.de>

On 18 Oct 1999 14:33:26 GMT, Annie K. wrote:

> Pronews/2 has both on- and offline capabilities. It's true that its 
>creators have long since flown the coop, but IMO it's still the best 
>GUI newsreader there is for OS/2. Can't comment on the other two 
>programs you mentioned as I haven't used them.

I dropped Pronews/2 and went to SLRN because Pronews/2 crashed when
downloading groublists with more than 32.000 entries (or at least I thought
it was the reason). Has anyone other experiences?

Regards


Maximilian Stempfhuber
Project Manager
___________________________________________________________________
German Social Science Information Centre (IZ)
Project ELVIRA II
Lennstr. 30, 53113 Bonn, Germany
Tel.: (+49) (0)228 - 2281-139  
Fax: (+49) (0)228 - 2281-120
E-Mail: st@bonn.iz-soz.de  
WWW: http://www.elvira.bonn.iz-soz.de
___________________________________________________________________
The box said "Requires Windows 95 or better." So I bought OS/2 Warp


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: German Social Science Information Centre (1:109/42)

+----------------------------------------------------------------------------+

From: xyxmadxyx@xyxziplinkxyx.xyxnetxyx                 18-Oct-99 13:40:21
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: mark davidson <xyxmadxyx@xyxziplinkxyx.xyxnetxyx>

On 18 Oct 1999 14:25:16 GMT, piquant00@uswestmail.net (Annie K.)
wrote:

>:here's another improvement.  mark some text in the body of a message 
>:and click the right mouse button.  you're now able to 'copy' it to the
>:clipboard whereas in the past (and unlike the win9x version) that 
>:wasn't possible.

> I hope you're joking. That 'copy' menu needs to be done away with, 
>fast.

to each their own but i'm curious.  why is it that you think it needs
to be done away with? 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                18-Oct-99 10:42:18
  To: All                                               18-Oct-99 16:32:02
Subj: Re: PMMail2.1 & PGP

From: John M Price PhD <jmprice@calweb.com>

In comp.os.os2.mail-news article <380a250d.128579@news.demon.co.uk>
no-one@nospam wrote:
: On Sun, 17 Oct 1999 18:31:47 +0200 (CDT), "Adrian Gschwend"
: <nospam_ktk@netlabs.org> wrote:

:>Almost nothing happens on my machine. If I get a PGP encrypted message, I
:>just see garbage. If I save the message and uncrypt it by hand it works. If
a
:>message is signed I just get "Could not verify PGP key". And I don't know
how
:>to encrypt a message with PGP because nothing happens. I use PGP 5.0

: How are you viewing the messages ?    I do not use the preview pane
: window.   I have to click on the message to open it and when I do I
: get  a message requesting my passphrase before the message opens.  If
: the passphrase is correct, the message opens decrypted, if not correct
: the message opens with encrypted text displayed.

I added version 5, Geiger's compile, and it flat does not work.  I have
tried opening a message, and it has hung the entire machine on the
passphrase window.  (Previously, it was simply blank - manual gavce me a
'need newer version error.)  If I go to the folder where the message is,
and run PGP from the command line, it works fine.  I've not tried
encryption.

Does PMMail know about the version 5 'multiple binaries' issue?

Very frustrating.  This was one of the selling points for me - saving
bouncing back and forth from command line, text import, etc.

-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

"As the most participatory form of mass speech yet developed, the
Internet deserves the highest protection from government intrusion."
    - U.S. District Court for the Eastern District of Pennsylvania
    Dolores K. Sloviter, chief judge, U.S. Third Circuit Court of Appeals
    U.S. District Judge Ronald L. Buckwalter &
    U.S. District Judge Stewart Dalzell, presiding

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 18-Oct-99 17:33:25
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: hamei@pacbell.net

In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
>On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
>> I just did this yesterday - it took about a half hour total. Selective
>> uninstalled multimedia, about five minutes. Reboot. Find the CD, about an 
>> hour. Selective reinstall, about another five minutes. Reboot. Find where
>> I put the fixpack files, start Service, choose Multimedia, another maybe
>> ten minutes. Reboot. Sort of a pain, but not that big a deal. Service will
>> let you Fix the old MMPM install easily. I use something from Hobbes - 
>> fastkick141 I think ? that makes the fpak situation relatively painless.
>> You might try it. DIUNPAK the .dsk files first, then the Fix.cmd runs you
>> right through no muss, no fuss, *and* you have the disk images if you 
>> need them again later. good luck
>> 
>> >
>
>Many programs add files such as dll's to the mmos2 directory.  2 
>examples are quickflick, anpocodec and the netscape plugin pack.  If 
>you do an uninstall and reinstall, what happens to those files.


reinstall those as well, yeah, it's kinda tedious . . . but if you
want the new soundcard to work . . . ?? the point was that
the fixpack will upgrade just mmos2 without messing with
the rest of the system.

--
Hrad ngravvrd



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: heloman@my-deja.com                               18-Oct-99 17:38:08
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: heloman@my-deja.com

 _______________________________________________________________
>
> What if you have a large amount of memory, and wanted to mini-
> mize the amount of transitory junk written to your H/D ?  If
> there was a way to have most of that stuff cached in RAM, and
> not written to disk at all, that would interest me (for some,
> maybe most sessions).   <snip>

This is how I am currently running my system. I downloaded the
virtual ram program ramfs64.zip (Hobbes should have it) and
installed it as my drive Z. Go into Netscape - Edit -
Preferences - Advanced - Cache and in the window there tell it
that the drive to use for "disk cache folder"  Z:\cache. From
then on every time you start Netscape it will automatically go
to the virtual drive and use it instead of the hd. Works great
here.  Hope this helps and good luck......


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: bfrancis@pobox.com                                18-Oct-99 14:01:13
  To: All                                               18-Oct-99 16:32:02
Subj: Re: Crystal "TidalWave128" sound card

From: "Bruce Francis" <bfrancis@pobox.com>

On Sun, 17 Oct 1999 21:08:18 GMT, Stephen Eickhoff (remove the - to reply)
wrote:

>Try http://www.tabi.org/timur/crystalos2.html for more information.
>
>I don't know what the status of that company is. I'd say you're stuck with
>using the drivers in the
>box or the generic Crystal drivers.

You're not "stuck with using the drivers" .... you can get current drivers
for that card at cirrus.com/drivers/audiodrv   or at   www.crystal.com




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  18-Oct-99 17:35:18
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

Can anybody else see the webpage that this URL points to? My browser 
(Netscape 4.61) ruturns a page that is empty, save for the partial tag on 
the following line:
<Meta Name="Hpp" Cont

On Mon, 18 Oct 1999 03:17:40, "David D. Huff Jr." <huffd@nls.net> wrote:

> Stan,
> Help will be slow in coming for the next week. Many of the major players
> are at Warpstock99. But the following URL has all you will ever need to
> know about the Crystal chips: http://www.tabi.org/timur/crystalos2.html
> Here is where you get the drivers:
> ftp://ftp.cirrus.com/pub/drivers/audio/
> cwos2202.zip for ISA cards
> cwos2303.zip for PCI cards.
> 
> I was one of the early users. My Tidalwave128 was replaced due to faulty
> plumbing and my new one was #15 hand stamped by the tester. I wouldn't
> part with it.
> 
> Have fun,
> Dave Huff
> 
> Stan Goodman wrote:
> 
> > I have replaced my AWE32 soundcard with a Crystal card (see subject line).
> > Before the installation, as instructed by the User's Manual, I wanted to
> > uninstall the AWE drivers using Selective Install; unfortunately, Warp4
> > Selective Install does not behave according to the manual's instructions,
> > so I deleted the two AWE drivers from config.sys, then began Selective
> > Install in order to install the new drivers. Because the system correctly
> > identified the card as "Crystal Audio CS-4232/36 PNP", I permitted it to
> > install from the OS/2 CDROM, which may have been a mistake. After reboot,
> > the sound system is silent.
> >
> > There is a README file in the OS/2 directory of the CDROM, which is much
> > more specific about how previous audio cards must be uninstalled, as
> > follows:
> >
> > ----------------------Quote follows-------------------
> > If your system presently has Sound Blaster OS/2 device drivers installed
> > and you do not have a Sound Blaster device installed, then you should
> > de-install the Sound Blaster OS/2 drivers prior to running this
> > installation.
> >
> > The de-installation of the Sound Blaster OS/2 device drivers requires
> > the following steps:
> >
> > a) ERASE \MMOS2 and all subdirectories (this removes OS/2 multimedia
> > support)
> >    Some files won't delete, this is okay.
> > b) Use OS/2 selective install to re-install OS/2 multimedia support.
> >    It will auto-detect the wrong device.  You should override
> >    the auto-detection to remove the Sound Blaster device driver.
> >    When correct, the installation panel will have no audio devices listed.
> > c) Complete selective installation and reboot
> > d) You are now prepared to use this diskette to install Crystal drivers.
> > ----------------------ends----------------------
> >
> > I am very reluctant to follow these directions, because I would be
deleting
> > an MMOS2 directory which has been updated to FP10, and then reinstalling
it
> > from the original Warp4 distribution CDROM. If the instructions had said
> > something about updating specific files, one would have felt more
> > comfortable.
> >
> > Has someone installed this card as a replacement to AWE32, or any other
> > Soundblaster card? If so, I would appreciate knowing how you accomplished
> > the feat.
> >
> > -------------
> > Stan Goodman
> > Qiryat Tiv'on
> > Israel
> >
> > Spammers are getting smarter; email sent to l_luciano@da.mob will not
reach
> > me. Sorry.
> > Send E-mail to: domain: hashkedim dot com, username: stan.
> >
> > 

> 

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: bbarclay@ca.ibm.com                               18-Oct-99 14:03:22
  To: All                                               18-Oct-99 22:36:23
Subj: Re: cdwriter support

From: Brad BARCLAY <bbarclay@ca.ibm.com>

Pierre Jelenc wrote:
> 
> Peter McMorran <mcmorran@norfolk.infi.net> writes:
> >
> > Which CD rippers are you using? cdrecord/2 includes cdda2wav,
> > which works with the Yamaha CRW4416, so I expect it ought to work
> > with the 64616 also.
> 
> It does. I had not thought of it because I used to use others when I had
> my old IDE drive and they were set up ready to use. So far cdda2wav is the
> only one that works, all the others either say the drive does not support
> CD-DA or they grab nothing (one got 44 bytes, another got the full length,
> but it was all zeros! I don't remember which is which but I tried Leech,
> CD2MP3, CD Audio Dump/2, JCDread/2, Alfons, and PMCD2WAV.)

	The MultiMedia Setup notebook allows you to specify what features your
CD-ROM drive supports (under the Compact Disc tab(s)).  One of these
selections is "Digital Transfer".  If it's not enabled, select it.

	If the applications you're using are querying the MMPM subsystem to see
if your drive supports digital transfers, and this selection was
previously disabled, it could explain why they weren't working.

Brad BARCLAY

=-=-=-=-=-=-=-=-=-=
Posted from the OS/2 WARP v4.5 desktop of Brad BARCLAY.
E-Mail:  bbarclay@ca.ibm.com		Location:  2G43D@Torolabs

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Toronto Labs, DB2 for OS/2 Install Developer (1:109/42)

+----------------------------------------------------------------------------+

From: bbarclay@ca.ibm.com                               18-Oct-99 14:11:04
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Bios/Large HD Install Question

From: Brad BARCLAY <bbarclay@ca.ibm.com>

seth berk wrote:
> 
> 1)  The Bios won't  auto detect past 2 gigs.  It has 3 settings for a
> 2 gig HD (normal, Large, LBA),  if I can partition the HD to an
> intial 2 gig size, can I use the Bios anyway?  It is an old (1995)
> Award Bios.

	I don't know about Linux, but I do know that the IBM1S506 driver under
OS/2 will use the geometry used by the drive over the one used by the
BIOS if they differ.  OS/2 generally doesn't use BIOS calls for hard
disk access - so if you set it up for 2Gb under your BIOS, you might be
able to get away with using the full space under OS/2 anyhow (and if it
doesn't use the proper geometry automatically, you should be able ot use
the /GEO: switch for the 1S506 driver to manually specify it's geometry,
and enable LBA mode).
 
> I have updated the OS/2 Install diskettes with the FDISK and
> IBM1S506.ADD on my boot partition.  I am hoping that if I can install
> OS/2 in the first 1024 cylinders that it will look beyond the 2 gigs
> that the BIOS is limited to.  Is this right?

	This should work just fine.
 
> Is there a central repository for BIOS updates if I can't find my
> Mother Board's manufacturer?

	No.  Unfortunately, the BIOS is often motherboard specific, and often
not only to the specific manufacturer, but to the specific motherboard
model as well.  I have a friend who toasted his MB installing an Asus
BIOS update to his Asus motherboard, only to realize later (after trying
to reboot...) that he applied the patch for a motherboard revision
different from the one he owned :P.
 
> Thanks for listening to this OT post - I have come to trust the
> advice given here, and didn't want to start with a new NG.

	No problem :).

Brad BARCLAY

=-=-=-=-=-=-=-=-=-=
Posted from the OS/2 WARP v4.5 desktop of Brad BARCLAY.
E-Mail:  bbarclay@ca.ibm.com		Location:  2G43D@Torolabs

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Toronto Labs, DB2 for OS/2 Install Developer (1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       18-Oct-99 18:35:01
  To: All                                               18-Oct-99 22:36:23
Subj: Re: cdwriter support

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

On Mon, 18 Oct 1999 09:16:39 +0000, s135989@studenti.ing.unipi.it wrote:
>On 15 Oct 1999, Pierre Jelenc wrote:
>
>+Anssi Saari  <as@sci.fi> writes:
>+> 
>+> Oh sorry, now I understand. You're using some weird front end. Just a
>+> guess, but maybe you should specify the device in cdrecord syntax,
>+> 3,0? Or maybe, if you just set the environment variable CDR_DEVICE you
>+> don't need to guess what the author had in mind?
>+
>+It's CDwriter. 
>+
>I had a system hang with my Yamaha 6/4/16 using cdrecord 1.8 a24, so I'll
>try with the new (a24b) version and with the 1.8a19. 
>I noticed cdrecord and mkisofs seem to be really "sensible" to the order
>in wn writing down the options, isn't it? I think I'll write some REXX
>script to ease the operations of making the ISO image and burning the CD,
>if I'll have the time.

Can't help with hanging, but my 4416s also hung with releases
1.8a24.  The newer 24b release has fixed it 100%!

Previosuly acessing the drive gave a trap. 

Cheers
Chris


-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                18-Oct-99 14:41:29
  To: All                                               18-Oct-99 22:36:23
Subj: Netscape cache messing up

From: lifedata@xxvol.com

Netscape 4.61:  The cache has started messing up in general just recently. 
I've
cleared out both memory cache and disk cache, turned them off etc., but I
still
keep seeing web pages re-download over and over.

And the download restart cache is gone.  Stopping a download from the cancel
button or the exit window click box used to result in a restart picking up
where
it left off, even after Netscape was taken down started.

Something has screwed up here and I have no idea what to do for it.

Help?

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    18-Oct-99 10:12:16
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Bios/Large HD Install Question

From: "seth berk" <snberk@ibm.net>

On 17 Oct 1999 04:35:53 GMT, Annie K. wrote:

>On Sat, 16 Oct 1999 18:50:47, "seth berk" <snberk@ibm.net> wrote:
>
>[snip]
>
>: The Bios won't  auto detect past 2 gigs. 
>
>[snip]
>
> Why not see if there's a BIOS update for it? Might be the best 
>solution.
>
>-- 
>Klaatu barada nikto

Actually, thats what I did.  I had managed to kludge together a
system, but it was obviously not happy.  I have never "flashed"
anything before so was hesitant, plus I didn't know who the MB
manufacturer was.  But... by using a meta search engine with some key
words I knew about the MB I found a site that listed model numbers (I
had a model number, but no maker name!?!) with the maker.  Once I
figured out the MB was made by Asus the rest was easy.  So thanks for
the reply.  Now that I've done it I realize it was nothing to get
worried about.  

Seth


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    18-Oct-99 10:59:27
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Ghost writer

From: "seth berk" <snberk@ibm.net>

I know it is possible to run Adobe PhotoShop v3, (and IIRC PS v4 too)
by doing a hybrid Win32 v1.25/v1.30 install.  I *don't* know if
pagemaker would work as well.  Check Deja for the archived thread
(use variations on "Win1.25"(??) as a keyword.  If you can't find it
there, write to me off-list and I'll see if I haven't saved it
somewhere.

Seth
snberk@ibm.net


On Thu, 14 Oct 1999 11:19:14 -0400, W.N.(Bill) McCaw wrote:

>I make up camera ready pages for our local singing group's programs,
>using Lotus WordPro for OS2.
>
>The printer is a Mac outfit, using the Mac version of Page Maker, so I
>bought Page Maker 6.0 for Windows, so that I could send the stuff in on
>a disk and save the endless trips when proofing the final copy.  
>
>Turns out that 6.0 uses a later version of Win 32 than OS2 supports, and
>of course, Page Maker will not accept WordPro files.  
>
>What version of Ghost writer do I need to get to transform Word Pro
>files into Page Maker format?  
>
>Is the program (Ghost writer) reliable for this purpose?
>
>Too bad that there is no Page Maker style program for OS2 that could
>turn out acceptable files.
>-- 
>Cheers! W.N.(Bill) McCaw
>
>"When is doubt, Act like a pro!!"



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     18-Oct-99 19:54:17
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Sat, 16 Oct 1999 19:16:23, Michael Warmuth 
<michael.warmuth@wu-wien.ac.at> wrote:

> + You use a proxy on the same machine (like WBI).
>  
> + You have a DNS running on the same computer (like BIND).
>  
> + You use a 32bit TCP/IP stack (e.g. TCP/IP 4.1 or MPTS WR8610 or 
> WR8620).
>  
> I am not quite sure if all of the above is required to run into the 
> problem. Nor do I know if this happens if you use another proxy (like 
> SQUID) or another nameserver.
> 

I use SmartCache, which is a proxie caching program (JAVA), I do not 
have a DNS running on my machine, and I am using the TCP/IP that comes
with warp4, updated to the WR8424 level, and the PEER fix at IP8412. I
do have the problem of going to 100% on some web pages. I had thought 
about turning off the memory cache, but have never got around to 
trying it. Now, I am going to try it.

Thanks...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     18-Oct-99 19:54:18
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Sun, 17 Oct 1999 10:11:48, stephen@turboweb.splat.spam.net.au 
(stephen) wrote:

> On Sat, 16 Oct 1999 19:16:23, Michael Warmuth 
> <michael.warmuth@wu-wien.ac.at> wrote:
> 
> > TURN OFF NETSCAPE'S MEMORY CACHE!!! (set it to 0)
> >  
> 
> Finally someone else has confirmed for me what I have posted on a 
> couple of occasions as seeming to work for me! I have been wondering 
> if it was just coincidental in some weird way, or if setting memory 
> cache to zero did the trick, but nobody ever responded to my comment 
> (or I missed the response).
> 
> Regards,
> 
> Stephen

Hmmm. Never saw your comments (probably because I tend to skip past a 
lot of these posts, especially after they get to be more than about 6 
deep). Sometimes, it is worth starting a new thread, if you come up 
with some new information.
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     18-Oct-99 19:54:13
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Best way to get Wordpro Documents into StarOffice?

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Fri, 15 Oct 1999 17:09:06, John Abraham <jabraham@ucalgary.ca> 
wrote:

> I've installed StarOffice and want to give it a try.  But it doesn't
> convert my Lotus WordPro files (it just launches WordPro when I try to
> open them.)
> 
> What's the best way to get them in?  Should I "save as MSWord" from
> Wordpro?  Or RTF? Or AmiPro?
> 
> Or is it supposed to be able to convert them directly?
> 
> -- 
> John Abraham, M.Sc. P.Eng.
> T.J. Modelling Ltd.
> Mathematical Modelling for Transportation Planning and Urban Design
> jabraham@ucalgary.ca

I haven't tried it, but RTF (Rich Text Format) seems to work well for 
converting between programs (in general). Sometimes, you need to try 
more than one way to find the best conversion path.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     18-Oct-99 19:54:19
  To: All                                               18-Oct-99 22:36:23
Subj: Re: StarOffice 5.1

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Sat, 16 Oct 1999 19:40:40, heloman@my-deja.com wrote:

> While I don't wish to look a gift horse in the mouth or be
> critical of any product/vendor producing for OS/2 I need a
> little help with StarOffice 5.1  Having only been able to 'play'
> with it for a few days it appears the "HELP" portion is either
> very lacking and user unfriendly or I am not in tune with being
> able to use it. I was trying to import a file/export a file with
> conversion to other format(s) and delete a previously saved
> file. Trying to get this information from help was about as
> helpful as the error msg from os/2 when trying to format a
> floppy (and you find it is write protected). Is there a printed
> document, PDF or can someone plese tell me how to get the
> information from it in a more useable form. I thank anyone for
> their response.....
> 
> 
> Sent via Deja.com http://www.deja.com/
> Before you buy.

I agree that the Help doesn't, which is too bad, because StarOffice 
seems to be a very powerful program. I have also found that StarOffice
will do almost anything you want, once you figure out how to do it. 
The "best" way, that I have found, is to start looking until you find 
something that looks promising, then try it to see what it really 
does. Don't forget about the right mouse button, it is used 
extensively for navigation within StarOffice.

I have heard that one of the CD offerings does have a manual included.
I have no idea if it is useful. I have also heard about a book 
(specifically for the LINUX version, I think), that may help. I have 
no idea where to get one, but AMAZON books (on the web, somewhere), 
might have it.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     18-Oct-99 19:54:16
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Crystal "TidalWave128" sound card

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Sun, 17 Oct 1999 19:31:44, l_luciano@da.mob (Stan Goodman) wrote:

> If somebody -- ANYBODY -- knows where the card's manufacturer discusses the
> card, I hope he will let me in on the well-kept secret. There are enough 
> inconsistencies in the documentation on the CDROM, and between the 
> documentation and the way Warp4 actually behaves, that I would like to see 
> up to date information, and even to discuss the product with a live support
> person.
>  
> Many thanks.
>  
> ----------
> Stan Goodman
> Qiryat Tiv'on
> Israel
>  
> Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
>  

Get the latest drivers, from the chip manufacturer's web site, at:

http://www.cirrus.com/drivers/audiodrv/

MOST of the time, they will work without doing anything special.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                18-Oct-99 13:03:28
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Enhanced E

From: John M Price PhD <jmprice@calweb.com>

In comp.os.os2.apps article <enfpubabfcnzvanzrpbz.fjrjta0.pminews@news.tel.hr> 
Rade Popovic <rascho@nospam.iname.com> wrote:
: Hi

: One quick question. Enhanced E beeps every time I start it. Is it
: normal and how can I make it stop (it is annoying)?
: And also help doesn't work. I can't evan see it when typing viewhelp
: eee.hlp; it says help is not available at this time; hyperview can't
: open it either.

I had this problem.  Wayne forwarded me a new copy of the help file, and
that fixed it.  The email address is in the readme.

Look at the help file in the old system editor, and you'll see it is
corrupted.

He did say he checked the help file in the zip package, so you might try
simply another download of it.  



-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

VIRGO (Aug 23 - Sept 22)
        You are the logical type and hate disorder.  This nitpicking is
        sickening to your friends.  You are cold and unemotional and
        sometimes fall asleep while making love.  Virgos make good bus
        drivers.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: jdesmaraNOjdSPAM@novanthealth.or...               18-Oct-99 13:17:16
  To: All                                               18-Oct-99 22:36:23
Subj: Re: StarOffice 5.1

Message sender: jdesmaraNOjdSPAM@novanthealth.org.invalid

From: John Desmarais <jdesmaraNOjdSPAM@novanthealth.org.invalid>

In article <SKfw30zmCGmZ-pn2-1xJH6O5R5cKD@localhost>,
doug.bissett"at"attglobal.net (Doug Bissett) wrote:
>  I have also heard about a book
> (specifically for the LINUX version, I think), that may help. I
> have
> no idea where to get one, but AMAZON books (on the web,
> somewhere),
> might have it.

There are two books you can look for.

"Special Edition Using StarOffice" - Pricey, but mostly platform
neutral.

"Staroffice 5.1 Fast and Easy" - I don't think it's actually out yet.
About all I can tell you abut it is that it's smaller and cheaper than
the book mentioned above, and from the very short description I've read
isn't really geared towards any one platform.

-=>John Desmarais


* Sent from RemarQ http://www.remarq.com The Internet's Discussion Network *
The fastest and easiest way to search and participate in Usenet - Free!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://www.remarq.com: The World's Usenet/Discuss
(1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          18-Oct-99 20:56:27
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: piquant00@uswestmail.net (Annie K.)

On Mon, 18 Oct 1999 17:41:50, !2020hindsight@usa.net (Bill Clark) 
wrote:

:> :Where does one find 2.1?
:  
:>  Hobbes /incoming, http://hobbes.nmsu.edu/pub/incoming
: 
:Thanks!... Now that  I have it, I'm curious as to what the newest and 
:greatest, that we have been anxiously holding our breath for, amounts 
:to...

 I don't see anything different in 2.1 compared to 2.0. Some say the 
printing bug (big squares among printed text) has been fixed, but I 
haven't tried it yet.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          18-Oct-99 20:55:06
  To: All                                               18-Oct-99 22:36:23
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: piquant00@uswestmail.net (Annie K.)

On Mon, 18 Oct 1999 17:40:42, mark davidson 
<xyxmadxyx@xyxziplinkxyx.xyxnetxyx> wrote:

:>:here's another improvement.  mark some text in the body of a message 
:>:and click the right mouse button.  you're now able to 'copy' it to the
:>:clipboard whereas in the past (and unlike the win9x version) that 
:>:wasn't possible.
: 
:> I hope you're joking. That 'copy' menu needs to be done away with, 
:>fast.
: 
:to each their own but i'm curious.  why is it that you think it needs
:to be done away with? 

 It's redundant. How many ways do you need to copy to the clipboard? 
There's a copy function under the edit menu, I usually hit Ctrl-Ins, 
but if I'm mousing I swipe, hold the LMB down, and tap the RMB. Plus, 
the damn thing's taken the place of 'Explore URL.' I think someone 
who's never used OS/2 stuck that 'copy' in there.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: JDS@nospam-syntel.com                             18-Oct-99 14:25:26
  To: All                                               18-Oct-99 22:36:23
Subj: Re: How to export email from PMMail

From: Jonathan Seder <JDS@nospam-syntel.com>

This Rexx program and associated filter file extracts PMMail messages in
a nice format:


/* trace intermediate */
/* Extract messages from PMMail */
/* Jonathan Seder 1998-9  e-mail: jseder at syntel dot com */
/* You can use this non-commercial applications */

/* Run this from the directory which contains the messages you want to
dump */
/* They will get printed to stdout in a nice format */

trace normal
i = 0
mimefile = 'c:\user\mime.lst'
do forever
   if lines(mimefile)=0 then leave
   i = i + 1
   mime.i = linein(mimefile)
   end
mime.0 = i
infile = 'FOLDER.BAG'
do forever
   if lines(infile)=0 then leave
   b = linein(infile)
   /* The separator char below is 0xDE or decimal 222*/
   parse var b ,
          m_c1          ,
      '' m_c2          ,
      '' m_date        ,
      '' m_time        ,
      '' m_subj        ,
      '' m_tos         ,
      '' m_tonames     ,
      '' m_fromnames   ,
      '' m_from        ,
      '' m_size        ,
      '' m_fn          ,
      '' m_x
/* status = word("Unread Read Replied Sent",m_c1+1) */
   say ''
   say
'-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-'
   say ''
   do forever
      if lines(m_fn)=0 then do
         s = stream(m_fn,'c','close')
         leave
         end
      i = IsNotMime(0)
      end
   end
return

IsNotMime: procedure expose mime. m_fn
m = linein(m_fn)
do i=1 to mime.0
/* say 'pos('m','mime.i')='pos(mime.i,m) */
   if pos(translate(mime.i),translate(m))<>0 then return 0
   end
say m
return 0

/* end of cmd file */

/* Here is my mime.lst */

Post.Office
 for <userid@
 SMTP Relay
 with esmtp
 with SMTP id
 with SMTP;
 id <
boundary="--------
charset:
charset=
Content-Description:
Content-Disposition:
Content-Transfer-Encoding:
content-type:
envelope-from
Errors-To:
in-reply-to:
message-id:
mime-version:
Organization:
Priority:
received:
references:
reply-to:
return-path:
tatus:
X-Accept-Language:
X-Eci-Info:
X-Lotus-FromDomain:
x-mailer:
X-MimeOLE:
X-Mozilla-Status2:
X-Originating-IP:
x-sender:
X-Server-Uuid:
x-status:
X-UIDL:
X-Gateway:
X-WSS-ID:

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SyntelSoft Inc (1:109/42)

+----------------------------------------------------------------------------+

From: engs0011@sable.ox.ac.uk                           18-Oct-99 21:57:29
  To: All                                               19-Oct-99 03:31:01
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: engs0011@sable.ox.ac.uk (Ian Johnston)

Mooo (zayne@omen.com.au) wrote:

: There is at least one improvement.  You no longer get black 'blobs' at
: the end of every line when you print an email on an HP LJ :)

I've been printing to a LJ1100 from PMMAil v2.0 for ages without ever seeing
these blobs.

Southsoft Technical people told me that this release would solve the "timed
fetch" bug - sometimes (*) PMMail would start demanding 100% CPU resources
in a timed fetch, resist all attempts to kill it, and require a reboot. I
have nervously reinstated timed fetching in v2.10 ... no problems so far.

Ian

* - "sometimes", in my opinion meaning "in second or subsequent connections
to the net". 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Oxford University, England (1:109/42)

+----------------------------------------------------------------------------+

From: hunters@thunder.indstate.edu                      18-Oct-99 22:08:24
  To: All                                               19-Oct-99 03:31:01
Subj: Re: no audio from cdplayer

From: hunters@thunder.indstate.edu

In article <380a6302$1$qnivfs$mr2ice@news.logical.net>,
  nemo@union.edu wrote:

> I just discovered that my music cd-player isn't working in Warp,
> FP10. It works when booted to Win95 when I can't get a sound out of
> it when booted to OS/2. I do have system sounds and can play wav's,
> midi's, etc.
>
> Just need a fast tip where to look for trouble-shooting. Couldn't
> find anything on deja.com.

Have you checked the CD player volume? (ie: click on the little
"speaker" and make sure it's turned up.)

Have you tried using the Digital Transfer mode?

--
-Steven Hunter               *OS/2 Warp 4 * |Warpstock '99 | Oct 16-17|
hunters@thunder.indstate.edu *AMD K6-2 400* |       Atlanta GA        |


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: egermain@mediaone.net                             18-Oct-99 22:51:05
  To: All                                               19-Oct-99 03:31:01
Subj: Partition Magic 4.0 Bug, I believe

From: egermain@mediaone.net (Edward Germain)

When building partition tables, OS/2 requires strict adherence to its 
published rules.  Partition Magic takes shortcuts.  It can change your
partition table so that OS/2 can't read it accurately, even though 
Windows and/or NT can.

It works like this:  If you have a drive with OS/2 in the C: partition
followed by  an extended partition with more than 2 logical partitions
in it, and then you move some freespace from the end of your drive up 
to the C: partition, your computer will not be able to recognize all 
the partitions.

I have duplicated this several times with my setup: an 18-gig drive 
with bootmanager loaded, an OS/2 C: partition active, a hidden NT C: 
partition, an extended partition with four logical partitions in it, 
and free space at the end.  I moved a gig of free space up to the 
hidden NT partition, and while NT and Partition Magic could see the 
drives correctly, OS/2 could only recognize the OS/2 C: partition.  
FDisk couldn't find the remainder of the disk.

I have called Partition Magic's tech. support twice.  Both times I was
told to reformat my computer and restore from backup.  (Which I had to
do, by the way--it was the right advice).

I have submitted a report about this to PowerQuest.  PowerQuest has 
offered to refund my money.  I am getting a refund, because the 
product is dangerous to use with OS/2.

I have been careful about working through this process and am fairly 
certain about the conclusions I've posted.  However, if anyone has a 
different experience in this particular situation or a different 
analysis, please let me, and others, know.

My understanding is that OS/2 requires each partition to be linked by 
address to the partitions on either side of it.  Partition Magic 
doesn't..

--Ed Germain

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Road Runner (1:109/42)

+----------------------------------------------------------------------------+

From: egermain@mediaone.net                             18-Oct-99 23:00:15
  To: All                                               19-Oct-99 03:31:01
Subj: Re: Xywrite and OS/2 

From: egermain@mediaone.net (Edward Germain)

On Mon, 4 Oct 1999 08:33:03, Daniel Say <say@sfu.ca> wrote:

> In comp.os.os2.apps Esther Schindler <esther@bitranch.com> wrote:
> : On Sun, 3 Oct 1999 02:49:38, Daniel Say <say@sfu.ca> wrote:
> : |         and some of us find XYwrite very fast.  It's still
> : |         sold by The Technology Group in Baltimore.
> 
Amazing.  It was the best of the best, but the sad, sad tale when it 
was sold to IBM and then wrecked in development (the product was to be
called "Signature"--I still have an alpha version around somewhere) 
and then abandoned by IBM--well it's too sad to be retold.

Thank you for the news that to some degree it is still alive!

--Ed Germain

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Road Runner (1:109/42)

+----------------------------------------------------------------------------+

From: merlins@ibm.net                                   18-Oct-99 19:20:23
  To: All                                               19-Oct-99 03:31:01
Subj: Re: LoadDskF.exe & IBMWorks CSD 2.1

From: Meinolf Sondermann <merlins@ibm.net>


hamei@pacbell.net wrote:
> 
> In <7udeq6$dde$1@nnrp1.deja.com>, j.welton@mailcity.com writes:
> snip
> >
> >I get the error message:
> >
> >Unsupported disk type
> >
> >I am trying to create a set of floppies on standard 1.44kb disks.  When
> >I look at the size of the DSK files above I see they are larger than
> >1.44kb and assume the system is telling me my floppy is insufficient to
> >support the volume needed.  I tried issuing the same command to have
> >the data created on another (fixed) partition only to receive an error
> >that the program is unable to write to a fixed disk.
> >
> >So how does one get these DSK files over to floppies?
> 
> you probably have remmed BASEDEV=XDFLOPPY.FLT from your config.sys ?
> you need it to make Xtended Density images, I think.
> 
> --
> Hrad ngravvrd


And for copying the images to floppy you may have to run the "xdfcopy"
utility.

Bye/2
Meinolf


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: merlins@ibm.net                                   18-Oct-99 20:03:27
  To: All                                               19-Oct-99 03:31:01
Subj: Re: Bios/Large HD Install Question

From: Meinolf Sondermann <merlins@ibm.net>


seth berk wrote:
> 
> Hello:
> 
> I hope you Gurus will tolerate an slightly off topic post.
> 
> I recently upgraded my computer system from an old P90 system to a
> 350 PII one by moving the hard-drives (a 2 gig and a 1 gig) and other
> useful cards from the old box to the new box.  No problems there.
> OS/2 handled it beautifully.  However...   Now the computer store has
> convinced me that I should turn the old P90 box into a Linux box, and
> sold me the required hardware which included an 8 gig Harddrive
> (Smallest one they had on the shelves!  By the way did you see that
> IBM is now selling a *73*!!! Gig HD??).  I am using Warp 4 FP11.
> 

[...]

> Seth
> 
> (could you cc any replies to this weekend to snberk@ibm.net please?
> I won't be able to check NGs until monday.  Thanks again)


Hello Seth,

I would install the new HD to the new box.

At first the new box would have all three drives in it. This enables you
to create and format the desired partitions on the 8GB drive. You can 
then xcopy ( use switches "/H /O /T /S /E /R /V" )the contents of the old
drives to the corresponding partitions on the new one. 

Note: The drive letters will change after creating a new primary partition 
( the one you want to boot from in the future ) to the third drive.

There's one thing left to be done after copying: run the command 'sysinstx'
against your new boot partition. This command is to be found on the first of
the installation/boot disks as well as on the warp cd under \os2image\disk_0.

After dooing that you remove the old HDs and make the new one the master on
channel one.

Thats it

Bye/2
Meinolf


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               19-Oct-99 01:57:23
  To: All                                               19-Oct-99 03:31:01
Subj: Re: Network security questions

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Khairil Yusof schrieb:
> Let's see, if you don't run any daemons, then I don't think anybody can get
> access to your computer. eg. telnet, ftp etc.
> 
> OS/2's tcpip stack is resistant to stupid DOS attacks.
> 
> If you do have telnet then you can configure a firewall if you have TCP/IP
4.1
> and only allow access for certain ports. To be safe:
> 
> no anonymous ftp uploads, a few users, with good passwords set to expire
every
> month or so.
> 
> ditto for your webserver, disable put command
> 
> if you don't need it, don't run a telnet daemon.
> 
> People can only get into your computer, if you open the door. No daemons or
open
> ports, no doors :)

Nice to hear! As you probably have already guessed I don't know much
about his topic.

> Unless you run a major site with multiple users, simple precautions like the
> above will do. It's VERY unlikely somebody is even going to bother hacking
into
> your personal computer.

Maybe, but they DID try to get access to my neighbour's. And some even
had a dynamic IP from our provider, i.e. they also use a dial-up
connection. Do you happen to know how I could monitor such attacks so we
could try to identify the IP the attack came from? Then we could send a
message to our ISP if it's one of their IPs.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: gordon.nospam@gadsnet.com                         19-Oct-99 00:10:20
  To: All                                               19-Oct-99 03:31:01
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: "Gordon A. Stripling" <gordon.nospam@gadsnet.com>

On 18 Oct 1999 20:55:13 GMT, Annie K. wrote:

>Plus, 
>the damn thing's taken the place of 'Explore URL.' I think someone 
>who's never used OS/2 stuck that 'copy' in there.

Not completely.  I just swiped a (or is it an) URL and it still had "Explore
URL", but it was ABOVE the "copy".  Also, it seems somewhat "smart" in that
if it isn't a URL, you don't get the "Explore URL" option, only copy.  The
URL I tried was complete with "http://", so I don't know if it works with
just the address portion.  

Thinking back, it would put "none" in the "Explore URL" list if the URL
wasn't complete, didn't it?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: ivan@protein.bio.msu.su                           19-Oct-99 13:02:09
  To: All                                               19-Oct-99 10:32:22
Subj: Re: no audio from cdplayer

From: "Ivan Adzhubei" <ivan@protein.bio.msu.su>

In <380a6302$1$qnivfs$mr2ice@news.logical.net>, on 10/17/99 
   at 07:59 PM, nemo@union.edu said:

Are you are sure it was working before and you did not change anything
in the software?

I have a problem with my Crystal-based soundcard under WSeb due to WSeb
drivers for this card (v. 2.01) are conflicting with OS/2 built-in
MMPM/2 mixer. As a result, my CD input is turned off by default. This
means I can't hear audio played from CD unless I use external mixer
(LBCSMix) to turn CD input on. And then any system sound produced in WPS
(i.e., by opening a folder) will switch CD sound off again, so I need
either lock CD input in LBCSMix (there's an option) or just switch focus
to mixer window to get CD sound back. Try finding any third-party sound
mixer program for your card and use it to play with various mixer input
sources.

>I just discovered that my music cd-player isn't working in Warp, FP10.
>It works when booted to Win95 when I can't get a sound out of it when
>booted to OS/2. I do have system sounds and can play wav's, midi's,
>etc.

Chances are FP10 broke something in MMPM interface.

>Just need a fast tip where to look for trouble-shooting. Couldn't find
>anything on deja.com.

>I sent this message to comp.os.os2.misc and have gotten a couple of
>helpful replies. One was to reinstall Multimedia which I may end up
>doing, but I'm hoping for another solution before that. (I should
>install FP12 anyway, I guess.) It occurred to me today that the
>cdplayer _used_ to work a couple of weeks ago. I can't think of what I
>may have done to change the system since I've been very conservative
>(that is, no time for 'playing').

Before trying a complete reinstall of MMOS2, why not to try reinstalling
(upgrading?) just the drivers for your soundcard. BTW, which one you
have? Drivers for Crystal-based cards can be easily reinstalled on top
of the current version. This is not true for most other cards, in which
case a complete deinstall/reinstall of OS/2 Multimedia may be necessary.

Cheers,
Ivan

-- 
-----------------------------------------------------------
"Ivan Adzhubei" <ivan@protein.bio.msu.su>
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Moscow State University (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   19-Oct-99 03:41:04
  To: All                                               19-Oct-99 10:32:22
Subj: Re: Network security questions

From: Kris Kadela <kris@dgraph.com>


Christian Hennecke wrote:
> 
> Khairil Yusof schrieb:
> > Let's see, if you don't run any daemons, then I don't think anybody can
get
> > access to your computer. eg. telnet, ftp etc.
> >
> > OS/2's tcpip stack is resistant to stupid DOS attacks.
> >
> > If you do have telnet then you can configure a firewall if you have TCP/IP 
4.1
> > and only allow access for certain ports. To be safe:
> >
> > no anonymous ftp uploads, a few users, with good passwords set to expire
every
> > month or so.
> >
> > ditto for your webserver, disable put command
> >
> > if you don't need it, don't run a telnet daemon.
> >
> > People can only get into your computer, if you open the door. No daemons
or open
> > ports, no doors :)
> 
> Nice to hear! As you probably have already guessed I don't know much
> about his topic.
> 
> > Unless you run a major site with multiple users, simple precautions like
the
> > above will do. It's VERY unlikely somebody is even going to bother hacking 
into
> > your personal computer.
> 
> Maybe, but they DID try to get access to my neighbour's. And some even
> had a dynamic IP from our provider, i.e. they also use a dial-up
> connection. Do you happen to know how I could monitor such attacks so we
> could try to identify the IP the attack came from? Then we could send a
> message to our ISP if it's one of their IPs.
> 

Under OS/2 you would run iptrace and then ipformat to view the output.
This would allow you to see xactly who is trying to connect and on what
ports. Don't know about windows though.

> Christian Hennecke
> --
> Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: nospam                                            19-Oct-99 10:36:02
  To: All                                               19-Oct-99 10:32:22
Subj: Re: EscapeGL 3.0 and OpenGL problems...

From: glennth@<nospam>senet.com.au (Glenn Thompson)

On Thu, 14 Oct 1999 17:32:41, "RichS" <worlock@frontiernet.net> wrote:

-> But to the point... EscapeGL is a wonderful screensaver and has all kinds
of
-> new modules. Unfortunately, it loves to crash. I have installed oglgold
from
-> IBM. EscapeGL does run and all the modules do work. But if I leave it alone
-> in the screensaver mode it traps as follows:

Have you tried emailing Snow Storm, they helped me out with this new
version. Dive and Matrox still don't get along in my case.

Glenn.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none here ! (1:109/42)

+----------------------------------------------------------------------------+

From: rsteiner@visi.com                                 19-Oct-99 05:22:11
  To: All                                               19-Oct-99 10:32:23
Subj: Re: Network security questions

From: rsteiner@visi.com (Richard Steiner)

Here in comp.os.os2.apps, Christian Hennecke
<christian.hennecke@ruhr-uni-bochum.de> spake unto us, saying:

>Is there any OS/2 app that can do the same? Firewalls? Gateways? Any
>recommendations?

Since I have multiple boxes here on my home LAN (one running OS/2 all
the time, others running various other OSes), I decided some time ago
that I should set up a dedicated firewall box in order to isolate my
LAN from the net.

If you're not actually running any servers (ftp, web, whatever), tho,
which could grant access to your machine, I suspect your overall level
of vulnerability will be much lower.

-- 
   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
        Explain counter-clockwise to someone with a digital watch.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  19-Oct-99 10:51:09
  To: All                                               19-Oct-99 10:32:23
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:

> In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> >> I just did this yesterday - it took about a half hour total. Selective
> >> uninstalled multimedia, about five minutes. Reboot. Find the CD, about an 

> >> hour. Selective reinstall, about another five minutes. Reboot. Find where
> >> I put the fixpack files, start Service, choose Multimedia, another maybe
> >> ten minutes. Reboot. Sort of a pain, but not that big a deal. Service
will
> >> let you Fix the old MMPM install easily. I use something from Hobbes - 
> >> fastkick141 I think ? that makes the fpak situation relatively painless.
> >> You might try it. DIUNPAK the .dsk files first, then the Fix.cmd runs you
> >> right through no muss, no fuss, *and* you have the disk images if you 
> >> need them again later. good luck
> >> 
> >> >
> >
> >Many programs add files such as dll's to the mmos2 directory.  2 
> >examples are quickflick, anpocodec and the netscape plugin pack.  If 
> >you do an uninstall and reinstall, what happens to those files.
> 
> 
> reinstall those as well, yeah, it's kinda tedious . . . but if you
> want the new soundcard to work . . . ?? the point was that
> the fixpack will upgrade just mmos2 without messing with
> the rest of the system.

OK, I have done the whole exercise, deleting MMOS2, installing
Crystal drivers, and reinstalling MM support, rebooting after each step, 
The
system is still silent. It also thinks it has a CS4232/36 card, whereas the
drivers I installed are for 4236B, which is what is on the card. 

After the final reboot, the system told me it couldn't find 
mmos2\cwaudio.sys.
The installation had put the line in config.sys, but had not made it good 
by
copying the file; I would like to know why that happened. I did find a copy
in
the OS2/BOOT directory, so I copied it and rebooted yet again, but the 
system is
still quiet.

I do not think interrupts are the problem: RMVIEW /irq shows that it has 
taken
5 and 9, which is correct.

I don't think I failed to touch any of the bases. What might be happening 
now?

-----------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: dwparsons@t-online.de                             19-Oct-99 13:02:04
  To: All                                               19-Oct-99 10:32:23
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: dwparsons@t-online.de (Dave Parsons)

On Tue, 19 Oct 1999 01:07:40, "frank schmittroth" <franks@owt.com> wrote:

> On 18 Oct 1999 20:55:13 GMT, Annie K. wrote:
> 
> > It's redundant. How many ways do you need to copy to the clipboard? 
> >There's a copy function under the edit menu, I usually hit Ctrl-Ins, 
> >but if I'm mousing I swipe, hold the LMB down, and tap the RMB. Plus, 
> >the damn thing's taken the place of 'Explore URL.' 
> 
> I use 'Explore URL' all the time.  Is that really gone?
> Frank. 

No, which menu you get depends upon what you highlight.
Much better.

-- 
Dave

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDL (1:109/42)

+----------------------------------------------------------------------------+

From: dwparsons@t-online.de                             19-Oct-99 13:01:23
  To: All                                               19-Oct-99 10:32:23
Subj: Re: PMMail, Attachments, and application calling

From: dwparsons@t-online.de (Dave Parsons)

On Fri, 15 Oct 1999 14:35:22, zayne@omen.com.au (Mooo) wrote:

> I have the same problem.  Have yet to be able to work it out :(  My
> associations are correct, because if I drag the attachment to the
> desktop, then double click on it, it opens with the application I
> want.
> 
> sigh..
> Craig
> 

I had a similar problem here a few days ago.
It seems that PMMail/2 V2.0 has a very short buffer that it uses to pass
the commands to the helper program, probably 64 bytes.
If the combined length of the 'Program to Execute' + 'Arguments' is too
long the WinOS/2 program just sees rubbish after the 64th? character.

The file that I was trying to read was:-
  'g:\mailnews\pmmail\pmmail\temp\filename.doc'
and the helper was:-
  'c:\winapps\wordview\wordview.exe'

To get round the problem I had to move both the pmmail directory to the
root of its partition and also the helper program to the root of its
partition.
This reduced the complete string to 59 characters and then it worked.

I haven't checked to see if it is the same in v2.1, but if it is, then that is
something to be fixed in v2.2.

Another thing to watch out for is that if the helper is a Windows program
then the path and filename must conform to the 8.3 convention.

HTH
-- 
Dave

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDL (1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           19-Oct-99 09:11:26
  To: All                                               19-Oct-99 12:51:28
Subj: Re: EscapeGL 3.0 and OpenGL problems...

From: "RichS" <worlock@frontiernet.net>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

No, I didn't want to go that route until necessary and I had a chance to get
things working myself. They gave the impression that opengl problems were not
their thing, but maybe not?

The previous post about disabling Dive has stopped the old crash, but still
not working. It does start up and run when the system locks. Things then seem
to work when I enter my password to get back to work, but then escapegl sits
there as an icon using 100%cpu and not responsive. The only way I can then
get rid of it is to go into process commander and kill it (after it says
escapegl is not responding). So it doesn't seem to be a dive problem,
although disabling it does make it work 'better'...

Unfortunately, I had to spend two days recovering from a miserably failed
Scitech display doctor installation and haven't had the time to explore the
problem with escapegl any further. Now that I'm almost back up and running,
maybe I'll ask for help from Snow Storm?

Thanks...

Rich...

 19 Oct 1999 10:36:04 +0950, glennth@senet.com.au (Glenn Thompson) wrote:

>On Thu, 14 Oct 1999 17:32:41, "RichS" <worlock@frontiernet.net> wrote:
>
>-> But to the point... EscapeGL is a wonderful screensaver and has all kinds
of
>-> new modules. Unfortunately, it loves to crash. I have installed oglgold
from
>-> IBM. EscapeGL does run and all the modules do work. But if I leave it
alone
>-> in the screensaver mode it traps as follows:
>
>Have you tried emailing Snow Storm, they helped me out with this new
>version. Dive and Matrox still don't get along in my case.
>
>Glenn.
>

******************************************************************************
Practice Random Acts of Kindness and Senseless...Umm...Uhh....
Oh - Heck...I never could remember all that "nice" stuff.
-
-----------------------------{worlock@frontiernet/net}-------------------------
-------
******************************************************************************



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: noconv

wj8DBQE4DGFCJUo5KMjfuWMRAioXAKCm+KVOzfcFSa5bjuvuVg8xa7CYEQCcDjYM
d89lJJuMKwJNohuAilQXJTI=
=7OAa
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           19-Oct-99 13:43:23
  To: All                                               19-Oct-99 12:51:28
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman) wrote:

> On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> 
> > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > >> I just did this yesterday - it took about a half hour total. Selective
> > >> uninstalled multimedia, about five minutes. Reboot. Find the CD, about
an 
> > >> hour. Selective reinstall, about another five minutes. Reboot. Find
where
> > >> I put the fixpack files, start Service, choose Multimedia, another
maybe
> > >> ten minutes. Reboot. Sort of a pain, but not that big a deal. Service
will
> > >> let you Fix the old MMPM install easily. I use something from Hobbes - 
> > >> fastkick141 I think ? that makes the fpak situation relatively
painless.
> > >> You might try it. DIUNPAK the .dsk files first, then the Fix.cmd runs
you
> > >> right through no muss, no fuss, *and* you have the disk images if you 
> > >> need them again later. good luck
> > >> 
> > >> >
> > >
> > >Many programs add files such as dll's to the mmos2 directory.  2 
> > >examples are quickflick, anpocodec and the netscape plugin pack.  If 
> > >you do an uninstall and reinstall, what happens to those files.
> > 
> > 
> > reinstall those as well, yeah, it's kinda tedious . . . but if you
> > want the new soundcard to work . . . ?? the point was that
> > the fixpack will upgrade just mmos2 without messing with
> > the rest of the system.
> 
> OK, I have done the whole exercise, deleting MMOS2, installing
> Crystal drivers, and reinstalling MM support, rebooting after each step, 
> The
> system is still silent. It also thinks it has a CS4232/36 card, whereas the
> drivers I installed are for 4236B, which is what is on the card. 
> 
> After the final reboot, the system told me it couldn't find 
> mmos2\cwaudio.sys.
> The installation had put the line in config.sys, but had not made it good 
> by
> copying the file; I would like to know why that happened. I did find a copy
> in
> the OS2/BOOT directory, so I copied it and rebooted yet again, but the 
> system is
> still quiet.
> 
> I do not think interrupts are the problem: RMVIEW /irq shows that it has 
> taken
> 5 and 9, which is correct.
> 
> I don't think I failed to touch any of the bases. What might be happening 
> now?
> 

When you do the re-install it should be in the following order.

1) Re-install MMOS/2 - DO NOT choose a sound card and
if one is selected remove it. (It will not detect the Tidalwave 128
correctly). You can do this by pressing the button on selective
install beside the Multimedia Device field.

2) After MMOS/2 is re-installed, install the drivers for the card.

3) apply the appropriate fixpack (FP 12)

From your message (quoted above) it looks like you installed
the sound card drivers, then re-installed MMOS/2.

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: david@mensys.nl                                   19-Oct-99 15:39:27
  To: All                                               19-Oct-99 12:51:28
Subj: Re: Describe 4.0 : How to print ?

From: "D.J. van Enckevort" <david@mensys.nl>

On 14 Oct 1999 23:34:44 GMT, Frank wrote:

>
>>You're not running a shareware copy of Describe 4.0, what you are 
>> running is a workable demo.  
>
>But..is it possible to have this demo version print anything ?
>
I believe the print function was disabled in the demo.

Yours sincerely,
   David van Enckevort



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: news-service.com (1:109/42)

+----------------------------------------------------------------------------+

From: swordedg@ntrnet.net                               19-Oct-99 13:59:06
  To: All                                               19-Oct-99 12:51:28
Subj: Re: Netscape cache messing up

From: swordedg@ntrnet.net (David Eckard)

On Tue, 19 Oct 1999 06:27:00, "Jeffrey S. Kobal" 
<murdoctor@ausNOSPAMtin.rr.com> wrote:

> 
> Well, I can't deny there being some level of pretense in my
> response, but the facts have a clear implication...
>  
> Recent actions taken by Jim L:
> Cleared memory and disk cache; set both to 0 (disabled)
>  
> Expected results of latter action:
> (1) Web pages will not be cached, thereby requiring the
> browser to download them from the server every time.
> (2) Any "temporary" files stored in the cache will be
> removed the next time new files are retrieved (e.g.
> loading a web page).
>  
> Symptoms reported by Jim L:
> (1) "web pages re-downloading over and over"
> (2) Won't continue download after abort; restarts again
>  
> There appears to be a direct correlation, which led me
> to my suggestion that he re-enable the caching.  :)
>  
> Jeffrey S. Kobal
> IBM Corporation
>  
> 

Jeff, there is definately something about the GA 4.61 that pegs my CPU
meter and slows the system to a crawl.

If I let the settings stay at the default, the browser pegs my CPU 
meter ever single time I load this site

http://www.tvguide.com/Listings/FrameBase.asp?F=2&I=61071

or my local are TV schedule.

With the memory cache set to zero, it loads just dandy.  HOWEVER....  
now the PDF files on the job section of the news and observer peg the 
cpu meter.  They, I now download to my hd and load manually.  Works 
better for me that way anyway....

I tried to find out where IBM hid the defect reports but have been 
unsuccessful.  Is that on purpose?



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ntrnet Systems (1:109/42)

+----------------------------------------------------------------------------+

From: wrightc@dtcweb.com                                19-Oct-99 10:06:24
  To: All                                               19-Oct-99 12:51:29
Subj: Wacom Intuos support for OS/2???

From: "Christopher B. Wright" <wrightc@dtcweb.com>

Does anyone know if the Pen for OS/2 Artpad drivers support the Wacom Intuos?
Do any OS/2 mouse drivers support the Intuos? Just wondering...


Christopher B. Wright (wrightc@dtcweb.com)
"We are all born originals -- why is it so many of us die copies?"
       - Edward Young


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@auerbachatunity.ncsu.edu                   19-Oct-99 09:51:10
  To: All                                               19-Oct-99 12:51:29
Subj: Re: Xywrite and OS/2 

From: nospam@auerbachatunity.ncsu.edu

In <EC3EJ5uiPEfW-pn2-FbDeRCbfNvrQ@egermain.ne.mediaone.net>, on 10/18/99 
   at 11:00 PM, egermain@mediaone.net (Edward Germain) said:

>Amazing.  It was the best of the best, but the sad, sad tale when it  was
>sold to IBM and then wrecked in development (the product was to be called
>"Signature"--I still have an alpha version around somewhere)  and then
>abandoned by IBM--well it's too sad to be retold.

>Thank you for the news that to some degree it is still alive!
 It is very alive and if you get XyWrite 4 (ver. 4.017 I think) and then
visit http://www.serve.com/xywwweb/  you'll find an amazing collection of
add-ons for XyWrite (remember XyWrite has a very powerful macro language
combined with the ability to add commands and program the keyboard)
including a howisthatpossible integration with OS/2.  For sheer manipulation
of text XyWrite is still the one.   Some quotes from theXyWeb  page:


>XyWrite-OS/2 File Manager for HPFS
> Transparent manipulation of
> OS/2's High Performance
> File System files and
>directories under XyWrite. Long
>   filenames! Display DIRectories
>of them, create edit save
> and delete them, etc. New
>commands: DIR2 NE2 CA2
>  ME2 SA2 AB2 DEL2 and INfo2


>Xy-OS/2 Shell (v1.0d). Xy-OS/2 Shell is a powerful interface that allows
>you to shell to OS/2 from
>        XyWrite, to run or switch to (and return to XyWrite from) OS/2
>programs and objects. All required
>        Xy-OS/2 Shell frames are integrated within XYWWWEB.U2; the what's
>it all about? DOCumentation
>        and several DOS and OS/2 programs are contained in this ZIP 
>        XYOS2FM: Xy-OS/2 File Manager (Xy-OS/2 FM). Import and edit long
>filenames and directories
>        within XyWrite. Transparent access to all HPFS|FAT files on your
>machine 
>        REXXPL: RexXPL v2.011. Integrated XPL + REXX for XyWrite running
>under OS/2. Requires
>        Xy-OS/2 Shell (CLD 1/20/98) 
>        LFN: Import LongFileNamed (non-8.3) OS/2 Files into XyWrite 


-- 
                                         Regards, 
                                         David
Only dull people are brilliant at breakfast.
                             --Oscar Wilde
"What would life be without arithmetic, but a scene of horrors?"
                       -Rev. Sydney Smith, letter to young lady, 22 July 1835


-----------------------------------------------------------
David Auerbach                   nospam@auerbachatunity.ncsu.edu            
Department of Philosophy & Religion
NCSU
Box 8103
Raleigh, 27695-8103
-----------------------------------------------------------




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: North Carolina State University (1:109/42)

+----------------------------------------------------------------------------+

From: jdye@niu.edu                                      19-Oct-99 09:48:23
  To: All                                               19-Oct-99 12:51:29
Subj: Re: Netscape cache messing up

From: "James Dye" <jdye@niu.edu>

On 19 Oct 1999 13:59:13 GMT, David Eckard wrote:

|If I let the settings stay at the default, the browser pegs my 
CPU 
|meter ever single time I load this site
|
|http://www.tvguide.com/Listings/FrameBase.asp?F=2&I=6
1071
|
|or my local are TV schedule.
|
|With the memory cache set to zero, it loads just dandy.  
HOWEVER....  
|now the PDF files on the job section of the news and 
observer peg the 
|cpu meter.  They, I now download to my hd and load 
manually.  Works 
|better for me that way anyway....
With 4000K memory cache the TVGuide page mentioned 
loads perfectly fine here, although there are a couple of 
momentary peaks of maybe 85% CPU usage and several 
lesser peaks  around 50%. 


James Dye
Northern Illinois University


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Northern Illinois University (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  19-Oct-99 15:06:27
  To: All                                               19-Oct-99 12:51:29
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne Sunley) wrote:

> On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman) wrote:
> 
> > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > 
> > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > >> I just did this yesterday - it took about a half hour total.
Selective
> > > >> uninstalled multimedia, about five minutes. Reboot. Find the CD,
about an 
> > > >> hour. Selective reinstall, about another five minutes. Reboot. Find
where
> > > >> I put the fixpack files, start Service, choose Multimedia, another
maybe
> > > >> ten minutes. Reboot. Sort of a pain, but not that big a deal. Service 
will
> > > >> let you Fix the old MMPM install easily. I use something from Hobbes
- 
> > > >> fastkick141 I think ? that makes the fpak situation relatively
painless.
> > > >> You might try it. DIUNPAK the .dsk files first, then the Fix.cmd runs 
you
> > > >> right through no muss, no fuss, *and* you have the disk images if you 

> > > >> need them again later. good luck
> > > >> 
> > > >> >
> > > >
> > > >Many programs add files such as dll's to the mmos2 directory.  2 
> > > >examples are quickflick, anpocodec and the netscape plugin pack.  If 
> > > >you do an uninstall and reinstall, what happens to those files.
> > > 
> > > 
> > > reinstall those as well, yeah, it's kinda tedious . . . but if you
> > > want the new soundcard to work . . . ?? the point was that
> > > the fixpack will upgrade just mmos2 without messing with
> > > the rest of the system.
> > 
> > OK, I have done the whole exercise, deleting MMOS2, installing
> > Crystal drivers, and reinstalling MM support, rebooting after each step, 
> > The
> > system is still silent. It also thinks it has a CS4232/36 card, whereas
the
> > drivers I installed are for 4236B, which is what is on the card. 
> > 
> > After the final reboot, the system told me it couldn't find 
> > mmos2\cwaudio.sys.
> > The installation had put the line in config.sys, but had not made it good 
> > by
> > copying the file; I would like to know why that happened. I did find a
copy
> > in
> > the OS2/BOOT directory, so I copied it and rebooted yet again, but the 
> > system is
> > still quiet.
> > 
> > I do not think interrupts are the problem: RMVIEW /irq shows that it has 
> > taken
> > 5 and 9, which is correct.
> > 
> > I don't think I failed to touch any of the bases. What might be happening 
> > now?
> > 
> 
> When you do the re-install it should be in the following order.
> 
> 1) Re-install MMOS/2 - DO NOT choose a sound card and
> if one is selected remove it. (It will not detect the Tidalwave 128
> correctly). You can do this by pressing the button on selective
> install beside the Multimedia Device field.
> 
> 2) After MMOS/2 is re-installed, install the drivers for the card.
> 
> 3) apply the appropriate fixpack (FP 12)
> 
> From your message (quoted above) it looks like you installed
> the sound card drivers, then re-installed MMOS/2.

No, I didn't do that. In order to have everything fresh in my memory, I 
repeated the first part of the process just now. I deleted the \MMOS2 
directory; as predicted by the Crystal docs, quite a number of files would 
not allow themselves to be deleted; that is OK, according to the docs. 
Then, in Selective Install (where the sound card still appeared as "Crystal
Audio CS-4232/36") I removed the driver from the _selected_ list, and did 
"Next", so that the MM installation completed from the OS/2 distribution 
CDROM. I rebooted, and got two announcements that programs belonging to the
"Video Part" could not be deleted. Finally, I started Selective Install 
again, in order to inspect the result; I was not surprised (having been 
through this before) to see that the system still thinks a "Crystal Audio 
CS-4232/36" card is installed.

I have left nothing out in the story; what did I do wrong? 

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@null                                       19-Oct-99 15:29:13
  To: All                                               19-Oct-99 12:51:29
Subj: Re: Pronews/2

From: nospam@null (Richard Crane)

On Mon, 18 Oct 1999 17:42:44, "Maximilian Stempfhuber" <st@bonn.iz-soz.de> 
wrote:
> 
> I dropped Pronews/2 and went to SLRN because Pronews/2 crashed when
> downloading groublists with more than 32.000 entries (or at least I thought
> it was the reason). Has anyone other experiences?
I have noticed my pronews gets "touchy" when downloading big (32000+)
newsgroups
lists and opening/closing newsgroups with 2048+ items in them but have found 
that it is just a case of going "non-multitasking" until its done ie don't go 
off and start your wordprocessor or anything else whist waiting let it
(pronews)
have the focus and it handles it.
OK so not perfect for a multtasking system but pronews is in all other ways
vg.
Richard A Crane


Abort, Retry, Fail or I wish I hadn't done that?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           19-Oct-99 15:49:10
  To: All                                               19-Oct-99 12:51:29
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Tue, 19 Oct 1999 15:06:55, l_luciano@da.mob (Stan Goodman) wrote:

> On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne Sunley) wrote:
> 
> > On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman) wrote:
> > 
> > > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > > 
> > > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > > >> I just did this yesterday - it took about a half hour total.
Selective
> > > > >> uninstalled multimedia, about five minutes. Reboot. Find the CD,
about an 
> > > > >> hour. Selective reinstall, about another five minutes. Reboot. Find 
where
> > > > >> I put the fixpack files, start Service, choose Multimedia, another
maybe
> > > > >> ten minutes. Reboot. Sort of a pain, but not that big a deal.
Service will
> > > > >> let you Fix the old MMPM install easily. I use something from
Hobbes - 
> > > > >> fastkick141 I think ? that makes the fpak situation relatively
painless.
> > > > >> You might try it. DIUNPAK the .dsk files first, then the Fix.cmd
runs you
> > > > >> right through no muss, no fuss, *and* you have the disk images if
you 
> > > > >> need them again later. good luck
> > > > >> 
> > > > >> >
> > > > >
> > > > >Many programs add files such as dll's to the mmos2 directory.  2 
> > > > >examples are quickflick, anpocodec and the netscape plugin pack.  If 
> > > > >you do an uninstall and reinstall, what happens to those files.
> > > > 
> > > > 
> > > > reinstall those as well, yeah, it's kinda tedious . . . but if you
> > > > want the new soundcard to work . . . ?? the point was that
> > > > the fixpack will upgrade just mmos2 without messing with
> > > > the rest of the system.
> > > 
> > > OK, I have done the whole exercise, deleting MMOS2, installing
> > > Crystal drivers, and reinstalling MM support, rebooting after each step, 

> > > The
> > > system is still silent. It also thinks it has a CS4232/36 card, whereas
the
> > > drivers I installed are for 4236B, which is what is on the card. 
> > > 
> > > After the final reboot, the system told me it couldn't find 
> > > mmos2\cwaudio.sys.
> > > The installation had put the line in config.sys, but had not made it
good 
> > > by
> > > copying the file; I would like to know why that happened. I did find a
copy
> > > in
> > > the OS2/BOOT directory, so I copied it and rebooted yet again, but the 
> > > system is
> > > still quiet.
> > > 
> > > I do not think interrupts are the problem: RMVIEW /irq shows that it has 

> > > taken
> > > 5 and 9, which is correct.
> > > 
> > > I don't think I failed to touch any of the bases. What might be
happening 
> > > now?
> > > 
> > 
> > When you do the re-install it should be in the following order.
> > 
> > 1) Re-install MMOS/2 - DO NOT choose a sound card and
> > if one is selected remove it. (It will not detect the Tidalwave 128
> > correctly). You can do this by pressing the button on selective
> > install beside the Multimedia Device field.
> > 
> > 2) After MMOS/2 is re-installed, install the drivers for the card.
> > 
> > 3) apply the appropriate fixpack (FP 12)
> > 
> > From your message (quoted above) it looks like you installed
> > the sound card drivers, then re-installed MMOS/2.
> 
> No, I didn't do that. In order to have everything fresh in my memory, I 
> repeated the first part of the process just now. I deleted the \MMOS2 
> directory; as predicted by the Crystal docs, quite a number of files would 
> not allow themselves to be deleted; that is OK, according to the docs. 
> Then, in Selective Install (where the sound card still appeared as "Crystal
> Audio CS-4232/36") I removed the driver from the _selected_ list, and did 
> "Next", so that the MM installation completed from the OS/2 distribution 
> CDROM. I rebooted, and got two announcements that programs belonging to the
> "Video Part" could not be deleted. Finally, I started Selective Install 
> again, in order to inspect the result; I was not surprised (having been 
> through this before) to see that the system still thinks a "Crystal Audio 
> CS-4232/36" card is installed.
> 
> I have left nothing out in the story; what did I do wrong? 
> 

The "Selective Install" always probes for physically installed
sound cards. It will always think the "Tidalwave 128" is a
CS-4232/36 card.

The install of the drivers (after the delete and re-install of MMOS/2)
should be done using MINSTALL in the directory where you
have unzipped the drivers from the Crystal web site.

This will install the correct drivers.

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  19-Oct-99 16:42:02
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

On Tue, 19 Oct 1999 15:49:20, lsunley@mb.sympatico.ca (Lorne Sunley) wrote:

> On Tue, 19 Oct 1999 15:06:55, l_luciano@da.mob (Stan Goodman) wrote:
> 
> > On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > 
> > > On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman) wrote:
> > > 
> > > > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > > > 
> > > > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > > > >> I just did this yesterday - it took about a half hour total.
Selective
> > > > > >> uninstalled multimedia, about five minutes. Reboot. Find the CD,
about an 
> > > > > >> hour. Selective reinstall, about another five minutes. Reboot.
Find where
> > > > > >> I put the fixpack files, start Service, choose Multimedia,
another maybe
> > > > > >> ten minutes. Reboot. Sort of a pain, but not that big a deal.
Service will
> > > > > >> let you Fix the old MMPM install easily. I use something from
Hobbes - 
> > > > > >> fastkick141 I think ? that makes the fpak situation relatively
painless.
> > > > > >> You might try it. DIUNPAK the .dsk files first, then the Fix.cmd
runs you
> > > > > >> right through no muss, no fuss, *and* you have the disk images if 
you 
> > > > > >> need them again later. good luck
> > > > > >> 
> > > > > >> >
> > > > > >
> > > > > >Many programs add files such as dll's to the mmos2 directory.  2 
> > > > > >examples are quickflick, anpocodec and the netscape plugin pack. 
If 
> > > > > >you do an uninstall and reinstall, what happens to those files.
> > > > > 
> > > > > 
> > > > > reinstall those as well, yeah, it's kinda tedious . . . but if you
> > > > > want the new soundcard to work . . . ?? the point was that
> > > > > the fixpack will upgrade just mmos2 without messing with
> > > > > the rest of the system.
> > > > 
> > > > OK, I have done the whole exercise, deleting MMOS2, installing
> > > > Crystal drivers, and reinstalling MM support, rebooting after each
step, 
> > > > The
> > > > system is still silent. It also thinks it has a CS4232/36 card,
whereas the
> > > > drivers I installed are for 4236B, which is what is on the card. 
> > > > 
> > > > After the final reboot, the system told me it couldn't find 
> > > > mmos2\cwaudio.sys.
> > > > The installation had put the line in config.sys, but had not made it
good 
> > > > by
> > > > copying the file; I would like to know why that happened. I did find a 
copy
> > > > in
> > > > the OS2/BOOT directory, so I copied it and rebooted yet again, but the 

> > > > system is
> > > > still quiet.
> > > > 
> > > > I do not think interrupts are the problem: RMVIEW /irq shows that it
has 
> > > > taken
> > > > 5 and 9, which is correct.
> > > > 
> > > > I don't think I failed to touch any of the bases. What might be
happening 
> > > > now?
> > > > 
> > > 
> > > When you do the re-install it should be in the following order.
> > > 
> > > 1) Re-install MMOS/2 - DO NOT choose a sound card and
> > > if one is selected remove it. (It will not detect the Tidalwave 128
> > > correctly). You can do this by pressing the button on selective
> > > install beside the Multimedia Device field.
> > > 
> > > 2) After MMOS/2 is re-installed, install the drivers for the card.
> > > 
> > > 3) apply the appropriate fixpack (FP 12)
> > > 
> > > From your message (quoted above) it looks like you installed
> > > the sound card drivers, then re-installed MMOS/2.
> > 
> > No, I didn't do that. In order to have everything fresh in my memory, I 
> > repeated the first part of the process just now. I deleted the \MMOS2 
> > directory; as predicted by the Crystal docs, quite a number of files would 

> > not allow themselves to be deleted; that is OK, according to the docs. 
> > Then, in Selective Install (where the sound card still appeared as
"Crystal
> > Audio CS-4232/36") I removed the driver from the _selected_ list, and did 
> > "Next", so that the MM installation completed from the OS/2 distribution 
> > CDROM. I rebooted, and got two announcements that programs belonging to
the
> > "Video Part" could not be deleted. Finally, I started Selective Install 
> > again, in order to inspect the result; I was not surprised (having been 
> > through this before) to see that the system still thinks a "Crystal Audio 
> > CS-4232/36" card is installed.
> > 
> > I have left nothing out in the story; what did I do wrong? 
> > 
> 
> The "Selective Install" always probes for physically installed
> sound cards. It will always think the "Tidalwave 128" is a
> CS-4232/36 card.
> 
> The install of the drivers (after the delete and re-install of MMOS/2)
> should be done using MINSTALL in the directory where you
> have unzipped the drivers from the Crystal web site.
> 
> This will install the correct drivers.

To test that, I continued the installation procedure (having already 
deleted MMOS2 and reinstalled the distribution Multimedia support). 

The manual says to install from the Multimedia Application Install object, 
and that one can "also" install from the command line. These are in fact 
the same thing, but in order to follow your suggestion precisely, I did it 
this time from the command line, and installed from the file os2208wt, 
which I downloaded yesterday.

When the smoke had cleared away, I rebooted yet again, and opened Selective
Install, in order to get the system's opinion about the sound card. The 
system still thinks it has a "Crystal Audio CS-4232/36 PnP", as before

When the system was coming up during the reboot, there was an announcement 
(which I had seen last time) that the file \MMOS2\CWAUDIO.SYS could not be 
found. I already know from last time that there is indeed a copy of the 
file in the \OS2\BOOT directory, and that copying it into the MMOS2 
directory doesn't help.

So no; apparently it doesn't install the correct drivers.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     19-Oct-99 16:51:27
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Tue, 19 Oct 1999 00:10:41, "Gordon A. Stripling" 
<gordon.nospam@gadsnet.com> wrote:

>  The
> URL I tried was complete with "http://", so I don't know if it works with
> just the address portion. 

Yes, it works with just www.xxx.com (this is not a real address, of 
course). I suspect that it may have a problem with something that 
doesn't start with "www" (and there are getting to be more of these 
out there).
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     19-Oct-99 16:51:26
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Mon, 18 Oct 1999 19:54:35, doug.bissett"at"attglobal.net (Doug 
Bissett) wrote:

> I had thought 
> about turning off the memory cache, but have never got around to 
> trying it. Now, I am going to try it.
> 

Sorry to respond to my own post, BUT:

YES, it does seem to make a BIG difference. Some things don't seem to 
be as quick, but I have not, yet, seen the 100% CPU thing.

Thanks...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           19-Oct-99 17:00:04
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Tue, 19 Oct 1999 16:42:04, l_luciano@da.mob (Stan Goodman) wrote:

> On Tue, 19 Oct 1999 15:49:20, lsunley@mb.sympatico.ca (Lorne Sunley) wrote:
> 
> > On Tue, 19 Oct 1999 15:06:55, l_luciano@da.mob (Stan Goodman) wrote:
> > 
> > > On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > > 
> > > > On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman) wrote:
> > > > 
> > > > > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > > > > 
> > > > > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > > > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > > > > >> I just did this yesterday - it took about a half hour total.
Selective
> > > > > > >> uninstalled multimedia, about five minutes. Reboot. Find the
CD, about an 
> > > > > > >> hour. Selective reinstall, about another five minutes. Reboot.
Find where
> > > > > > >> I put the fixpack files, start Service, choose Multimedia,
another maybe
> > > > > > >> ten minutes. Reboot. Sort of a pain, but not that big a deal.
Service will
> > > > > > >> let you Fix the old MMPM install easily. I use something from
Hobbes - 
> > > > > > >> fastkick141 I think ? that makes the fpak situation relatively
painless.
> > > > > > >> You might try it. DIUNPAK the .dsk files first, then the
Fix.cmd runs you
> > > > > > >> right through no muss, no fuss, *and* you have the disk images
if you 
> > > > > > >> need them again later. good luck
> > > > > > >> 
> > > > > > >> >
> > > > > > >
> > > > > > >Many programs add files such as dll's to the mmos2 directory.  2 
> > > > > > >examples are quickflick, anpocodec and the netscape plugin pack.  
If 
> > > > > > >you do an uninstall and reinstall, what happens to those files.
> > > > > > 
> > > > > > 
> > > > > > reinstall those as well, yeah, it's kinda tedious . . . but if you
> > > > > > want the new soundcard to work . . . ?? the point was that
> > > > > > the fixpack will upgrade just mmos2 without messing with
> > > > > > the rest of the system.
> > > > > 
> > > > > OK, I have done the whole exercise, deleting MMOS2, installing
> > > > > Crystal drivers, and reinstalling MM support, rebooting after each
step, 
> > > > > The
> > > > > system is still silent. It also thinks it has a CS4232/36 card,
whereas the
> > > > > drivers I installed are for 4236B, which is what is on the card. 
> > > > > 
> > > > > After the final reboot, the system told me it couldn't find 
> > > > > mmos2\cwaudio.sys.
> > > > > The installation had put the line in config.sys, but had not made it 
good 
> > > > > by
> > > > > copying the file; I would like to know why that happened. I did find 
a copy
> > > > > in
> > > > > the OS2/BOOT directory, so I copied it and rebooted yet again, but
the 
> > > > > system is
> > > > > still quiet.
> > > > > 
> > > > > I do not think interrupts are the problem: RMVIEW /irq shows that it 
has 
> > > > > taken
> > > > > 5 and 9, which is correct.
> > > > > 
> > > > > I don't think I failed to touch any of the bases. What might be
happening 
> > > > > now?
> > > > > 
> > > > 
> > > > When you do the re-install it should be in the following order.
> > > > 
> > > > 1) Re-install MMOS/2 - DO NOT choose a sound card and
> > > > if one is selected remove it. (It will not detect the Tidalwave 128
> > > > correctly). You can do this by pressing the button on selective
> > > > install beside the Multimedia Device field.
> > > > 
> > > > 2) After MMOS/2 is re-installed, install the drivers for the card.
> > > > 
> > > > 3) apply the appropriate fixpack (FP 12)
> > > > 
> > > > From your message (quoted above) it looks like you installed
> > > > the sound card drivers, then re-installed MMOS/2.
> > > 
> > > No, I didn't do that. In order to have everything fresh in my memory, I 
> > > repeated the first part of the process just now. I deleted the \MMOS2 
> > > directory; as predicted by the Crystal docs, quite a number of files
would 
> > > not allow themselves to be deleted; that is OK, according to the docs. 
> > > Then, in Selective Install (where the sound card still appeared as
"Crystal
> > > Audio CS-4232/36") I removed the driver from the _selected_ list, and
did 
> > > "Next", so that the MM installation completed from the OS/2 distribution 

> > > CDROM. I rebooted, and got two announcements that programs belonging to
the
> > > "Video Part" could not be deleted. Finally, I started Selective Install 
> > > again, in order to inspect the result; I was not surprised (having been 
> > > through this before) to see that the system still thinks a "Crystal
Audio 
> > > CS-4232/36" card is installed.
> > > 
> > > I have left nothing out in the story; what did I do wrong? 
> > > 
> > 
> > The "Selective Install" always probes for physically installed
> > sound cards. It will always think the "Tidalwave 128" is a
> > CS-4232/36 card.
> > 
> > The install of the drivers (after the delete and re-install of MMOS/2)
> > should be done using MINSTALL in the directory where you
> > have unzipped the drivers from the Crystal web site.
> > 
> > This will install the correct drivers.
> 
> To test that, I continued the installation procedure (having already 
> deleted MMOS2 and reinstalled the distribution Multimedia support). 
> 
> The manual says to install from the Multimedia Application Install object, 
> and that one can "also" install from the command line. These are in fact 
> the same thing, but in order to follow your suggestion precisely, I did it 
> this time from the command line, and installed from the file os2208wt, 
> which I downloaded yesterday.
> 
> When the smoke had cleared away, I rebooted yet again, and opened Selective
> Install, in order to get the system's opinion about the sound card. The 
> system still thinks it has a "Crystal Audio CS-4232/36 PnP", as before
> 
> When the system was coming up during the reboot, there was an announcement 
> (which I had seen last time) that the file \MMOS2\CWAUDIO.SYS could not be 
> found. I already know from last time that there is indeed a copy of the 
> file in the \OS2\BOOT directory, and that copying it into the MMOS2 
> directory doesn't help.
> 
> So no; apparently it doesn't install the correct drivers.
> 

I have a Crystal Audio based card (8235 chip) and the driver
for the chip installs with the following line

BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2

As far as I know the driver package should set up something
like the above line (a BASEDEV) not a DEVICE statement.

What does your config.sys file line for installing the driver look
like. I have one REM'med out in mine that looks like this

REM DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8

This line came from allowing MMOS/2 to select the CS-4232/36 
card. (I went through all this when I change from an AWE64 to
the Crystal Audio card.

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  19-Oct-99 16:41:28
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Pronews/2

From: l_luciano@da.mob (Stan Goodman)

On Tue, 19 Oct 1999 15:29:27, nospam@null (Richard Crane) wrote:

> On Mon, 18 Oct 1999 17:42:44, "Maximilian Stempfhuber" <st@bonn.iz-soz.de> 
> wrote:
> > 
> > I dropped Pronews/2 and went to SLRN because Pronews/2 crashed when
> > downloading groublists with more than 32.000 entries (or at least I
thought
> > it was the reason). Has anyone other experiences?
> I have noticed my pronews gets "touchy" when downloading big (32000+)
newsgroups
> lists and opening/closing newsgroups with 2048+ items in them but have found 

> that it is just a case of going "non-multitasking" until its done ie don't
go 
> off and start your wordprocessor or anything else whist waiting let it
(pronews)
> have the focus and it handles it.
> OK so not perfect for a multtasking system but pronews is in all other ways
vg.
> Richard A Crane

I agree, it is touchy, but remains a very good tool. For example, If I 
press "G" to make it get new headers for all groups, then press CTRL-O to 
put it online before all the task flags are present, it WILL lock up. So I 
have trained myself to wait forthe flags. I still regard it as a brilliant 
piece of software; it is a great pity that the few remaining bugs haven't 
been wrung out, and that the few missing potentially helpful features 
haven't been added. Although I don't think anyone is listening that could 
do anything about it, I believe the program would be improved if different 
signature blocks could be assigned to postings and to mail -- but that's 
the only feature I really miss.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: tomfred@xibm.net                                  19-Oct-99 17:23:27
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Netscape cache messing up

From: Tom <tomfred@xibm.net>

On 1999/10/19, in message <380BD554.CD6FD0B5@ausNOSPAMtin.rr.com>,
JEFFREY S. KOBAL <murdoctor@ausNOSPAMtin.rr.com> wrote:
----------------------------------------------------------------------
  lifedata@xxvol.com wrote: 
 
  > Netscape 4.61: The cache has started messing up in general just recently.
 I've 
 
  > cleared out both memory cache and disk cache, turned them off etc., but I
 still 
 
  > keep seeing web pages re-download over and over. 
 
  Try turning the caching back ON. 
 
  Jeffrey S. Kobal 
 
  IBM Corporation 
 
 
======================================================================
Right or wrong it's my song:

        I see the similar action here with the cache ON. Also loading or
display of files will stop while deleting cache files. This takes some 
time status bay will say "deleting 1645 files cache" or something 
similar. Could that not be done in the background?
        I installed over 4.04 if that may have any bearing on this.

                Thanks for your time Jeffrey

::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
       Remove X For Mail
        tomfred@Xibm.net                                      
::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
      Posted With DNREAD 130B6 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    18-Oct-99 12:33:10
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Bios/Large HD Install Question

From: "seth berk" <snberk@ibm.net>

On Mon, 18 Oct 1999 14:11:08 -0400, Brad BARCLAY wrote:

>seth berk wrote:
>> 
>> 1)  The Bios won't  auto detect past 2 gigs.  It has 3 settings for a
>> 2 gig HD (normal, Large, LBA),  if I can partition the HD to an
>> intial 2 gig size, can I use the Bios anyway?  It is an old (1995)
>> Award Bios.
>
>	I don't know about Linux, but I do know that the IBM1S506 driver under
>OS/2 will use the geometry used by the drive over the one used by the
>BIOS if they differ.  OS/2 generally doesn't use BIOS calls for hard
>disk access - so if you set it up for 2Gb under your BIOS, you might be
>able to get away with using the full space under OS/2 anyhow (and if it
>doesn't use the proper geometry automatically, you should be able ot use
>the /GEO: switch for the 1S506 driver to manually specify it's geometry,
>and enable LBA mode).

I didn't know about the /GEO switch, but as you indicated OS/2 would
work OK even though the Bios was wrong.  

snip snip snip

>
>	No.  Unfortunately, the BIOS is often motherboard specific, and often
>not only to the specific manufacturer, but to the specific motherboard
>model as well.  I have a friend who toasted his MB installing an Asus
>BIOS update to his Asus motherboard, only to realize later (after trying
>to reboot...) that he applied the patch for a motherboard revision
>different from the one he owned :P.

Now you tell me... actually, I managed to find a site that listed
model numbers, so I could cross reference that manufacturers, that
lead to the ASUS site (Thank you Dogpile - search terms were "Triton
Award Bios") and well, now I have an updated Bios that is both Y2K (I
hope - I guess I should check) compliant and recognizes the HD.

The irony is that I upgraded my work computer from the P90 to the
PII350 because it wasn't Y2K compliant and I didn't think I could
find/flash an updated Bios.  The P90 is now at the house and my hobby
computer (I'm learning Linux just for fun) and it is now Y2K ready! 
I could have saved the money and not upgraded after all.  Of course
then I wouldn't have the fun of a new hobby.

Thanks for the reply

Seth

> 
>> Thanks for listening to this OT post - I have come to trust the
>> advice given here, and didn't want to start with a new NG.
>
>	No problem :).
>
>Brad BARCLAY
>
>=-=-=-=-=-=-=-=-=-=
>Posted from the OS/2 WARP v4.5 desktop of Brad BARCLAY.
>E-Mail:  bbarclay@ca.ibm.com		Location:  2G43D@Torolabs



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: peter.stahl@abc.se                                19-Oct-99 21:00:23
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Warp4-and-HPFS386

From: Peter Stahl <peter.stahl@abc.se>

It was very easy to install, just unzip the files and change

a couple of lines in CONFIG.SYS.



But HPFS386 couldn't use standard HPFS ACLs so I was forced to make

new ones.



I thought it would be equal easy to change back to standard

HPFS, just change CONFIG.SYS back to old contents, but HPFS

will not change HPFS386's ACLs.



I have tried to delete the ACLs in the same program as I create

new ones (Shared Resources and Network Connections) but HPFS

can't create new usable ACLs and it doesn't function without

ACLs either.



What to do ?



/Peter Stahl







On 25 Aug 1999 21:34:03 -0000, Anonymous wrote:



>This hpfs386 is dated 06/11/99 and is the latest release.

>if you're just using hpfs.ifs,  you can improve your system

>performance with the hpfs386 driver.

>

>The hpfs386 is 32bit and can have any cache size you

>want, plus its about 4x faster at writing and a bit

>faster at reading.  It will improve the speed of your

>system.

>

>

>You'll know it worked when you reboot and a single

>statement across your screen says the hpfs386 driver

>was found.








--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ABC-Klubben (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  19-Oct-99 18:17:13
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

On Tue, 19 Oct 1999 17:00:09, lsunley@mb.sympatico.ca (Lorne Sunley) wrote:

> On Tue, 19 Oct 1999 16:42:04, l_luciano@da.mob (Stan Goodman) wrote:
> 
> > On Tue, 19 Oct 1999 15:49:20, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > 
> > > On Tue, 19 Oct 1999 15:06:55, l_luciano@da.mob (Stan Goodman) wrote:
> > > 
> > > > On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > > > 
> > > > > On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman) wrote:
> > > > > 
> > > > > > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > > > > > 
> > > > > > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > > > > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > > > > > >> I just did this yesterday - it took about a half hour total.
Selective
> > > > > > > >> uninstalled multimedia, about five minutes. Reboot. Find the
CD, about an 
> > > > > > > >> hour. Selective reinstall, about another five minutes.
Reboot. Find where
> > > > > > > >> I put the fixpack files, start Service, choose Multimedia,
another maybe
> > > > > > > >> ten minutes. Reboot. Sort of a pain, but not that big a deal. 
Service will
> > > > > > > >> let you Fix the old MMPM install easily. I use something from 
Hobbes - 
> > > > > > > >> fastkick141 I think ? that makes the fpak situation
relatively painless.
> > > > > > > >> You might try it. DIUNPAK the .dsk files first, then the
Fix.cmd runs you
> > > > > > > >> right through no muss, no fuss, *and* you have the disk
images if you 
> > > > > > > >> need them again later. good luck
> > > > > > > >> 
> > > > > > > >> >
> > > > > > > >
> > > > > > > >Many programs add files such as dll's to the mmos2 directory. 
2 
> > > > > > > >examples are quickflick, anpocodec and the netscape plugin
pack.  If 
> > > > > > > >you do an uninstall and reinstall, what happens to those files.
> > > > > > > 
> > > > > > > 
> > > > > > > reinstall those as well, yeah, it's kinda tedious . . . but if
you
> > > > > > > want the new soundcard to work . . . ?? the point was that
> > > > > > > the fixpack will upgrade just mmos2 without messing with
> > > > > > > the rest of the system.
> > > > > > 
> > > > > > OK, I have done the whole exercise, deleting MMOS2, installing
> > > > > > Crystal drivers, and reinstalling MM support, rebooting after each 
step, 
> > > > > > The
> > > > > > system is still silent. It also thinks it has a CS4232/36 card,
whereas the
> > > > > > drivers I installed are for 4236B, which is what is on the card. 
> > > > > > 
> > > > > > After the final reboot, the system told me it couldn't find 
> > > > > > mmos2\cwaudio.sys.
> > > > > > The installation had put the line in config.sys, but had not made
it good 
> > > > > > by
> > > > > > copying the file; I would like to know why that happened. I did
find a copy
> > > > > > in
> > > > > > the OS2/BOOT directory, so I copied it and rebooted yet again, but 
the 
> > > > > > system is
> > > > > > still quiet.
> > > > > > 
> > > > > > I do not think interrupts are the problem: RMVIEW /irq shows that
it has 
> > > > > > taken
> > > > > > 5 and 9, which is correct.
> > > > > > 
> > > > > > I don't think I failed to touch any of the bases. What might be
happening 
> > > > > > now?
> > > > > > 
> > > > > 
> > > > > When you do the re-install it should be in the following order.
> > > > > 
> > > > > 1) Re-install MMOS/2 - DO NOT choose a sound card and
> > > > > if one is selected remove it. (It will not detect the Tidalwave 128
> > > > > correctly). You can do this by pressing the button on selective
> > > > > install beside the Multimedia Device field.
> > > > > 
> > > > > 2) After MMOS/2 is re-installed, install the drivers for the card.
> > > > > 
> > > > > 3) apply the appropriate fixpack (FP 12)
> > > > > 
> > > > > From your message (quoted above) it looks like you installed
> > > > > the sound card drivers, then re-installed MMOS/2.
> > > > 
> > > > No, I didn't do that. In order to have everything fresh in my memory,
I 
> > > > repeated the first part of the process just now. I deleted the \MMOS2 
> > > > directory; as predicted by the Crystal docs, quite a number of files
would 
> > > > not allow themselves to be deleted; that is OK, according to the docs. 

> > > > Then, in Selective Install (where the sound card still appeared as
"Crystal
> > > > Audio CS-4232/36") I removed the driver from the _selected_ list, and
did 
> > > > "Next", so that the MM installation completed from the OS/2
distribution 
> > > > CDROM. I rebooted, and got two announcements that programs belonging
to the
> > > > "Video Part" could not be deleted. Finally, I started Selective
Install 
> > > > again, in order to inspect the result; I was not surprised (having
been 
> > > > through this before) to see that the system still thinks a "Crystal
Audio 
> > > > CS-4232/36" card is installed.
> > > > 
> > > > I have left nothing out in the story; what did I do wrong? 
> > > > 
> > > 
> > > The "Selective Install" always probes for physically installed
> > > sound cards. It will always think the "Tidalwave 128" is a
> > > CS-4232/36 card.
> > > 
> > > The install of the drivers (after the delete and re-install of MMOS/2)
> > > should be done using MINSTALL in the directory where you
> > > have unzipped the drivers from the Crystal web site.
> > > 
> > > This will install the correct drivers.
> > 
> > To test that, I continued the installation procedure (having already 
> > deleted MMOS2 and reinstalled the distribution Multimedia support). 
> > 
> > The manual says to install from the Multimedia Application Install object, 

> > and that one can "also" install from the command line. These are in fact 
> > the same thing, but in order to follow your suggestion precisely, I did it 

> > this time from the command line, and installed from the file os2208wt, 
> > which I downloaded yesterday.
> > 
> > When the smoke had cleared away, I rebooted yet again, and opened
Selective
> > Install, in order to get the system's opinion about the sound card. The 
> > system still thinks it has a "Crystal Audio CS-4232/36 PnP", as before
> > 
> > When the system was coming up during the reboot, there was an announcement 

> > (which I had seen last time) that the file \MMOS2\CWAUDIO.SYS could not be 

> > found. I already know from last time that there is indeed a copy of the 
> > file in the \OS2\BOOT directory, and that copying it into the MMOS2 
> > directory doesn't help.
> > 
> > So no; apparently it doesn't install the correct drivers.
> > 
> 
> I have a Crystal Audio based card (8235 chip) and the driver
> for the chip installs with the following line
> 
> BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
> 
> As far as I know the driver package should set up something
> like the above line (a BASEDEV) not a DEVICE statement.
> 
> What does your config.sys file line for installing the driver look
> like. I have one REM'med out in mine that looks like this
> 
> REM DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
> 
> This line came from allowing MMOS/2 to select the CS-4232/36 
> card. (I went through all this when I change from an AWE64 to
> the Crystal Audio card.

Here are the lines that seem to be related to the card (I take B. Saudi to 
be a prince in an Arabian royal family, but I could be wrong):

DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
DEVICE=C:\MMOS2\CWVAUDIO.SYS BSAUD1$
BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
DEVICE=C:\MMOS2\CWMPU401.SYS /O:ONLYONE /O:LONGNAME /O:MULTIIRQ /O:MULTIIO 
/O:16BITS /N:CWMPU1$
BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2

So it is placing one DEVICE statement and two BASEDEV statements for the 
card, none REMed out. I will delete the duplicate BASEDEV; I assume that 
the DEVICE statement should also go, or be REMed, and that the CWVAUDIO 
statement should be left alone. I'll try that, and report here _only_ if it
does something good -- but I have little faith.

I am interested in your remark about allowing the installation to select 
the card. At no point in the installation have I ever been offered a choice
of cards, or an opportunity to confirm the installation's choice. The 
downloaded file, os2208wt.zip is called out to be associated with the chip 
used on the card, among others, and I have assumed that all those chips 
want the same drivers.

It still seems strange to me that the installation doesn't put the 
CWAUDIO.SYS in the MMOS2 directory.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.






--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    19-Oct-99 10:59:03
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Bios/Large HD Install Question

From: "seth berk" <snberk@ibm.net>

Thanks Meinolf;

I had reserved that idea as a plan B (or maybe C).  My new box is
literally built into my desk to make it less of a theft target.  I
have actually gone that route when I installed the 2nd drive.  I did
some (carefully preplanned) X-copying and swapping to make the new
2nd drive the first/boot drive.  As it turned out I found a bios
update, so now all is well.  I like having 2 separate HDs in my main
machine so I can make x-copies of the boot and data partitions to the
2nd drive.  Its not a perfect back up solution, but then that is why
the box is so hard to get at.

Seth


On Mon, 18 Oct 1999 20:03:55 +0200, Meinolf Sondermann wrote:

>
>
>seth berk wrote:
>> 
>> Hello:
>> 
>> I hope you Gurus will tolerate an slightly off topic post.
>> 
>> I recently upgraded my computer system from an old P90 system to a
>> 350 PII one by moving the hard-drives (a 2 gig and a 1 gig) and other
>> useful cards from the old box to the new box.  No problems there.
>> OS/2 handled it beautifully.  However...   Now the computer store has
>> convinced me that I should turn the old P90 box into a Linux box, and
>> sold me the required hardware which included an 8 gig Harddrive
>> (Smallest one they had on the shelves!  By the way did you see that
>> IBM is now selling a *73*!!! Gig HD??).  I am using Warp 4 FP11.
>> 
>
>[...]
>
>> Seth
>> 
>> (could you cc any replies to this weekend to snberk@ibm.net please?
>> I won't be able to check NGs until monday.  Thanks again)
>
>
>Hello Seth,
>
>I would install the new HD to the new box.
>
>At first the new box would have all three drives in it. This enables you
>to create and format the desired partitions on the 8GB drive. You can 
>then xcopy ( use switches "/H /O /T /S /E /R /V" )the contents of the old
>drives to the corresponding partitions on the new one. 
>
>Note: The drive letters will change after creating a new primary partition 
>( the one you want to boot from in the future ) to the third drive.
>
>There's one thing left to be done after copying: run the command 'sysinstx'
>against your new boot partition. This command is to be found on the first of
>the installation/boot disks as well as on the warp cd under \os2image\disk_0.
>
>After dooing that you remove the old HDs and make the new one the master on
>channel one.
>
>Thats it
>
>Bye/2
>Meinolf
>
>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  19-Oct-99 18:07:08
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

On Tue, 19 Oct 1999 17:00:09, lsunley@mb.sympatico.ca (Lorne Sunley) wrote:

> On Tue, 19 Oct 1999 16:42:04, l_luciano@da.mob (Stan Goodman) wrote:
> 
> > On Tue, 19 Oct 1999 15:49:20, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > 
> > > On Tue, 19 Oct 1999 15:06:55, l_luciano@da.mob (Stan Goodman) wrote:
> > > 
> > > > On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > > > 
> > > > > On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman) wrote:
> > > > > 
> > > > > > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > > > > > 
> > > > > > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > > > > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > > > > > >> I just did this yesterday - it took about a half hour total.
Selective
> > > > > > > >> uninstalled multimedia, about five minutes. Reboot. Find the
CD, about an 
> > > > > > > >> hour. Selective reinstall, about another five minutes.
Reboot. Find where
> > > > > > > >> I put the fixpack files, start Service, choose Multimedia,
another maybe
> > > > > > > >> ten minutes. Reboot. Sort of a pain, but not that big a deal. 
Service will
> > > > > > > >> let you Fix the old MMPM install easily. I use something from 
Hobbes - 
> > > > > > > >> fastkick141 I think ? that makes the fpak situation
relatively painless.
> > > > > > > >> You might try it. DIUNPAK the .dsk files first, then the
Fix.cmd runs you
> > > > > > > >> right through no muss, no fuss, *and* you have the disk
images if you 
> > > > > > > >> need them again later. good luck
> > > > > > > >> 
> > > > > > > >> >
> > > > > > > >
> > > > > > > >Many programs add files such as dll's to the mmos2 directory. 
2 
> > > > > > > >examples are quickflick, anpocodec and the netscape plugin
pack.  If 
> > > > > > > >you do an uninstall and reinstall, what happens to those files.
> > > > > > > 
> > > > > > > 
> > > > > > > reinstall those as well, yeah, it's kinda tedious . . . but if
you
> > > > > > > want the new soundcard to work . . . ?? the point was that
> > > > > > > the fixpack will upgrade just mmos2 without messing with
> > > > > > > the rest of the system.
> > > > > > 
> > > > > > OK, I have done the whole exercise, deleting MMOS2, installing
> > > > > > Crystal drivers, and reinstalling MM support, rebooting after each 
step, 
> > > > > > The
> > > > > > system is still silent. It also thinks it has a CS4232/36 card,
whereas the
> > > > > > drivers I installed are for 4236B, which is what is on the card. 
> > > > > > 
> > > > > > After the final reboot, the system told me it couldn't find 
> > > > > > mmos2\cwaudio.sys.
> > > > > > The installation had put the line in config.sys, but had not made
it good 
> > > > > > by
> > > > > > copying the file; I would like to know why that happened. I did
find a copy
> > > > > > in
> > > > > > the OS2/BOOT directory, so I copied it and rebooted yet again, but 
the 
> > > > > > system is
> > > > > > still quiet.
> > > > > > 
> > > > > > I do not think interrupts are the problem: RMVIEW /irq shows that
it has 
> > > > > > taken
> > > > > > 5 and 9, which is correct.
> > > > > > 
> > > > > > I don't think I failed to touch any of the bases. What might be
happening 
> > > > > > now?
> > > > > > 
> > > > > 
> > > > > When you do the re-install it should be in the following order.
> > > > > 
> > > > > 1) Re-install MMOS/2 - DO NOT choose a sound card and
> > > > > if one is selected remove it. (It will not detect the Tidalwave 128
> > > > > correctly). You can do this by pressing the button on selective
> > > > > install beside the Multimedia Device field.
> > > > > 
> > > > > 2) After MMOS/2 is re-installed, install the drivers for the card.
> > > > > 
> > > > > 3) apply the appropriate fixpack (FP 12)
> > > > > 
> > > > > From your message (quoted above) it looks like you installed
> > > > > the sound card drivers, then re-installed MMOS/2.
> > > > 
> > > > No, I didn't do that. In order to have everything fresh in my memory,
I 
> > > > repeated the first part of the process just now. I deleted the \MMOS2 
> > > > directory; as predicted by the Crystal docs, quite a number of files
would 
> > > > not allow themselves to be deleted; that is OK, according to the docs. 

> > > > Then, in Selective Install (where the sound card still appeared as
"Crystal
> > > > Audio CS-4232/36") I removed the driver from the _selected_ list, and
did 
> > > > "Next", so that the MM installation completed from the OS/2
distribution 
> > > > CDROM. I rebooted, and got two announcements that programs belonging
to the
> > > > "Video Part" could not be deleted. Finally, I started Selective
Install 
> > > > again, in order to inspect the result; I was not surprised (having
been 
> > > > through this before) to see that the system still thinks a "Crystal
Audio 
> > > > CS-4232/36" card is installed.
> > > > 
> > > > I have left nothing out in the story; what did I do wrong? 
> > > > 
> > > 
> > > The "Selective Install" always probes for physically installed
> > > sound cards. It will always think the "Tidalwave 128" is a
> > > CS-4232/36 card.
> > > 
> > > The install of the drivers (after the delete and re-install of MMOS/2)
> > > should be done using MINSTALL in the directory where you
> > > have unzipped the drivers from the Crystal web site.
> > > 
> > > This will install the correct drivers.
> > 
> > To test that, I continued the installation procedure (having already 
> > deleted MMOS2 and reinstalled the distribution Multimedia support). 
> > 
> > The manual says to install from the Multimedia Application Install object, 

> > and that one can "also" install from the command line. These are in fact 
> > the same thing, but in order to follow your suggestion precisely, I did it 

> > this time from the command line, and installed from the file os2208wt, 
> > which I downloaded yesterday.
> > 
> > When the smoke had cleared away, I rebooted yet again, and opened
Selective
> > Install, in order to get the system's opinion about the sound card. The 
> > system still thinks it has a "Crystal Audio CS-4232/36 PnP", as before
> > 
> > When the system was coming up during the reboot, there was an announcement 

> > (which I had seen last time) that the file \MMOS2\CWAUDIO.SYS could not be 

> > found. I already know from last time that there is indeed a copy of the 
> > file in the \OS2\BOOT directory, and that copying it into the MMOS2 
> > directory doesn't help.
> > 
> > So no; apparently it doesn't install the correct drivers.
> > 
> 
> I have a Crystal Audio based card (8235 chip) and the driver
> for the chip installs with the following line
> 
> BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
> 
> As far as I know the driver package should set up something
> like the above line (a BASEDEV) not a DEVICE statement.
> 
> What does your config.sys file line for installing the driver look
> like. I have one REM'med out in mine that looks like this
> 
> REM DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
> 
> This line came from allowing MMOS/2 to select the CS-4232/36 
> card. (I went through all this when I change from an AWE64 to
> the Crystal Audio card.

Here are the lines that seem to be related to the card (I take B. Saudi to 
be a prince in an Arabian royal family, but I could be wrong):

DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
DEVICE=C:\MMOS2\CWVAUDIO.SYS BSAUD1$
BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
DEVICE=C:\MMOS2\CWMPU401.SYS /O:ONLYONE /O:LONGNAME /O:MULTIIRQ /O:MULTIIO 
/O:16BITS /N:CWMPU1$
BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2

So it is placing one DEVICE statement and two BASEDEV statements for the 
card, none REMed out. I will delete the duplicate BASEDEV; I assume that 
the DEVICE statement should also go, or be REMed, and that the CWVAUDIO 
statement should be left alone. I'll try that, and report here _only_ if it
does something good -- but I have little faith.

I am interested in your remark about allowing the installation to select 
the card. At no point in the installation have I ever been offered a choice
of cards, or an opportunity to confirm the installation's choice. The 
downloaded file, os2208wt.zip is called out to be associated with the chip 
used on the card, among others, and I have assumed that all those chips 
want the same drivers.

It still seems strange to me that the installation doesn't put the 
CWAUDIO.SYS in the MMOS2 directory.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    19-Oct-99 19:34:22
  To: All                                               19-Oct-99 16:46:05
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

Brad BARCLAY  <bbarclay@ca.ibm.com> writes:
> 
> 	The MultiMedia Setup notebook allows you to specify what features your
> CD-ROM drive supports (under the Compact Disc tab(s)).  One of these
> selections is "Digital Transfer".  If it's not enabled, select it.

Maybe that's it. It was unchecked. What I don't understand is why, then.
It must have been checked for the old drive, since I had no problems with
it. How and where is it set in the first place? Does the installation
query the drive?

I assume I have to reboot, because I still get the errors after checking 
the box.

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                19-Oct-99 15:28:24
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Netscape cache messing up

From: lifedata@xxvol.com

"Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com> said:
>Symptoms reported by Jim L:
>(1) "web pages re-downloading over and over"
>(2) Won't continue download after abort; restarts again

>There appears to be a direct correlation, which led me
>to my suggestion that he re-enable the caching.  :)

My mistake.  I figured the "etc." covered turning them back on.  They are back
to their previous (previously functional) values.

Sooooooooooo, if there is something in addition to putting values in the cache
windows to turn them on, what is it?

Lacking an answer of substance there, what else can I do?

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                19-Oct-99 15:30:09
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Netscape cache messing up

From: lifedata@xxvol.com

swordedg@ntrnet.net (David Eckard) said:

>Jeff, there is definately something about the GA 4.61 that pegs my CPU meter
>and slows the system to a crawl.

I've heard that having no disk cache causes that.

Now...  Do you have a comment on the subject of my thread?

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           19-Oct-99 19:53:17
  To: All                                               19-Oct-99 16:46:05
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Tue, 19 Oct 1999 18:17:27, l_luciano@da.mob (Stan Goodman) wrote:

> On Tue, 19 Oct 1999 17:00:09, lsunley@mb.sympatico.ca (Lorne Sunley) wrote:
> 
> > On Tue, 19 Oct 1999 16:42:04, l_luciano@da.mob (Stan Goodman) wrote:
> > 
> > > On Tue, 19 Oct 1999 15:49:20, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > > 
> > > > On Tue, 19 Oct 1999 15:06:55, l_luciano@da.mob (Stan Goodman) wrote:
> > > > 
> > > > > On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne Sunley) 
wrote:
> > > > > 
> > > > > > On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman)
wrote:
> > > > > > 
> > > > > > > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > > > > > > 
> > > > > > > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>,
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > > > > > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > > > > > > >> I just did this yesterday - it took about a half hour
total. Selective
> > > > > > > > >> uninstalled multimedia, about five minutes. Reboot. Find
the CD, about an 
> > > > > > > > >> hour. Selective reinstall, about another five minutes.
Reboot. Find where
> > > > > > > > >> I put the fixpack files, start Service, choose Multimedia,
another maybe
> > > > > > > > >> ten minutes. Reboot. Sort of a pain, but not that big a
deal. Service will
> > > > > > > > >> let you Fix the old MMPM install easily. I use something
from Hobbes - 
> > > > > > > > >> fastkick141 I think ? that makes the fpak situation
relatively painless.
> > > > > > > > >> You might try it. DIUNPAK the .dsk files first, then the
Fix.cmd runs you
> > > > > > > > >> right through no muss, no fuss, *and* you have the disk
images if you 
> > > > > > > > >> need them again later. good luck
> > > > > > > > >> 
> > > > > > > > >> >
> > > > > > > > >
> > > > > > > > >Many programs add files such as dll's to the mmos2 directory. 
 2 
> > > > > > > > >examples are quickflick, anpocodec and the netscape plugin
pack.  If 
> > > > > > > > >you do an uninstall and reinstall, what happens to those
files.
> > > > > > > > 
> > > > > > > > 
> > > > > > > > reinstall those as well, yeah, it's kinda tedious . . . but if 
you
> > > > > > > > want the new soundcard to work . . . ?? the point was that
> > > > > > > > the fixpack will upgrade just mmos2 without messing with
> > > > > > > > the rest of the system.
> > > > > > > 
> > > > > > > OK, I have done the whole exercise, deleting MMOS2, installing
> > > > > > > Crystal drivers, and reinstalling MM support, rebooting after
each step, 
> > > > > > > The
> > > > > > > system is still silent. It also thinks it has a CS4232/36 card,
whereas the
> > > > > > > drivers I installed are for 4236B, which is what is on the card. 

> > > > > > > 
> > > > > > > After the final reboot, the system told me it couldn't find 
> > > > > > > mmos2\cwaudio.sys.
> > > > > > > The installation had put the line in config.sys, but had not
made it good 
> > > > > > > by
> > > > > > > copying the file; I would like to know why that happened. I did
find a copy
> > > > > > > in
> > > > > > > the OS2/BOOT directory, so I copied it and rebooted yet again,
but the 
> > > > > > > system is
> > > > > > > still quiet.
> > > > > > > 
> > > > > > > I do not think interrupts are the problem: RMVIEW /irq shows
that it has 
> > > > > > > taken
> > > > > > > 5 and 9, which is correct.
> > > > > > > 
> > > > > > > I don't think I failed to touch any of the bases. What might be
happening 
> > > > > > > now?
> > > > > > > 
> > > > > > 
> > > > > > When you do the re-install it should be in the following order.
> > > > > > 
> > > > > > 1) Re-install MMOS/2 - DO NOT choose a sound card and
> > > > > > if one is selected remove it. (It will not detect the Tidalwave
128
> > > > > > correctly). You can do this by pressing the button on selective
> > > > > > install beside the Multimedia Device field.
> > > > > > 
> > > > > > 2) After MMOS/2 is re-installed, install the drivers for the card.
> > > > > > 
> > > > > > 3) apply the appropriate fixpack (FP 12)
> > > > > > 
> > > > > > From your message (quoted above) it looks like you installed
> > > > > > the sound card drivers, then re-installed MMOS/2.
> > > > > 
> > > > > No, I didn't do that. In order to have everything fresh in my
memory, I 
> > > > > repeated the first part of the process just now. I deleted the
\MMOS2 
> > > > > directory; as predicted by the Crystal docs, quite a number of files 
would 
> > > > > not allow themselves to be deleted; that is OK, according to the
docs. 
> > > > > Then, in Selective Install (where the sound card still appeared as
"Crystal
> > > > > Audio CS-4232/36") I removed the driver from the _selected_ list,
and did 
> > > > > "Next", so that the MM installation completed from the OS/2
distribution 
> > > > > CDROM. I rebooted, and got two announcements that programs belonging 
to the
> > > > > "Video Part" could not be deleted. Finally, I started Selective
Install 
> > > > > again, in order to inspect the result; I was not surprised (having
been 
> > > > > through this before) to see that the system still thinks a "Crystal
Audio 
> > > > > CS-4232/36" card is installed.
> > > > > 
> > > > > I have left nothing out in the story; what did I do wrong? 
> > > > > 
> > > > 
> > > > The "Selective Install" always probes for physically installed
> > > > sound cards. It will always think the "Tidalwave 128" is a
> > > > CS-4232/36 card.
> > > > 
> > > > The install of the drivers (after the delete and re-install of MMOS/2)
> > > > should be done using MINSTALL in the directory where you
> > > > have unzipped the drivers from the Crystal web site.
> > > > 
> > > > This will install the correct drivers.
> > > 
> > > To test that, I continued the installation procedure (having already 
> > > deleted MMOS2 and reinstalled the distribution Multimedia support). 
> > > 
> > > The manual says to install from the Multimedia Application Install
object, 
> > > and that one can "also" install from the command line. These are in fact 

> > > the same thing, but in order to follow your suggestion precisely, I did
it 
> > > this time from the command line, and installed from the file os2208wt, 
> > > which I downloaded yesterday.
> > > 
> > > When the smoke had cleared away, I rebooted yet again, and opened
Selective
> > > Install, in order to get the system's opinion about the sound card. The 
> > > system still thinks it has a "Crystal Audio CS-4232/36 PnP", as before
> > > 
> > > When the system was coming up during the reboot, there was an
announcement 
> > > (which I had seen last time) that the file \MMOS2\CWAUDIO.SYS could not
be 
> > > found. I already know from last time that there is indeed a copy of the 
> > > file in the \OS2\BOOT directory, and that copying it into the MMOS2 
> > > directory doesn't help.
> > > 
> > > So no; apparently it doesn't install the correct drivers.
> > > 
> > 
> > I have a Crystal Audio based card (8235 chip) and the driver
> > for the chip installs with the following line
> > 
> > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
> > 
> > As far as I know the driver package should set up something
> > like the above line (a BASEDEV) not a DEVICE statement.
> > 
> > What does your config.sys file line for installing the driver look
> > like. I have one REM'med out in mine that looks like this
> > 
> > REM DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
> > 
> > This line came from allowing MMOS/2 to select the CS-4232/36 
> > card. (I went through all this when I change from an AWE64 to
> > the Crystal Audio card.
> 
> Here are the lines that seem to be related to the card (I take B. Saudi to 
> be a prince in an Arabian royal family, but I could be wrong):
> 

I think the next line should be REM'med
> DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8

The next three left alone
> DEVICE=C:\MMOS2\CWVAUDIO.SYS BSAUD1$
> BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
> DEVICE=C:\MMOS2\CWMPU401.SYS /O:ONLYONE /O:LONGNAME /O:MULTIIRQ /O:MULTIIO 
> /O:16BITS /N:CWMPU1$

This one REM'med out
> BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2

> 
> So it is placing one DEVICE statement and two BASEDEV statements for the 
> card, none REMed out. I will delete the duplicate BASEDEV; I assume that 
> the DEVICE statement should also go, or be REMed, and that the CWVAUDIO 
> statement should be left alone. I'll try that, and report here _only_ if it
> does something good -- but I have little faith.
> 
> I am interested in your remark about allowing the installation to select 
> the card. At no point in the installation have I ever been offered a choice
> of cards, or an opportunity to confirm the installation's choice. The 
> downloaded file, os2208wt.zip is called out to be associated with the chip 
> used on the card, among others, and I have assumed that all those chips 
> want the same drivers.
> 
> It still seems strange to me that the installation doesn't put the 
> CWAUDIO.SYS in the MMOS2 directory.
> 

When they made it into a basedev, the boot process wll only
load it from the root directory (\), (\OS2) or (\OS2\BOOT) as the
loader is restricted on where it can look for BASEDEV drivers.

He's actually not a member of the House of Saud, it stands
for BusinesS AUDio (I think :-)

Lorne Sunley



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           19-Oct-99 20:36:02
  To: All                                               19-Oct-99 19:57:21
Subj: Re: Bios/Large HD Install Question

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Tue, 19 Oct 1999 20:17:06, Brad BARCLAY <bbarclay@ca.ibm.com> 
wrote:

<snip all the good stuff>
> 
> 	Three laws of computer science:
> 
> 		1) You can never have too much storage space,
> 		2) You can never have too many available CPU cycles,
> 		3) You can never have enough bandwidth.
> 
You forgot one,

	4) You can never have enough back-ups.
	5) Rule 4 is only reconized after the fact (or crash)

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: bbarclay@ca.ibm.com                               19-Oct-99 16:17:03
  To: All                                               19-Oct-99 19:57:22
Subj: Re: Bios/Large HD Install Question

From: Brad BARCLAY <bbarclay@ca.ibm.com>

seth berk wrote:
> Now you tell me... actually, I managed to find a site that listed
> model numbers, so I could cross reference that manufacturers, that
> lead to the ASUS site (Thank you Dogpile - search terms were "Triton
> Award Bios") and well, now I have an updated Bios that is both Y2K (I
> hope - I guess I should check) compliant and recognizes the HD.

	Well, if you've successfully rebooted the computer, I'd be willing to
say it obviously worked :).

	I just can't caution everyon enough, however, on making certain that
they have the *exact* correct BIOS flash file that goes with their
specific motherboard manufacturer and model before attempting to flash
it.  I have seen many people flash their boards with the wrong flash
BIOS update only to find afterwards that their board was useless (at
which point your only options are to either replace the flash BIOS chip
altogether, remove it and reprogram it using a stand-alone flash
reprogrammer, or buy a new motherboard).  It's a really quick and easy
way to make your motherboard into a piece of useless junk :).

	I really wish that the flash designers could put a fixed model ID
number into their cihps so that the flashing programs can verify that
the flash BIOS file matches the intended motherboard model number.  This
would cut down on user errors resulting in useless hardware.

	Anyhow, congratulations!  I've flashed my board at home on several
ocasions (most recently to make my Asus P2B board P3 compliant so I
could drop a P3-450 into it :) without a single problem.
 
> The irony is that I upgraded my work computer from the P90 to the
> PII350 because it wasn't Y2K compliant and I didn't think I could
> find/flash an updated Bios.  The P90 is now at the house and my hobby
> computer (I'm learning Linux just for fun) and it is now Y2K ready!
> I could have saved the money and not upgraded after all.  Of course
> then I wouldn't have the fun of a new hobby.

	Three laws of computer science:

		1) You can never have too much storage space,
		2) You can never have too many available CPU cycles,
		3) You can never have enough bandwidth.

	IMHO, the more, the merrier! :).

Brad BARCLAY

=-=-=-=-=-=-=-=-=-=
Posted from the OS/2 WARP v4.5 desktop of Brad BARCLAY.
E-Mail:  bbarclay@ca.ibm.com		Location:  2G43D@Torolabs

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Toronto Labs, DB2 for OS/2 Install Developer (1:109/42)

+----------------------------------------------------------------------------+

From: bbarclay@ca.ibm.com                               19-Oct-99 16:21:21
  To: All                                               19-Oct-99 19:57:22
Subj: Re: cdwriter support

From: Brad BARCLAY <bbarclay@ca.ibm.com>

Pierre Jelenc wrote:
> 
> Brad BARCLAY  <bbarclay@ca.ibm.com> writes:
> >
> >       The MultiMedia Setup notebook allows you to specify what features
your
> > CD-ROM drive supports (under the Compact Disc tab(s)).  One of these
> > selections is "Digital Transfer".  If it's not enabled, select it.
> 
> Maybe that's it. It was unchecked. What I don't understand is why, then.
> It must have been checked for the old drive, since I had no problems with
> it. How and where is it set in the first place? Does the installation
> query the drive?

	I think it's queried when you run through a plug and play hardware
detection (ie: either by selecting "Full Hardware Detection" fromthe
ALT-F1 boot menu, or from the Hardware object's properties notebook, tab
1 page 1).  But don't quote me on that - I'm not entirely certain.

	(If you haven't done so since installing the new drive, or any other
new hardware, running through such an update on your next reboot might
not be a bad idea.  It may not necessarily fix anything, but it should
prevent potential future problems).
 
> I assume I have to reboot, because I still get the errors after checking
> the box.

	No, you shouldn't have to reboot.  It was only a guess on my part as to
why it was failing, although this setting should help you avoid this
problem with other applications that support digital transfer via MMPM
(such as the OS/2 CD player's digital transfer mode).

	Best of luck!

Brad BARCLAY

=-=-=-=-=-=-=-=-=-=
Posted from the OS/2 WARP v4.5 desktop of Brad BARCLAY.
E-Mail:  bbarclay@ca.ibm.com		Location:  2G43D@Torolabs

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Toronto Labs, DB2 for OS/2 Install Developer (1:109/42)

+----------------------------------------------------------------------------+

From: huffd@nls.net                                     19-Oct-99 21:36:24
  To: All                                               19-Oct-99 19:57:22
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: "David D. Huff Jr." <huffd@nls.net>

I think there may be more of a problem than just the driver install.
Here is what I would do:
Delete mmos2 again and rem out all the sound devices in the config.sys
re-install the mmos2 from this install facility allowing it to use the
default drivers OS/2 will select. I know for a fact both Warp4 and
WSeB will both play sound throught the card using the default
drivers IF it is an ISA card!

Secondly the drivers you downloaded were for the ISA card NOT
the PCI card.

If the above two things are all in sync. The card may be bad. And
I would replace it with the same card. Because in my opinion
it is still the best card for OS/2



Lorne Sunley wrote:

> On Tue, 19 Oct 1999 18:17:27, l_luciano@da.mob (Stan Goodman) wrote:
>
> > On Tue, 19 Oct 1999 17:00:09, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> >
> > > On Tue, 19 Oct 1999 16:42:04, l_luciano@da.mob (Stan Goodman) wrote:
> > >
> > > > On Tue, 19 Oct 1999 15:49:20, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > > >
> > > > > On Tue, 19 Oct 1999 15:06:55, l_luciano@da.mob (Stan Goodman) wrote:
> > > > >
> > > > > > On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne
Sunley) wrote:
> > > > > >
> > > > > > > On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman)
wrote:
> > > > > > >
> > > > > > > > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > > > > > > >
> > > > > > > > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>, 
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > > > > > > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > > > > > > > >> I just did this yesterday - it took about a half hour
total. Selective
> > > > > > > > > >> uninstalled multimedia, about five minutes. Reboot. Find
the CD, about an
> > > > > > > > > >> hour. Selective reinstall, about another five minutes.
Reboot. Find where
> > > > > > > > > >> I put the fixpack files, start Service, choose
Multimedia, another maybe
> > > > > > > > > >> ten minutes. Reboot. Sort of a pain, but not that big a
deal. Service will
> > > > > > > > > >> let you Fix the old MMPM install easily. I use something
from Hobbes -
> > > > > > > > > >> fastkick141 I think ? that makes the fpak situation
relatively painless.
> > > > > > > > > >> You might try it. DIUNPAK the .dsk files first, then the
Fix.cmd runs you
> > > > > > > > > >> right through no muss, no fuss, *and* you have the disk
images if you
> > > > > > > > > >> need them again later. good luck
> > > > > > > > > >>
> > > > > > > > > >> >
> > > > > > > > > >
> > > > > > > > > >Many programs add files such as dll's to the mmos2
directory.  2
> > > > > > > > > >examples are quickflick, anpocodec and the netscape plugin
pack.  If
> > > > > > > > > >you do an uninstall and reinstall, what happens to those
files.
> > > > > > > > >
> > > > > > > > >
> > > > > > > > > reinstall those as well, yeah, it's kinda tedious . . . but
if you
> > > > > > > > > want the new soundcard to work . . . ?? the point was that
> > > > > > > > > the fixpack will upgrade just mmos2 without messing with
> > > > > > > > > the rest of the system.
> > > > > > > >
> > > > > > > > OK, I have done the whole exercise, deleting MMOS2, installing
> > > > > > > > Crystal drivers, and reinstalling MM support, rebooting after
each step,
> > > > > > > > The
> > > > > > > > system is still silent. It also thinks it has a CS4232/36
card, whereas the
> > > > > > > > drivers I installed are for 4236B, which is what is on the
card.
> > > > > > > >
> > > > > > > > After the final reboot, the system told me it couldn't find
> > > > > > > > mmos2\cwaudio.sys.
> > > > > > > > The installation had put the line in config.sys, but had not
made it good
> > > > > > > > by
> > > > > > > > copying the file; I would like to know why that happened. I
did find a copy
> > > > > > > > in
> > > > > > > > the OS2/BOOT directory, so I copied it and rebooted yet again, 
but the
> > > > > > > > system is
> > > > > > > > still quiet.
> > > > > > > >
> > > > > > > > I do not think interrupts are the problem: RMVIEW /irq shows
that it has
> > > > > > > > taken
> > > > > > > > 5 and 9, which is correct.
> > > > > > > >
> > > > > > > > I don't think I failed to touch any of the bases. What might
be happening
> > > > > > > > now?
> > > > > > > >
> > > > > > >
> > > > > > > When you do the re-install it should be in the following order.
> > > > > > >
> > > > > > > 1) Re-install MMOS/2 - DO NOT choose a sound card and
> > > > > > > if one is selected remove it. (It will not detect the Tidalwave
128
> > > > > > > correctly). You can do this by pressing the button on selective
> > > > > > > install beside the Multimedia Device field.
> > > > > > >
> > > > > > > 2) After MMOS/2 is re-installed, install the drivers for the
card.
> > > > > > >
> > > > > > > 3) apply the appropriate fixpack (FP 12)
> > > > > > >
> > > > > > > From your message (quoted above) it looks like you installed
> > > > > > > the sound card drivers, then re-installed MMOS/2.
> > > > > >
> > > > > > No, I didn't do that. In order to have everything fresh in my
memory, I
> > > > > > repeated the first part of the process just now. I deleted the
\MMOS2
> > > > > > directory; as predicted by the Crystal docs, quite a number of
files would
> > > > > > not allow themselves to be deleted; that is OK, according to the
docs.
> > > > > > Then, in Selective Install (where the sound card still appeared as 
"Crystal
> > > > > > Audio CS-4232/36") I removed the driver from the _selected_ list,
and did
> > > > > > "Next", so that the MM installation completed from the OS/2
distribution
> > > > > > CDROM. I rebooted, and got two announcements that programs
belonging to the
> > > > > > "Video Part" could not be deleted. Finally, I started Selective
Install
> > > > > > again, in order to inspect the result; I was not surprised (having 
been
> > > > > > through this before) to see that the system still thinks a
"Crystal Audio
> > > > > > CS-4232/36" card is installed.
> > > > > >
> > > > > > I have left nothing out in the story; what did I do wrong?
> > > > > >
> > > > >
> > > > > The "Selective Install" always probes for physically installed
> > > > > sound cards. It will always think the "Tidalwave 128" is a
> > > > > CS-4232/36 card.
> > > > >
> > > > > The install of the drivers (after the delete and re-install of
MMOS/2)
> > > > > should be done using MINSTALL in the directory where you
> > > > > have unzipped the drivers from the Crystal web site.
> > > > >
> > > > > This will install the correct drivers.
> > > >
> > > > To test that, I continued the installation procedure (having already
> > > > deleted MMOS2 and reinstalled the distribution Multimedia support).
> > > >
> > > > The manual says to install from the Multimedia Application Install
object,
> > > > and that one can "also" install from the command line. These are in
fact
> > > > the same thing, but in order to follow your suggestion precisely, I
did it
> > > > this time from the command line, and installed from the file os2208wt,
> > > > which I downloaded yesterday.
> > > >
> > > > When the smoke had cleared away, I rebooted yet again, and opened
Selective
> > > > Install, in order to get the system's opinion about the sound card.
The
> > > > system still thinks it has a "Crystal Audio CS-4232/36 PnP", as before
> > > >
> > > > When the system was coming up during the reboot, there was an
announcement
> > > > (which I had seen last time) that the file \MMOS2\CWAUDIO.SYS could
not be
> > > > found. I already know from last time that there is indeed a copy of
the
> > > > file in the \OS2\BOOT directory, and that copying it into the MMOS2
> > > > directory doesn't help.
> > > >
> > > > So no; apparently it doesn't install the correct drivers.
> > > >
> > >
> > > I have a Crystal Audio based card (8235 chip) and the driver
> > > for the chip installs with the following line
> > >
> > > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
> > >
> > > As far as I know the driver package should set up something
> > > like the above line (a BASEDEV) not a DEVICE statement.
> > >
> > > What does your config.sys file line for installing the driver look
> > > like. I have one REM'med out in mine that looks like this
> > >
> > > REM DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
> > >
> > > This line came from allowing MMOS/2 to select the CS-4232/36
> > > card. (I went through all this when I change from an AWE64 to
> > > the Crystal Audio card.
> >
> > Here are the lines that seem to be related to the card (I take B. Saudi to
> > be a prince in an Arabian royal family, but I could be wrong):
> >
>
> I think the next line should be REM'med
> > DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
>
> The next three left alone
> > DEVICE=C:\MMOS2\CWVAUDIO.SYS BSAUD1$
> > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
> > DEVICE=C:\MMOS2\CWMPU401.SYS /O:ONLYONE /O:LONGNAME /O:MULTIIRQ /O:MULTIIO
> > /O:16BITS /N:CWMPU1$
>
> This one REM'med out
> > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
>
> >
> > So it is placing one DEVICE statement and two BASEDEV statements for the
> > card, none REMed out. I will delete the duplicate BASEDEV; I assume that
> > the DEVICE statement should also go, or be REMed, and that the CWVAUDIO
> > statement should be left alone. I'll try that, and report here _only_ if
it
> > does something good -- but I have little faith.
> >
> > I am interested in your remark about allowing the installation to select
> > the card. At no point in the installation have I ever been offered a
choice
> > of cards, or an opportunity to confirm the installation's choice. The
> > downloaded file, os2208wt.zip is called out to be associated with the chip
> > used on the card, among others, and I have assumed that all those chips
> > want the same drivers.
> >
> > It still seems strange to me that the installation doesn't put the
> > CWAUDIO.SYS in the MMOS2 directory.
> >
>
> When they made it into a basedev, the boot process wll only
> load it from the root directory (\), (\OS2) or (\OS2\BOOT) as the
> loader is restricted on where it can look for BASEDEV drivers.
>
> He's actually not a member of the House of Saud, it stands
> for BusinesS AUDio (I think :-)
>
> Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  19-Oct-99 22:08:25
  To: All                                               19-Oct-99 21:35:07
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: l_luciano@da.mob (Stan Goodman)

On Tue, 19 Oct 1999 19:53:35, lsunley@mb.sympatico.ca (Lorne Sunley) wrote:

> On Tue, 19 Oct 1999 18:17:27, l_luciano@da.mob (Stan Goodman) wrote:
> 
> > On Tue, 19 Oct 1999 17:00:09, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > 
> > > On Tue, 19 Oct 1999 16:42:04, l_luciano@da.mob (Stan Goodman) wrote:
> > > 
> > > > On Tue, 19 Oct 1999 15:49:20, lsunley@mb.sympatico.ca (Lorne Sunley)
wrote:
> > > > 
> > > > > On Tue, 19 Oct 1999 15:06:55, l_luciano@da.mob (Stan Goodman) wrote:
> > > > > 
> > > > > > On Tue, 19 Oct 1999 13:43:46, lsunley@mb.sympatico.ca (Lorne
Sunley) wrote:
> > > > > > 
> > > > > > > On Tue, 19 Oct 1999 10:51:19, l_luciano@da.mob (Stan Goodman)
wrote:
> > > > > > > 
> > > > > > > > On Mon, 18 Oct 1999 17:33:50, hamei@pacbell.net wrote:
> > > > > > > > 
> > > > > > > > > In <E6sNVDizkcQ3-pn2-7mCqS9d7md8N@n04h3125.ex-pressnet.com>, 
maxikins@os2bbs.com (Mark Klebanoff) writes:
> > > > > > > > > >On Mon, 18 Oct 1999 04:39:21, hamei@pacbell.net wrote:
> > > > > > > > > >> I just did this yesterday - it took about a half hour
total. Selective
> > > > > > > > > >> uninstalled multimedia, about five minutes. Reboot. Find
the CD, about an 
> > > > > > > > > >> hour. Selective reinstall, about another five minutes.
Reboot. Find where
> > > > > > > > > >> I put the fixpack files, start Service, choose
Multimedia, another maybe
> > > > > > > > > >> ten minutes. Reboot. Sort of a pain, but not that big a
deal. Service will
> > > > > > > > > >> let you Fix the old MMPM install easily. I use something
from Hobbes - 
> > > > > > > > > >> fastkick141 I think ? that makes the fpak situation
relatively painless.
> > > > > > > > > >> You might try it. DIUNPAK the .dsk files first, then the
Fix.cmd runs you
> > > > > > > > > >> right through no muss, no fuss, *and* you have the disk
images if you 
> > > > > > > > > >> need them again later. good luck
> > > > > > > > > >> 
> > > > > > > > > >> >
> > > > > > > > > >
> > > > > > > > > >Many programs add files such as dll's to the mmos2
directory.  2 
> > > > > > > > > >examples are quickflick, anpocodec and the netscape plugin
pack.  If 
> > > > > > > > > >you do an uninstall and reinstall, what happens to those
files.
> > > > > > > > > 
> > > > > > > > > 
> > > > > > > > > reinstall those as well, yeah, it's kinda tedious . . . but
if you
> > > > > > > > > want the new soundcard to work . . . ?? the point was that
> > > > > > > > > the fixpack will upgrade just mmos2 without messing with
> > > > > > > > > the rest of the system.
> > > > > > > > 
> > > > > > > > OK, I have done the whole exercise, deleting MMOS2, installing
> > > > > > > > Crystal drivers, and reinstalling MM support, rebooting after
each step, 
> > > > > > > > The
> > > > > > > > system is still silent. It also thinks it has a CS4232/36
card, whereas the
> > > > > > > > drivers I installed are for 4236B, which is what is on the
card. 
> > > > > > > > 
> > > > > > > > After the final reboot, the system told me it couldn't find 
> > > > > > > > mmos2\cwaudio.sys.
> > > > > > > > The installation had put the line in config.sys, but had not
made it good 
> > > > > > > > by
> > > > > > > > copying the file; I would like to know why that happened. I
did find a copy
> > > > > > > > in
> > > > > > > > the OS2/BOOT directory, so I copied it and rebooted yet again, 
but the 
> > > > > > > > system is
> > > > > > > > still quiet.
> > > > > > > > 
> > > > > > > > I do not think interrupts are the problem: RMVIEW /irq shows
that it has 
> > > > > > > > taken
> > > > > > > > 5 and 9, which is correct.
> > > > > > > > 
> > > > > > > > I don't think I failed to touch any of the bases. What might
be happening 
> > > > > > > > now?
> > > > > > > > 
> > > > > > > 
> > > > > > > When you do the re-install it should be in the following order.
> > > > > > > 
> > > > > > > 1) Re-install MMOS/2 - DO NOT choose a sound card and
> > > > > > > if one is selected remove it. (It will not detect the Tidalwave
128
> > > > > > > correctly). You can do this by pressing the button on selective
> > > > > > > install beside the Multimedia Device field.
> > > > > > > 
> > > > > > > 2) After MMOS/2 is re-installed, install the drivers for the
card.
> > > > > > > 
> > > > > > > 3) apply the appropriate fixpack (FP 12)
> > > > > > > 
> > > > > > > From your message (quoted above) it looks like you installed
> > > > > > > the sound card drivers, then re-installed MMOS/2.
> > > > > > 
> > > > > > No, I didn't do that. In order to have everything fresh in my
memory, I 
> > > > > > repeated the first part of the process just now. I deleted the
\MMOS2 
> > > > > > directory; as predicted by the Crystal docs, quite a number of
files would 
> > > > > > not allow themselves to be deleted; that is OK, according to the
docs. 
> > > > > > Then, in Selective Install (where the sound card still appeared as 
"Crystal
> > > > > > Audio CS-4232/36") I removed the driver from the _selected_ list,
and did 
> > > > > > "Next", so that the MM installation completed from the OS/2
distribution 
> > > > > > CDROM. I rebooted, and got two announcements that programs
belonging to the
> > > > > > "Video Part" could not be deleted. Finally, I started Selective
Install 
> > > > > > again, in order to inspect the result; I was not surprised (having 
been 
> > > > > > through this before) to see that the system still thinks a
"Crystal Audio 
> > > > > > CS-4232/36" card is installed.
> > > > > > 
> > > > > > I have left nothing out in the story; what did I do wrong? 
> > > > > > 
> > > > > 
> > > > > The "Selective Install" always probes for physically installed
> > > > > sound cards. It will always think the "Tidalwave 128" is a
> > > > > CS-4232/36 card.
> > > > > 
> > > > > The install of the drivers (after the delete and re-install of
MMOS/2)
> > > > > should be done using MINSTALL in the directory where you
> > > > > have unzipped the drivers from the Crystal web site.
> > > > > 
> > > > > This will install the correct drivers.
> > > > 
> > > > To test that, I continued the installation procedure (having already 
> > > > deleted MMOS2 and reinstalled the distribution Multimedia support). 
> > > > 
> > > > The manual says to install from the Multimedia Application Install
object, 
> > > > and that one can "also" install from the command line. These are in
fact 
> > > > the same thing, but in order to follow your suggestion precisely, I
did it 
> > > > this time from the command line, and installed from the file os2208wt, 

> > > > which I downloaded yesterday.
> > > > 
> > > > When the smoke had cleared away, I rebooted yet again, and opened
Selective
> > > > Install, in order to get the system's opinion about the sound card.
The 
> > > > system still thinks it has a "Crystal Audio CS-4232/36 PnP", as before
> > > > 
> > > > When the system was coming up during the reboot, there was an
announcement 
> > > > (which I had seen last time) that the file \MMOS2\CWAUDIO.SYS could
not be 
> > > > found. I already know from last time that there is indeed a copy of
the 
> > > > file in the \OS2\BOOT directory, and that copying it into the MMOS2 
> > > > directory doesn't help.
> > > > 
> > > > So no; apparently it doesn't install the correct drivers.
> > > > 
> > > 
> > > I have a Crystal Audio based card (8235 chip) and the driver
> > > for the chip installs with the following line
> > > 
> > > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
> > > 
> > > As far as I know the driver package should set up something
> > > like the above line (a BASEDEV) not a DEVICE statement.
> > > 
> > > What does your config.sys file line for installing the driver look
> > > like. I have one REM'med out in mine that looks like this
> > > 
> > > REM DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
> > > 
> > > This line came from allowing MMOS/2 to select the CS-4232/36 
> > > card. (I went through all this when I change from an AWE64 to
> > > the Crystal Audio card.
> > 
> > Here are the lines that seem to be related to the card (I take B. Saudi to 

> > be a prince in an Arabian royal family, but I could be wrong):
> > 
> 
> I think the next line should be REM'med
> > DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
> 
> The next three left alone
> > DEVICE=C:\MMOS2\CWVAUDIO.SYS BSAUD1$
> > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
> > DEVICE=C:\MMOS2\CWMPU401.SYS /O:ONLYONE /O:LONGNAME /O:MULTIIRQ /O:MULTIIO 

> > /O:16BITS /N:CWMPU1$
> 
> This one REM'med out
> > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2

That's what I did. It didn't help.
 
> > So it is placing one DEVICE statement and two BASEDEV statements for the 
> > card, none REMed out. I will delete the duplicate BASEDEV; I assume that 
> > the DEVICE statement should also go, or be REMed, and that the CWVAUDIO 
> > statement should be left alone. I'll try that, and report here _only_ if
it
> > does something good -- but I have little faith.
> > 
> > I am interested in your remark about allowing the installation to select 
> > the card. At no point in the installation have I ever been offered a
choice
> > of cards, or an opportunity to confirm the installation's choice. The 
> > downloaded file, os2208wt.zip is called out to be associated with the chip 

> > used on the card, among others, and I have assumed that all those chips 
> > want the same drivers.
> > 
> > It still seems strange to me that the installation doesn't put the 
> > CWAUDIO.SYS in the MMOS2 directory.
> > 
> 
> When they made it into a basedev, the boot process wll only
> load it from the root directory (\), (\OS2) or (\OS2\BOOT) as the
> loader is restricted on where it can look for BASEDEV drivers.

Then it was confused, wasn't it. It put it in \OS2\BOOT, where the BASEDEV 
could find it, but it also put a DEVICE line in CONFIG.SYS, which wanted to
see it in \MMOS2. Interesting. The installation process is clearly screwed 
up; but we knew that.
 
> He's actually not a member of the House of Saud, it stands
> for BusinesS AUDio (I think :-)

Shows how one's first thought is influenced by one's environment.

My impression is that, with your great help, we have exhausted the 
possibilities, haven't we? So I will wait a little while for the Crystal 
people to get their thumb out of their nether regions, and try to get some 
help from them. Failing that, the card goes back to the mail order house; I
am out a good piece of change for S&H and Customs Duties, and I will have 
learned a lesson.

Thanks again...

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: bts@iaehv.nl                                      19-Oct-99 01:42:14
  To: All                                               19-Oct-99 21:35:07
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: "Martin Bartelds" <bts@iaehv.nl>

Very nice, my problem does have attention ;-(

- Kicking off the repeated animations cleared my problem.
  See another reply.
- No localproxy
- No local DNS, although hosts file use
- MPTS WR8610/20, but problem happened also earlier *memory*
- Indeed only memory cache.

Is there a real solution ?

Zero Netscape cache is a workaround, but very unfriendly
in a 33k modem connection.

Tell me where to push, to find the offending thing
and I'll push ......


/Martin.


On Sat, 16 Oct 1999 19:16:23 GMT, Michael Warmuth wrote:

:>The problem are not the animations. You can get this behaviour on 
:>complex pages without animated GIFs.
:>
:>
:>Here is a description of the problem:
:>
:>When downloading a page with NS 4.04 or 4.61 all of a sudden CPU 
:>utilization goes to 100%. The CPU meter and the watch in WarpCenter 
:>stop. Netscape itself responds to user interaction absolutely normal 
:>(e.g. opening a menu or the preferences dialog) and the process 
:>indicator of NS works smoothly. In most cases, opening the preferences 
:>dialog and keeping it open until the pages is completely loaded brings 
:>down the CPU utilization to normal values. If you switch to another 
:>applications while this problem occurs there is a high chance that the 
:>system stalls completely with the need to reboot.
:>
:>This problem is very similar to the '100% CPU load while calculating 
:>complex tables' problem. The big difference is, that the latter is not 
:>a real bug - there is no system stability problem. While the table is 
:>rendered NS's interface is not very responsive (e.g. the status 
:>information stops and jumps a lot), and after completing the table the 
:>system reverts to a normal state.
:>
:>
:>The environment:
:>
:>Only under special circumstances the problem occurs. This is the 
:>reason why many people (and IBM) don't seem to be able to reproduce 
:>this. First you need a complex page. Then your system has to be 
:>configured like this:
:>
:>+ You use a proxy on the same machine (like WBI).
:>
:>+ You have a DNS running on the same computer (like BIND).
:>
:>+ You use a 32bit TCP/IP stack (e.g. TCP/IP 4.1 or MPTS WR8610 or 
:>WR8620).
:>
:>I am not quite sure if all of the above is required to run into the 
:>problem. Nor do I know if this happens if you use another proxy (like 
:>SQUID) or another nameserver.
:>
:>
:>The solution:
:>
:>If you use a local proxy there is a high chance that you have turned 
:>off the file cache within NS since this would be a second time caching 
:>beside what the proxy does. Most likely you have turned on the memory 
:>cache of NS so that pages visited in a session will be redisplayed 
:>faster (e.g. when using the back button). To cure the problem you now 
:>should do this:
:>
:>TURN OFF NETSCAPE'S MEMORY CACHE!!! (set it to 0)
:>
:>The drawback is, that animations will only run once. Configuring the 
:>file cache, so that it holds some amount of data (e.g. 1 to 2 MB) will 
:>bring back the animations.
:>
:>
:>I hope this clarifies the situation and solves a problem some of you 
:>encountered.
:>
:>Greetings
:>Michael
:>
:>-- 
:>Michael Warmuth                   Austria  - The place in the 
:>http://www.os2forum.or.at/        heart of Europe where no 
:>http://www.osiconsult.co.at/      kangaroos are hopping around
:>
:>
:>
:>
:>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: BTSoftware (1:109/42)

+----------------------------------------------------------------------------+

From: bts@iaehv.nl                                      19-Oct-99 01:48:28
  To: All                                               19-Oct-99 21:35:07
Subj: Re: Solved: NS 4.61 uses 100% CPU 

From: "Martin Bartelds" <bts@iaehv.nl>

Yep, Yep, Yep !!!!

Did somebody send this to IBM ??????


/Martin.


On 16 Oct 1999 22:24:01 GMT, Rich Walsh wrote:

:>On Sat, 16 Oct 1999 19:16:23, Michael Warmuth
<michael.warmuth@wu-wien.ac.at> wrote:
:>> > > In message <ogfvnruiay.fjiwnq0.pminews@martin> - "Martin Bartelds"
:>> > > <bts@iaehv.nl>Wed, 13 Oct 1999 00:04:38 +0200 (CDT) writes:
:>> > > :>
:>> > > :>A lot of sites do contain animations. Loading such a site
:>> > > :>with Netscape 4.61 gives a 100% CPU load and a stalled
:>> > > :>Netscape.
:>> > > :>
:>> > > :>Giving a "Stop animations" solves this problem, however
:>> > > :>the page loading also stops.
:>> [...]
:>> 
:>> The problem are not the animations. You can get this behaviour on 
:>> complex pages without animated GIFs.
:>> 
:>> Here is a description of the problem:
:>> 
:>> When downloading a page with NS 4.04 or 4.61 all of a sudden CPU 
:>> utilization goes to 100%. The CPU meter and the watch in WarpCenter 
:>> stop. Netscape itself responds to user interaction absolutely normal 
:>> (e.g. opening a menu or the preferences dialog) and the process 
:>> indicator of NS works smoothly.
:>> 
:>[extraneous factors snipped]
:>> 
:>> The solution:
:>> If you use a local proxy there is a high chance that you have turned 
:>> off the file cache within NS since this would be a second time caching 
:>> beside what the proxy does. Most likely you have turned on the memory 
:>> cache of NS so that pages visited in a session will be redisplayed 
:>> faster (e.g. when using the back button). To cure the problem you now 
:>> should do this:
:>> 
:>> TURN OFF NETSCAPE'S MEMORY CACHE!!! (set it to 0)
:>
:>By George, he's got it!!! (or pretty close).  I did a bunch of testing
:>that seems to confirm that the problem lies in the interaction between
:>the disk and memory caches.  If you have a memory cache but no disk cache,
:>you'll get 100% CPU usage.  Setting memory cache to zero _or_ reenabling
:>a nominal disk cache solves the problem.
:>
:>The other factors that Michael mentioned (which I snipped, i.e. a 32-bit
:>stack, a DNS running on your system) appear not to be relevant.  Use of
:>a proxy is only relevant to the extent that its use is what would prompt
:>you to set disk caching to zero.
:>
:>FWIW, I wanted to retain my 2mb memory cache, so I set the disk cache
:>at 64kb.  When I had it at 1kb, there was nonstop disk activity as
:>NS kept filling and emptying it.  You'll probably want to set yours
:>to the size of a typical web page.
:>
:>Thanks, Michael!
:>
:>
:>   == == almost usable email address:  rlwalshATpacket.net == ==
:>___________________________________________________________________
:>
:>                |             - DragText v3.1 -
:>Rich Walsh      |  A Distinctly Different Desktop Enhancement
:>Ft Myers, FL    |  New!  Pickup & Drop for text, and more...
:>                |  http://www.usacomputers.net/personal/rlwalsh/
:>___________________________________________________________________
:>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: BTSoftware (1:109/42)

+----------------------------------------------------------------------------+

From: cfrank@rumms.uni-mannheim.de                      19-Oct-99 22:06:29
  To: All                                               19-Oct-99 21:35:08
Subj: How to scan for bad sectors on JFS

From: cfrank@rumms.uni-mannheim.de (Carsten Frank)

I have a problem with my little server. I set up a JFS partition and 
format it. But he has bad sectors on it. Now if I read the specific 
file with the specific bad sectors the server try to read it every 
time and then traps with 000e in device driver.

Now how can I scan for bad sectors and mark this as bad thanks

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: forgitaboutit@fake.com                            18-Oct-99 20:32:16
  To: All                                               19-Oct-99 23:35:28
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: David H. McCoy <forgitaboutit@fake.com>

In article <HwoLOCMdTH0RwcVwhBdjBKmL9pGp@4ax.com>, 
xyxmadxyx@xyxziplinkxyx.xyxnetxyx says...
>On Sun, 17 Oct 1999 21:15:43 -0400, David H. McCoy
><forgitaboutit@fake.com> wrote:
>
>>>here's another improvement.  mark some text in the body of a message 
>>>and click the right mouse button.  you're now able to 'copy' it to the
>>>clipboard whereas in the past (and unlike the win9x version) that 
>>>wasn't possible.
>
>>Hello, but I've got the Windows version and you can right-click and copy
text. 
>>You get a popup menu and one of the options is 'Copy'.
>
>>In you cse, user error may the problem.
>
>you obviously didn't get the point.  let me try again with smaller
>words.
>
>using the os/2 version until 2.1 there wasn't any 'copy' option using
>the right mouse button.  that was UNLIKE the win9x version where there
>always was a 'copy' option using the right mouse button.  get it now? 
>
>
>

My bad, fellow. While you are using smaller words, why not work on your 
capitalization?

Get it now?
^

-- 
---------------------------------------
David H. McCoy
dmccoy@EXTRACT_THIS_mnsinc.com
---------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: OminorTech (1:109/42)

+----------------------------------------------------------------------------+

From: peter@seagoon.newcastle.edu.au                    19-Oct-99 00:01:17
  To: All                                               19-Oct-99 23:35:28
Subj: Re: PMMail, Attachments, and application calling

From: peter@seagoon.newcastle.edu.au (Peter Moylan)

Mooo <zayne@omen.com.au> wrote:
>I have the same problem.  Have yet to be able to work it out :(  My
>associations are correct, because if I drag the attachment to the
>desktop, then double click on it, it opens with the application I
>want.
>
>John M Price PhD <jmprice@calweb.com> wrote:
>
>>I have a strange problem with attachments.  Some work, others don't, and
>>I can't see why.  For instance,  I have one with a .txt extension,
>>properly opened by E.EXE, as noted in the settings.  However, I can't
>>open the attachment, and I get a WinOS2 error message (!) about invalid
>>path.

Check your PMMail MIME associations for the category "spreadsheet files".
Change the "application/octet-stream" to "application/excel", or
something similar.

If this doesn't work, do a "view full message" to find out what MIME
type is given for the .txt file, and then look through your MIME type
settings in PMMail to discover which category is hijacking that 
particular type.

-- 
Peter Moylan                                         peter@ee.newcastle.edu.au
See http://eepjm.newcastle.edu.au for OS/2 information and software

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: whonea@codenet.net                                18-Oct-99 18:32:25
  To: All                                               19-Oct-99 23:35:28
Subj: Re: LoadDskF.exe & IBMWorks CSD 2.1

From: whonea@codenet.net (Will Honea)

On Sun, 17 Oct 1999 21:24:28, j.welton@mailcity.com wrote:

Unzip the images, then use DSKXTRCT.EXE (found in QF11 from Hobbes) to
extract the disks to the harddrive.  Apply the fix from there.  As for
currency,  someone else needs to jump in.

> Even though I have all the other OS/2 suites at my disposal, I'm
> fascinated with IBMWorks.  It works very well on my system.  I looked
> around to see if any updates were available and I found:
> 
> 1. CSD 2.1, works-csd.zip, ~8 Meg, dated 6/18/96
> 
> 2. Add RFT text filter (16 bit) to IBM Works - README readrft.txt, ~1k,
>    11/1/95
> 
> 3. Add RFT text filter (16 bit) to IBM Works, wksrft.zip, ~86K, 11/1/95
> 
> 4. Spreadsheet rounding problems Fix, wksfix1.zip, ~409K, 12/2/95
> 
> My current Warp 4 version of IBMWorks appears to be newer then the
> files released above.  Example:
> 
>  8-12-96   3:12a     15593           0  fpwobj.dll
>  8-12-96   3:12a     20687       28128  ibmworks.exe
>  8-12-96   3:12a     25385          61  ien30pxx.dll
>  8-12-96   3:15a     44993          61  about.exe
>  8-12-96   3:21a     52552          61  fpwmon.exe
>  8-12-96   3:21a    385516          61  fpwpim.exe
>  8-12-96   3:22a    109080        2736  pimrl.dll
>  8-12-96   3:23a    205444           0  fpwpim.hlp
>  8-25-96   1:05p    392137          61  ien30pwp.dll
>       112 file(s)    8384313 bytes used
>                    1854432 K bytes free
> 
> So my question may not be applicable.  Unzipping the CSD file above I
> find:
> 
>  5-21-96   9:59a   1884160           0  WKS21_1.DSK
>  5-21-96  10:03a   1884160           0  WKS21_2.DSK
>  5-21-96  10:04a   1884160           0  WKS21_3.DSK
>  5-21-96  10:05a   1884160           0  WKS21_4.DSK
>  5-21-96  10:07a   1884160           0  WKS21_5.DSK
> 
> And when I issue the following command using the with the latest
> LoadDskF.exe
> 
> [F:\work]LoadDskF F:\work\WKS21_1.DSK A: /f
> 
> I get the error message:
> 
> Unsupported disk type
> 
> I am trying to create a set of floppies on standard 1.44kb disks.  When
> I look at the size of the DSK files above I see they are larger than
> 1.44kb and assume the system is telling me my floppy is insufficient to
> support the volume needed.  I tried issuing the same command to have
> the data created on another (fixed) partition only to receive an error
> that the program is unable to write to a fixed disk.
> 
> So how does one get these DSK files over to floppies?
> 
> And last but not least, you'll see the unzipped DSK files are dated
> 5/1/96 whereas my IBMWorks files are dated 8/12/96 so I'm assuming my
> current Wapr 4 IBMWorks is updated with all of the files found in the
> 5/1/96 package.  Am I assuming correctly?
> 
> 
> Sent via Deja.com http://www.deja.com/
> Before you buy.


Will Honea <whonea@codenet.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: franks@owt.com                                    18-Oct-99 17:07:20
  To: All                                               19-Oct-99 23:35:28
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: "frank schmittroth" <franks@owt.com>

On 18 Oct 1999 20:55:13 GMT, Annie K. wrote:

> It's redundant. How many ways do you need to copy to the clipboard? 
>There's a copy function under the edit menu, I usually hit Ctrl-Ins, 
>but if I'm mousing I swipe, hold the LMB down, and tap the RMB. Plus, 
>the damn thing's taken the place of 'Explore URL.' 

I use 'Explore URL' all the time.  Is that really gone?
Frank.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://extra.newsguy.com (1:109/42)

+----------------------------------------------------------------------------+

From: hjmurray@home.com                                 19-Oct-99 01:04:04
  To: All                                               19-Oct-99 23:35:28
Subj: Re: Partition Magic 4.0 Bug, I believe

From: "Hal Murray" <hjmurray@home.com>

 > When building partition tables, OS/2 requires strict adherence to
its 
 > published rules.  Partition Magic takes shortcuts.  It can change
your
 > partition table so that OS/2 can't read it accurately

Ed

Had the same thing happen to me and went back to using PQ Magict.exe
3.05.03.

Their techs told me that PM 4 changes the file type for the extended
partition to 05. I don't recall what type it was before using PM 4.

Hal Murray
Calgary, AB

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     19-Oct-99 02:22:25
  To: All                                               19-Oct-99 23:36:00
Subj: Re: Netscape cache messing up

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

lifedata@xxvol.com wrote:

> Netscape 4.61:  The cache has started messing up in general just recently. 
I've
> cleared out both memory cache and disk cache, turned them off etc., but I
still
> keep seeing web pages re-download over and over.

Try turning the caching back ON.

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      18-Oct-99 23:45:00
  To: All                                               19-Oct-99 23:36:01
Subj: Re: can't download Java 1.1.8 stuff from service...

From: nospam@savebandwidth.invalid       (John Thompson)

In <380B29D5.12B4B770@interpath.com>, Joe Heafner <heafnerj@interpath.com>
writes:

>After nearly 12 hours of trying, I can't download the Java 1.1.8 files
>from the service ftp site. The downloads always hang or terminate
>prematurely. This happens both with ftp browser and NS 4.04. The "time
>remaining" counter just happily counts off towards infinity. 

Use "wget" instead.  Wget will keep trying until it connects and 
keep reconnecting until it gets the whole thing.

-John (John.Thompson@attglobal.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          19-Oct-99 03:15:15
  To: All                                               19-Oct-99 23:36:01
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: piquant00@uswestmail.net (Annie K.)

On Tue, 19 Oct 1999 01:07:40, "frank schmittroth" <franks@owt.com> 
wrote:

:Plus, 
:>the damn thing's taken the place of 'Explore URL.' 
: 
:I use 'Explore URL' all the time.  Is that really gone?

 No, but you have to do a bit of extra mousing to get to it.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          19-Oct-99 03:24:23
  To: All                                               19-Oct-99 23:36:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: piquant00@uswestmail.net (Annie K.)

On Tue, 19 Oct 1999 00:10:41, "Gordon A. Stripling" 
<gordon.nospam@gadsnet.com> wrote:

:>the damn thing's taken the place of 'Explore URL.' I think someone 
:>who's never used OS/2 stuck that 'copy' in there.
: 
:Not completely.  I just swiped a (or is it an) URL and it still had "Explore
:URL", but it was ABOVE the "copy". 

 Yes. I guess I'm just cranky that 'Explore URL' isn't the default 
action.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: heafnerj@interpath.com                            18-Oct-99 23:50:12
  To: All                                               19-Oct-99 23:36:02
Subj: Re: can't download Java 1.1.8 stuff from service...

From: Joe Heafner <heafnerj@interpath.com>

> >After nearly 12 hours of trying, I can't download the Java 1.1.8 files
> >from the service ftp site. The downloads always hang or terminate
> >prematurely. This happens both with ftp browser and NS 4.04. The "time
> >remaining" counter just happily counts off towards infinity.
> 
> Use "wget" instead.  Wget will keep trying until it connects and
> keep reconnecting until it gets the whole thing.
> 
I finally got a clean download of everything. It took all day
(literally), but I got it.


-- 

                        -- Joe Heafner

Joe Heafner, Astronomy and Physics Instructor. Work:(828)327-7000 x4246
my surname with my first initial at interpath dot com
http://home.interpath.com/heafnerj/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Interpath Communications, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 19-Oct-99 04:37:28
  To: All                                               19-Oct-99 23:36:03
Subj: Re: Netscape cache messing up

From: hamei@pacbell.net

In <380BD554.CD6FD0B5@ausNOSPAMtin.rr.com>, "Jeffrey S. Kobal"
<murdoctor@ausNOSPAMtin.rr.com> writes:
>
>lifedata@xxvol.com wrote:
>
>> Netscape 4.61:  The cache has started messing up in general just recently.  
I've
>> cleared out both memory cache and disk cache, turned them off etc., but I
still
>> keep seeing web pages re-download over and over.
>
>Try turning the caching back ON.
>

smartass :-)

>Jeffrey S. Kobal
>IBM Corporation
>
>

--
Hrad ngravvrd



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: nemo@union.edu                                    19-Oct-99 01:24:02
  To: All                                               19-Oct-99 23:36:04
Subj: Re: no audio from cdplayer

From: nemo@union.edu

In <7ug5p7$61b$1@nnrp1.deja.com>, on 10/18/99 
   at 10:08 PM, hunters@thunder.indstate.edu said:


>> Just need a fast tip where to look for trouble-shooting. Couldn't
>> find anything on deja.com.

>Have you checked the CD player volume? (ie: click on the little "speaker"
>and make sure it's turned up.)

Yeah, volume is ok.

>Have you tried using the Digital Transfer mode?

No. Where do I set this?

But I'm slowly resigning myself to having to reinstall multimedia if I
want to get this facility back.

F.

-----------------------------------------------------------
      Felmon John Davis		
     davisf@union.edu	|  davisf@capital.net     
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack 
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     19-Oct-99 06:27:00
  To: All                                               19-Oct-99 23:36:04
Subj: Re: Netscape cache messing up

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

hamei@pacbell.net wrote:

> >Try turning the caching back ON.
>
> smartass :-)

Well, I can't deny there being some level of pretense in my
response, but the facts have a clear implication...

Recent actions taken by Jim L:
Cleared memory and disk cache; set both to 0 (disabled)

Expected results of latter action:
(1) Web pages will not be cached, thereby requiring the
browser to download them from the server every time.
(2) Any "temporary" files stored in the cache will be
removed the next time new files are retrieved (e.g.
loading a web page).

Symptoms reported by Jim L:
(1) "web pages re-downloading over and over"
(2) Won't continue download after abort; restarts again

There appears to be a direct correlation, which led me
to my suggestion that he re-enable the caching.  :)

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: say@sfu.ca                                        19-Oct-99 07:07:05
  To: All                                               19-Oct-99 23:36:05
Subj: Re: Xywrite and OS/2

From: Daniel Say <say@sfu.ca>

In comp.os.os2.misc Edward Germain <egermain@mediaone.net> wrote:
: On Mon, 4 Oct 1999 08:33:03, Daniel Say <say@sfu.ca> wrote:

:> In comp.os.os2.apps Esther Schindler <esther@bitranch.com> wrote:
:> : On Sun, 3 Oct 1999 02:49:38, Daniel Say <say@sfu.ca> wrote:
:> : |         and some of us find XYwrite very fast.  It's still
:> : |         sold by The Technology Group in Baltimore.
:> 
: Amazing.  It was the best of the best, but the sad, sad tale when it 
: was sold to IBM and then wrecked in development (the product was to be
: called "Signature"--I still have an alpha version around somewhere) 
: and then abandoned by IBM--well it's too sad to be retold.

: Thank you for the news that to some degree it is still alive!
: --Ed Germain
---------------------
	Ah yes, Signature.  What a terrible non-improvement that
	was.
	I'm somewhat surprised on the Xywrite mailing list by
	the number of people in the active side who use XY
	with OS/2.

	There's an upgrade special offer for the Notabene
	version this month.
	Visit
	 www.notabene.com/xywrite
	for details.
					Daniel Say

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Simon Fraser University (1:109/42)

+----------------------------------------------------------------------------+

From: casfaq@locutus.ofB.ORG                            16-Oct-99 00:00:00
  To: All                                               20-Oct-99 03:24:07
Subj: FAQ: comp.apps.spreadsheets: pointer

From: casfaq@locutus.ofB.ORG

Archive-name: spreadsheets/pointer
Comp-apps-spreadsheets-archive-name: pointer
Frequency: biweekly
Frequency-Comment: monthly to financial/spreadsheet groups
Frequency-Comment: monthly to machine-specific .apps/.software groups
Last-modified: 1998-Jul-12
FAQ-Last-modified: 1999-Oct-02

comp.apps.spreadsheets     == cas
Frequently Asked Questions == FAQ

cas is about spreadsheets for ALL computer platforms.

The comp.apps.spreadsheets FAQ list can be obtained via all
news.answers access methods:

quoting the news.answers FAQ:

``
		    Where are *.answers archived?

  All of the *.answers newsgroups are archived in the periodic posting
archive on rtfm.mit.edu [18.181.0.24].  Postings are located in the
anonymous ftp directories /pub/usenet/alt.answers,
/pub/usenet/comp.answers, etc., and are archived by "Archive-name".
Other subdirectories of /pub/usenet contain periodic postings that may
not appear in *.answers (as well as most of the *.answers postings),
saved by Subject line rather than by Archive-name.

  If you do not have anonymous ftp access, you can access the archives
by mail server as well.  Send an E-mail message to
mail-server@rtfm.mit.edu with "help" and "index" in the body on
separate lines for more information.
''

The FAQ list for comp.apps.spreadsheets can be found on the Internet:
  <ftp://rtfm.mit.edu/pub/usenet/comp.apps.spreadsheets/faq>
  <http://www.faqs.org/faqs/spreadsheets/faq/>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Private System, Edmonton, AB, Canada (1:109/42)

+----------------------------------------------------------------------------+

From: cpeebles@_nospam_direct.ca                        19-Oct-99 18:36:13
  To: All                                               20-Oct-99 03:24:07
Subj: TrueSpectra help

From: Clinton <cpeebles@_nospam_direct.ca>

Maybe this is a dumb question, but I have downloaded TrueSpectra
Photo>Graphics and installed it, but where, or how, do I enter the Key
to unlock it?

-- 
Kill the MAI
http://www.canadianactionparty.ca/e/mai.html
---
Remove _nospam_ to reply

Clinton Peebles  VE7KNL  DN19ie
Salmo, B.C. Canada
E-Mail: cpeebles@direct.ca

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           20-Oct-99 02:38:13
  To: All                                               20-Oct-99 03:24:08
Subj: Re: TrueSpectra help

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Wed, 20 Oct 1999 01:36:27, Clinton <cpeebles@_nospam_direct.ca> 
wrote:

> Maybe this is a dumb question, but I have downloaded TrueSpectra
> Photo>Graphics and installed it, but where, or how, do I enter the Key
> to unlock it?
> 
> -- 

Right Click on the blank drawing area
Click on About
Click on "Unlock Now"

Enter your name and the registration key

URL http://www.truespectra.com/support.html

The registration keys appear on this page.

Lorne Sunley


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     20-Oct-99 03:30:08
  To: All                                               20-Oct-99 03:24:08
Subj: Re: Netscape cache messing up

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

lifedata@xxvol.com wrote:

> Sooooooooooo, if there is something in addition to putting values in the
cache
> windows to turn them on, what is it?
>
> Lacking an answer of substance there, what else can I do?

Have you verified that when you are surfing around, files
are being saved in your cache directory?

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     20-Oct-99 03:32:20
  To: All                                               20-Oct-99 03:24:08
Subj: Re: Netscape cache messing up

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

Tom wrote:

> Also loading or
> display of files will stop while deleting cache files. This takes some
> time status bay will say "deleting 1645 files cache" or something
> similar. Could that not be done in the background?

It probably would have been better in the background;
that's not how Netscape designed it.  That's a good
suggestion to take forward for a future update, if it is
feasible to move that work to another thread.

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: victori@exis.net                                  20-Oct-99 00:21:05
  To: All                                               20-Oct-99 03:24:08
Subj: Re: SYS3175 at startup of NC 4.61

From: victori@exis.net

On Mon, 18 Oct 1999 07:26:35, "Jeffrey S. Kobal" 
<murdoctor@ausNOSPAMtin.rr.com> wrote:

> 
> victori@exis.net wrote:
> 
> > I have installed NC 4.61 with no problems.  When I start the NC 4.61 I
> > get SYS3175 from OS/2.  This only occurs on one OS/2 machine and I
> > have not been able to resolve it.  Any ideas?
> 
> Could be a corrupted certification file (pcert7.db) in your user
> directory.  If the file is 0 bytes, just delete it and it will be
> recreated; otherwise, try renaming it temporarily to see if the
> problem goes away.
> 
> If that isn't the problem, you'll need to post the contents of
> the SYS3175 information from your POPUPLOG.OS2 file.
> 
> Jeffrey S. Kobal
> IBM Corporation

The pcert7.db file in my user directory was 0 bytes.  After I deleted 
it NC 4.61 worked fine.  Thanks for the info.  If you don't mind a 
question, What is the purpose/function ofpcert7.db file?

Thanks,
----Pat Victorio.
victori@exis.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Exis Net Inc (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     20-Oct-99 04:30:25
  To: All                                               20-Oct-99 03:24:08
Subj: Re: SYS3175 at startup of NC 4.61

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

victori@exis.net wrote:

> The pcert7.db file in my user directory was 0 bytes.  After I deleted
> it NC 4.61 worked fine.  Thanks for the info.  If you don't mind a
> question, What is the purpose/function ofpcert7.db file?

It's the database of "certificates" that you've set up for
your browser; it's a security thing, and most people don't
use them for normal use of the browser.  The 0-byte file
signified that the database got corrupted somehow, and
deleting it caused a new (empty) database to be created.

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          20-Oct-99 13:05:10
  To: All                                               20-Oct-99 03:24:08
Subj: Re: TrueSpectra help

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

Easy peasy. Right click on the the workspace (or press F12)
select "About" then "Unlock now" Enter your name and code
number and click on "Unlock"

Cheers

Wayne


On Tue, 19 Oct 1999 18:36:27 -0700, Clinton wrote:

:>Maybe this is a dumb question, but I have downloaded TrueSpectra
:>Photo>Graphics and installed it, but where, or how, do I enter the Key
:>to unlock it?
:>
:>-- 
:>Kill the MAI
:>http://www.canadianactionparty.ca/e/mai.html
:>---
:>Remove _nospam_ to reply
:>
:>Clinton Peebles  VE7KNL  DN19ie
:>Salmo, B.C. Canada
:>E-Mail: cpeebles@direct.ca

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
  Running on OS/2 Warp 4 (UK)  + FixPak 9
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: dink@dont.spam.me                                 20-Oct-99 03:47:10
  To: All                                               20-Oct-99 05:19:02
Subj: Re: Warp4-and-HPFS386

From: "dinkmeister" <dink@dont.spam.me>

On Tue, 19 Oct 1999 21:00:46 +0100, Peter Stahl wrote:

:It was very easy to install, just unzip the files and change
:a couple of lines in CONFIG.SYS.
:But HPFS386 couldn't use standard HPFS ACLs so I was forced to make
:new ones.
:
:I thought it would be equal easy to change back to standard
:HPFS, just change CONFIG.SYS back to old contents, but HPFS
:will not change HPFS386's ACLs.

re-install hpfs386 then run this command to strip the hpfs386
acl's: PREPACL /P /B:acls.txt /D:C:
acls.txt is the file where the acl's get stored, C: is the drive letter
to remove the acls from.  now you can safely return to hpfs.ifs


- dink ( http://dink.org )





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none (1:109/42)

+----------------------------------------------------------------------------+

From: swanee@pillarsoft.net                             20-Oct-99 01:32:27
  To: All                                               20-Oct-99 05:19:02
Subj: Re: Enhanced E

From: Wayne Swanson <swanee@pillarsoft.net>

Rade Popovic wrote:
> 
> Hi
> 
> One quick question. Enhanced E beeps every time I start it. Is it
> normal and how can I make it stop (it is annoying)?
> And also help doesn't work. I can't evan see it when typing viewhelp
> eee.hlp; it says help is not available at this time; hyperview can't
> open it either.

Hi Rade,

John Price dropped me a line about your problem when I got home from
WarpStock. It appears to be the same situation that he had.

If the help file is corrupted, it will beep when you start up and the
help will not work. I did download the archive from our website to check
it and it did work for me but somehow it may not have gotten to you in
one piece. Like John said, I fired a copy off to him and would be happy
to email you another copy of it if the one from our website is not
working for you. Just let me know if you still need it. My address is
below.

Your other note about TrueSpectra?

>Maybe this question was asked before, but as I don't know the solution
>of the problem I will ask it.
>I am using Warp3 + FP42 + GRADD 0.80 + VIRGE DX + Photo>Graphics and
>this combination gives me wierd pointer. I have black square with white
>arrow in it for pointer, and it looks really ugly. Is there any way of
>heaving nice little arrow for pointer (as it should be). Of course it
>happens only in PG.

Same thing here with the Gradd drivers and an S3 ViRGE. Hopefully this
will be addressed in the upcoming versions of Gradd but until then I am
keeping Gradd installed. It's a small tradoff for the increased speed of
Gradd over the native ViRGE drivers.


Wayne Swanson
------------------------------------------------------------
email: swanee@pillarsoft.net
PillarSoft: http://www.pillarsoft.net
Developers of: WarpZip, DeskTop Backup (DTB), SFX Installer
               ShowTime/2 and the Enhanced E Editors
Vice President: VOICE (Virtual OS/2 International Consumer Education)
VOICE: http://www.os2voice.org
------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PillarSoft (1:109/42)

+----------------------------------------------------------------------------+

From: nemo@union.edu                                    20-Oct-99 02:28:08
  To: All                                               20-Oct-99 05:19:02
Subj: Re: no audio from cdplayer - success!

From: nemo@union.edu

In <380c36b1$1$vina$mr2ice@news.msu.ru>, on 10/19/99 
   at 01:02 PM, "Ivan Adzhubei" <ivan@protein.bio.msu.su> said:


>>I sent this message to comp.os.os2.misc and have gotten a couple of
>>helpful replies. One was to reinstall Multimedia which I may end up
>>doing, but I'm hoping for another solution before that. (I should
>>install FP12 anyway, I guess.) It occurred to me today that the
>>cdplayer _used_ to work a couple of weeks ago. I can't think of what I
>>may have done to change the system since I've been very conservative
>>(that is, no time for 'playing').

>Before trying a complete reinstall of MMOS2, why not to try reinstalling
>(upgrading?) just the drivers for your soundcard. BTW, which one you
>have? Drivers for Crystal-based cards can be easily reinstalled on top of
>the current version. This is not true for most other cards, in which case
>a complete deinstall/reinstall of OS/2 Multimedia may be necessary.

This was _so_ obvious and _so_ much the first thing to try, it's almost
_brilliant_ of you to mention it! 

I must have installed OS/2 (new system) and installed the new drivers, had
sound, was content and forgot about it. But then probably didn't check
after installing FP10 whether I had CD sound so I didn't notice until now.
(I don't play much with stuff like that on this machine.)

You reminded me there are the newer drivers... - I'm now listening to a
Telemann fantasia off the cdplayer now.

I kind of consider mmedia misfunctions a bit like the proverbial 'canary
in the mine', I fear they can point to deeper systemic problems.

Thanks for your help.

F.

-----------------------------------------------------------
      Felmon John Davis		
     davisf@union.edu	|  davisf@capital.net     
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack 
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: news@fenrir.demon.co.uk                           20-Oct-99 08:20:22
  To: All                                               20-Oct-99 05:19:02
Subj: Re: Installing a Crystal "TidalWave128" soundcard in Warp4/FP10

From: "Brian Morrison" <news@fenrir.demon.co.uk>

On Tue, 19 Oct 1999 22:08:51 GMT, Stan Goodman wrote:

>> I think the next line should be REM'med
>> > DEVICE=C:\MMOS2\CWAUDIO.SYS /N:BSAUD1$ /L:8
>> 
>> The next three left alone
>> > DEVICE=C:\MMOS2\CWVAUDIO.SYS BSAUD1$
>> > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
>> > DEVICE=C:\MMOS2\CWMPU401.SYS /O:ONLYONE /O:LONGNAME /O:MULTIIRQ
/O:MULTIIO 
>> > /O:16BITS /N:CWMPU1$
>> 
>> This one REM'med out
>> > BASEDEV=CWAUDIO.SYS /N:BSAUD1$ /X1:100 /X2:100 /LCAPT:X1X2
>
>That's what I did. It didn't help.
> 
>> > So it is placing one DEVICE statement and two BASEDEV statements for the 
>> > card, none REMed out. I will delete the duplicate BASEDEV; I assume that 
>> > the DEVICE statement should also go, or be REMed, and that the CWVAUDIO 
>> > statement should be left alone. I'll try that, and report here _only_ if
it
>> > does something good -- but I have little faith.
>> > 
>> > I am interested in your remark about allowing the installation to select 
>> > the card. At no point in the installation have I ever been offered a
choice
>> > of cards, or an opportunity to confirm the installation's choice. The 
>> > downloaded file, os2208wt.zip is called out to be associated with the
chip 
>> > used on the card, among others, and I have assumed that all those chips 
>> > want the same drivers.
>> > 
>> > It still seems strange to me that the installation doesn't put the 
>> > CWAUDIO.SYS in the MMOS2 directory.
>> > 
>> 
>> When they made it into a basedev, the boot process wll only
>> load it from the root directory (\), (\OS2) or (\OS2\BOOT) as the
>> loader is restricted on where it can look for BASEDEV drivers.
>
>Then it was confused, wasn't it. It put it in \OS2\BOOT, where the BASEDEV 
>could find it, but it also put a DEVICE line in CONFIG.SYS, which wanted to
>see it in \MMOS2. Interesting. The installation process is clearly screwed 
>up; but we knew that.
> 

Stan, if you are using the v2.08 ISA drivers, I suspect that you won't
get it to work. Try the v2.07 drivers that I sent you and see if it
works. I would recommend that you simply copy the relevant files to
where they should be (cwaudio.sys to \os2\boot, others to \mmos2 I
think) and reboot. If I substitute the 2.08 files for my 2.07 variety,
I get no sound at all despite the driver statements being totally
unchanged.

Some time ago, there was a VOICE speakup with someone from Crystal who
writes the drivers. I forget his email address, but it was something
like monvanto@crystal.com, I know his first name is Joe. You could
search for the VOICE transcipts and see what was said. He did mention
the v2.08 driver in there, it was put on the web site some time later.


-- 
Brian Morrison                                       news@fenrir.demon.co.uk
               to reply, change address from 'news' to 'bdm'
 ...Grim faced, cold as fishwife's fingers, he snatched from the wall
 the sickle-sharp boar tusks he used for defacing Readers' Digest....


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Fool and Bladder Face-Jumping Team (1:109/42)

+----------------------------------------------------------------------------+

From: Johannes.Hromadka@siemens.at                      20-Oct-99 10:34:28
  To: All                                               20-Oct-99 10:29:02
Subj: Re: thumbnail maker?

From: Johannes Hromadka <Johannes.Hromadka@siemens.at>

Brian Christie wrote:
> 
> Does anyone know of a good graphics program to create thumbnails for use on
a
> web page?  The problem I have is that I want to catalogue pictures and I

I wrote a small REXX script for IMPOS2

/****************************************************************************/
/*                                                                         
*/
/* Impos/2
REXX                                                             */
/*                                                                         
*/
/*                                                                         
*/
/* resize all jpg files to x
130                                            */
/*                                                                         
*/
/*                                                                         
*/
/*                                                                         
*/
/* Copyright (C) Hannes Hromadka,
1999-02-02                                */
/*                                                                         
*/
/****************************************************************************/

/* check whether RxFuncs are loaded, if not, load them */
if RxFuncQuery('SysLoadFuncs') 
then do 
   /* load the load-function */
   call RxFuncAdd 'SysLoadFuncs', 'RexxUtil', 'SysLoadFuncs'
   /* load the Sys* utilities */
   call SysLoadFuncs
end

Rc = RxFuncAdd("ImgInitiate", "IMPREXX", "ImgInitiate")
call SysSleep 2
Rc = ImgInitiate()
if Rc <> 0 then do
    Resp = "error:  Fehler bei der Initialisierung rc="||Rc
    call tell
    return (1)
end

parse ARG useDir netb_lsn

/* Search all bmp files in directory */

if useDir <>'' then do
   curDir=DIRECTORY()
   newDir=DIRECTORY(useDir)
   if newDir <> useDir then do
      Resp = 'error:      cannot change to 'useDir
      call tell
      return (1)
   end  /* Do */
end  /* Do */

rc=SysFileTree('*.jpg',bilder,'F')
Resp = 'ok:      found '||bilder.0||' images to convert'
call tell

DO i = 1 TO bilder.0
        say bilder.i
end
pause
DO i = 1 TO bilder.0
   fromBildF = WORD(bilder.i,5)       /* full filename */
   fromBild = SUBSTR(FromBildF,LASTPOS('\',FromBildF)+1)
   toBild =  SUBSTR(FromBildF,1,LASTPOS('\',FromBildF)) || 'Thumbs\' ||
fromBild
   say fromBild ' --> ' toBild
   Resp = 'ok:       convert '||fromBild
   call tell
   Resp = 'ok:       to      ' || toBild
   call tell

   /* load, and  display */
   rc = ImgLoadImage(fromBildF,TRUE)
   Resp = 'ok:        image loaded'
   call tell
   /* resize to x = 130 */
   oldX = ImgQueryImageInfo(0, 1)
   oldY = ImgQueryImageInfo(0, 2)

   numeric DIGITS 2
   newX=130
   newY=TRUNC(oldY*130/oldX)
 
   Rc = ImgResizeImage(0, 1, newX, newY, TRUE)      /* Skalieren mit
Zwischenwerten */
 
   /* save as JPG */
   say toBild

   rc = ImgSaveImage(0, toBild, "JPG", "JPEG",TRUE)
   Resp = 'ok:        image saved.'
   call tell
   rc = ImgCloseImage(0)
     
end /* do */

call DIRECTORY(curDir)
call ImgTerminate     


Rc = RxFuncDrop("ImgInitiate")

return(0)

tell : procedure  expose Resp netb_lsn
/*************************************************************/
/*                                                           */
/*   Func Name   : tell                                      */
/*   purpose     : writes the given string to STDOUT and to  */
/*                 netbios if specified                      */
/*                                                           */
/*                                                           */
/*************************************************************/
   say Resp
   if netb_lsn <>'' then do

      /* Add this following line to all NETBIOS execs to insure the
function is registered */
      if rxfuncquery('netbios') then call rxfuncadd
'netbios','REXXNETB','NETBIOSSRV'

      /* Try to send Resp to client */
      rcn= netbios('Send',0,netb_lsn,Resp)
   end  /* Do */

   return

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Siemens AG Austria; PSE TN SBS 41 (1:109/42)

+----------------------------------------------------------------------------+

From: Johannes.Hromadka@siemens.at                      20-Oct-99 10:47:01
  To: All                                               20-Oct-99 10:29:02
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: Johannes Hromadka <Johannes.Hromadka@siemens.at>

Doug Darrow wrote:
 
> The press releases I've seen didn't say anything about _development_
> being taken over; just publishing and support. I think BoB and Icon are

See: http://www.blueprintsoftwareworks.com/ubb/Forum1/HTML/000001.html


	Hannes

These are the major changes in the Blueprint Software Works 2.1 version.

                   OS/2 Version
                   ------------
                   -Fixed a spelling error on a menu
                   -Fixed LDAP support to allow a search root

                   -Fixed a HUGE bug in vCard support that wouldn't QP
encode stuff properly

                   -Fixed a bug in PMMSend with respect to KOI8-R MIME
headers
                   -Fixed a bug in PMMSend with respect to encoding
outgoing messages
                   -Fixed a hotkey error on the popup folder menu
                   -Fixed a crash when printing messages with *really*
long lines

                   -Added a filter option "Save All Attachments"...You
select this and
                   specify a directory and all attachments will be saved
there.

                   -Fixed some problems with decoding wierd header lines
                   -Fixed a bug that would cause a message to have an
incorrect body

                   -Changed the behavior of opening a body in the
outbox...when doing
                   this, PMMail now defaults the message to NO
SIG...this removes the
                   double sig problem

                   -Fixed a bug where the preview pane would not
properly report an
                   error when a file was not found

                   -Fixed a bug with parsing the TZ environment
variable, this also
                   fixed correct determination of DST for southern
hemisphere countries

                   -Fixed a bug that caused high prio messages to never
be marked as
                   read when using the preview pane's "mark as read"
option

                   -Added some RMB cut, copy, and paste options

                   -Fixed a bug with searching...sometimes the "search
subfolder" option
                   didn't work

                   -Fixed a bug where moving addresses from one book to
another would
                   result in an incorrect error

                   -Fixed a spelling error on the printed output
                   -Added the option to use the spacebar to page through
messages
                   -Added a "/min" command line option to start PMMail/2
minimized
                   -Added a canned association for vcf files to vCards

                   -Modified the "Print Message" filter action. It still
defaults to
                   your default printer, but you can now select another
printer if you
                   wish

                   -Fixed a bug that would add a ficticious attachment
in certain
                   multipart/alternative messages

                   -Fixed a bug where PGP statuses were not cleared when
                   using up/down in the read window

                   -Fixed a bug where messages would be double-sent from
filters


                   Windows Version
                   ---------------

                   -Fixed a spelling error on a menu
                   -Fixed a HUGE bug in vCard support that wouldn't QP
encode stuff properly
                   -Fixed a hotkey error on the popup folder menu
                   -Fixed a crash when printing messages with *really*
long lines
                   -Fixed some problems with decoding wierd header lines
                   -Fixed a bug that would cause a message to have an
incorrect body

                   -Changed the behavior of opening a body in the
outbox...when doing
                   this, PMMail now defaults the message to NO
SIG...this removes the
                   double sig problem

                   -Fixed a bug where the preview pane would not
properly report an
                   error when a file was not found

                   -Fixed a bug with searching...sometimes the "search
subfolder" option
                   didn't work

                   -Fixed a spelling error on the printed output
                   -Added a canned association for vcf files to vCards

                   -Fixed a bug that would add a ficticious attachment
in certain
                   multipart/alternative messages

                   -Fixed (FINALLY) the bug where PGP statuses were not
cleared when
                   using up/down in the read window

                   -Fixed (FINALLY) the bug where messages would be
double-sent from
                   incoming filters

                   -Fixed a crash when adding a person to a group
                   -Allow the user to turn off automatic addressing
(PMMail->Properties)
                   -Fixed the crash if Quick Interrogation was turned
off
                   -We now strip "mailto:" off of embedded e-mail
addresses
                   -The From and Date fields in a read window will now
scroll
                   -Fixed window positioning when PMMail was started
minimized

                   -Added the option to pass '%s' for the filename in a
filter
                   hook. This allows other arguments to be passed.

                   -Fixed the problem with appending multiple messages
to a file

                   -Fixed a problem where the "quick path" for
attachment saving
                   would be corrupted and loose its trailing '\'

                   -Bouncing a message no longer re-sends to the BCC
list
                   -Fixed the crash when saving large complex filters

                   -The "In-Reply-To" header is now inserted so that
mailers
                   that can thread, will

                   -Fixed a missing hotkey for "New Message" in the read
window
                   -Fixed a crash when using the filter builder

                   * Information about attachments is cached. This
should make opening
                   messages *much* fater.

                   * Canned replies now have variables. Examples are
$h.to$ for the to
                   field of the message you are replying to,
$current.date$ for the 
                   current date, etc.

                   * A full list of all the variables is in the online
help.
                   This makes Canned Replies quite powerful, and they
can be used as
                   templates.

                   * You can now fully customize the way your printed
e-mail looks. To set
                   this up Go to PMMail->Settings->Print Setup. It
should be explained
                   in the help from there. This is a good way to get
used to the new
                   variable structure being introduced in Canned Replies
and Filters, as
                   they are roughly the same as the ones used there.
This quite powerful.
                   We were able to incorporate almost all of the
suggestions we got into
                   this one interface. There is a way to set up
virtually every way
                   people wanted to see their printed e-mail.

                   * You can now print out your address book. There are
two styles,
                   spreadsheet style, and a "verbose" style which prints
all the info
                   for each person, one per page. you can select the
verbose option
                   at print time.

                   * There is now a Find Tool for the address book that
is just like the
                   Find Tool for the e-mail messages.

                   * You can Export the contents of your address books
to a Comma
                   Separated File. The file format is defined in the
online help.

                   * You can also Import the same format of file into
your Address Book.

                   - LDAP support! You can use this stuff from the
"Tools" menu in the
                   address book manager.

                   - Added a filter option "Save All Attachments"...You
select this and
                   specify a directory and all attachments will be saved
there.

                   - Modified the "Print Message" filter action. It
still defaults to
                   your default printer, but you can now select another
printer if you
                   wish

                   - There are all new dictionaries in the product.
these should finally
                   include most of the common contractions and they
should be found
                   properly. As well, we have more then doubled the
number of wordsin the
                   dictionary to over 125,000. So, hopefully you will
get much more
                   meaningful suggestions.

                   * There is now a Fetch All option under the PMMail
menu. This 
                   cycles through all of your account and performs a
fetch.
                   Of course, if the account is password protected and
unopened,
                   the account will be skipped.

                   * When choosing to run the manual filters, you now
are presented
                   with a flyout menu which has a list of all of you
manual filters
                   as well as an "All" choice. You can use this to run a
single
                   manual filter, or all of them. The "All" choice is
how it used to 
                   work when choosing "Apply Manual Filters".

                   * The same RMB quick-addressbook popup as when
addressing an e-mail
                   is now accessible when defining groups.

                   - There are a whole lot of new additions to the
Filters and
                   specifically the ICSL.

                   New ICSL Tag:
                   -------------

                   The P or PROGRAM tag. This will allow you to run a
program
                   on the message being filtered and use it's return
value as
                   a boolean test in the filter. It's syntax is: 
                   PROGRAM.[.FLAGS]="STRING"
                   you must have the program name, and the pointy braces
around
                   it. All flags work with this tag. The program you
call
                   is passed the name of the message file as well as a
blank file 
                   where it needs to write it's return value/information
to.
                   This file is then compared against the "STRING" you
are
                   searching for.

                   New ICSL Fields:
                   ----------------

                   The H or HEADER tag now has 4 new fields. They are:
                   h.fromname, h.fromid, h.toname, and h.toid. They
                   further parse the h.to and h.from fields and
                   break them down further into their name and e-mail
                   address components.

                   New ICSL Flags:
                   ---------------

                   We have finally introduced the notion of "wildcards" 
                   into search strings. However, we have done it using
                   two new flags. They are:

                   -B This stand for Beginning, and the string must
match the
                   beginning of the string you are looking at. IE it is
                   a WORD* match.

                   -Z This stand for END, and the string must match the
                   end of the string you are looking at. IE it is
                   a *WORD match.

                   Only one of -b, -z, and -e can be used, as they
contradict each
                   other. -e is the same as a -b AND -z search together.

                   Variables in Search Strings!!! In simple and complex
filters
                   we now finally offer the ability to use certain
predefined
                   variablesin search strings. So, you can have a filter
catching
                   messages where the To: field and the From: field are
the same.
                   As well, you can use the variables to access current
time and
                   dates, as most importantly, you can use them to look
people up
                   in your address book and act if the are or are not in
there.
                   There is a full list of variables in the online help,
as well as
                   some do's and dont's about special characters that
you now cannot
                   use in the strings without a bit of padding and care.

                   -PMMail now supports Dial-Up Networking. Please see
the connection
                   page in the account settings.

                   - Reindexing has been made "safer" tool. and
"Reindex" now moved from
                   the Message menu to the tools menu.

                   -PGP keys are handled differently. (pro version
only). Check out
                   the security tab. You can now select your default
key. PMMail now
                   remebers the KeyID (which is unique). Before, it used
your e-mail
                   address.

                   -Fixed a crash when typing a lot of stuff in the
address field of a
                   new message.

                   -Fixed a bug with account where turing off "Leave on
server" would
                   tell you there were messages up on the server when
there weren't

                   -Fixed "Delete remote/local" issues with filters.

                   -Fixed filters so that bounces on outgoing messages
only send one
                   copy.

                   -Fixed problem with netscape URLs and launching in a
new window.

                   -Added key "Alt-B" for compose window to toggle
Cc/Bcc

                   -Fixed a crash on printing

                   -Hopefully, I put in the last fix for the Dial-Up
Networking stuff

                   -Fixed the crash on clicking a URL

                   -Dial-Up networking connections are reference
counted. What's that
                   mean to you and me? It means that 2 simultaneous
fetches will not
                   cause 2 connections, and that send after fetch will
not cause a
                   hangup and re-dial.

                   -Fixed reindex so you could reindex folders properly.
Part of our
                   "threadsafeness" caused it to be safe from even
itself.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Siemens AG Austria; PSE TN SBS 41 (1:109/42)

+----------------------------------------------------------------------------+

From: todea@DeleteThisToSendMail.ibm.net                20-Oct-99 21:30:00
  To: All                                               20-Oct-99 10:29:02
Subj: Acrobat Reader for OS/2 - Performance Problems under Warp V3

From: "Tom O'Dea" <todea@DeleteThisToSendMail.ibm.net>

I'm looking for help to solve a performance problem when running Acrobat
Reader
for OS/2 under Warp V3.

I have a 486 with 16MB of RAM and I have Warp V3 installed.  I installed
Acrobat Reader for OS/2.  When I run Acrobat Reader to display a PDF I find
that the screen painting time is painfully slow, even with simple documents. 
When I select print, Acrobat Reader just sits there with a dialog box saying
that it is printing but nothing happens.  After waiting several minutes, I
have to kill Acrobat Reader.

I checked the Acrobat Web site and found a reference to a similar problem. 
The suggested correction was to install  FP32.  

"Adobe Acrobat Reader 3.0x is supported for OS/2 Warp 3.0 and OS/2 Warp 4.0.
Adobe recommends you use fixpak 32 for OS/2 Warp 3.0 to avoid printing or
display problems."

I downloaded the latest FixPak (FP40) and I installed this OK.  However, when
I tried Acrobat Reader again, I found I still had the same problems.

Any suggestions?

NOTE:  I also tried to use Ghostscript as an alternative but couldn't get it
to print landscape.  I will describe this in a separate post.

Thanks,
Tom 




















----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (todea@ibm.net)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: todea@DeleteThisToSendMail.ibm.net                20-Oct-99 21:39:16
  To: All                                               20-Oct-99 10:29:02
Subj: Ghostscript/GSView - OS/2 Warp V3 - Landscape Printing

From: "Tom O'Dea" <todea@DeleteThisToSendMail.ibm.net>

I'm looking for help in how to get Ghostscript/GSView to print PDF documents
in landscape mode.

I recently installed Ghostscript/GSView under OS/2 Warp V3.  I did this
because I couldn't get Acrobat Reader for OS/2 to work (subject of a separate
post).  I got Ghostscript and GSView working OK, and I can view PDF files OK.
 I can also print pages from a PDF as long as the pages are Portrait. 
However, when I try to print pages which are Landscape, the page is printed
with a Portrait orientation, i.e. the right hand part of the page is lost.

GSView allows you to change the orientation of the pages on the display, but
this makes no difference to how the pages are printed.  I cannot find
anything in the documentation for Ghostscript or GSView that will allow me to
change the orientation of the page on the printer.

Any suggestions? 

Thanks,
Tom


----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (todea@ibm.net)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: cpeebles@_nospam_direct.ca                        20-Oct-99 05:15:14
  To: All                                               20-Oct-99 19:50:26
Subj: Re: TrueSpectra help

From: Clinton <cpeebles@_nospam_direct.ca>

Wayne Bickell wrote:
> 
> Easy peasy. Right click on the the workspace (or press F12)
> select "About" then "Unlock now" Enter your name and code
> number and click on "Unlock"

Like I said, dumb question.. Got it!  I must have tried every option
there was, but not About..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: dwparsons@t-online.de                             20-Oct-99 10:20:24
  To: All                                               20-Oct-99 19:50:26
Subj: SYS3175 in PMMERGE with Comm/2 4.61 GA

From: dwparsons@t-online.de (Dave Parsons)

Since upgrading to the GA version of Comm/2 4.61 and also FP12
I have started to get crashes using Netscape when doing nothing
special, just starting to download a new page.
In the last case it just said the system is stopped and didn't show
any module names. Sorry, I forgot to note CS:IP.

In a previous case it left the following in POPUPLOG.OS2

10-16-1999  10:11:30  SYS3175  PID 0334  TID 0001  Slot 0060
E:\NETSCAPE\PROGRAM\NETSCAPE.EXE
c0000005
1bdfdef1
P1=00000001  P2=00000103  P3=XXXXXXXX  P4=XXXXXXXX
EAX=178f0028  EBX=0000057c  ECX=00000060  EDX=00000584
ESI=00000584  EDI=000000ff
DS=0053  DSACC=d0f3  DSLIM=1fffffff
ES=0053  ESACC=d0f3  ESLIM=1fffffff
FS=150b  FSACC=00f3  FSLIM=00000030
GS=3503  GSACC=10f3  GSLIM=00003fff
CS:EIP=005b:1bdfdef1  CSACC=d0df  CSLIM=1fffffff
SS:ESP=0053:007c60f8  SSACC=d0f3  SSLIM=1fffffff
EBP=007c6128  FLG=00012206

PMMERGE.DLL 0004:000fdef1

I had no such problems during the beta trials. I was using FP11
then.
Looking back through POPUPLOG the last NC/2 crash I had was
over 3 months ago.

Is the fault in NC/2 GA or pmmerge from FP12?

-- 
Dave

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDL (1:109/42)

+----------------------------------------------------------------------------+

From: anthony_w@bigpond.com                             20-Oct-99 23:31:10
  To: All                                               20-Oct-99 19:50:26
Subj: Re: Partition Magic 4.0 Bug, I believe

From: Anthony White <anthony_w@bigpond.com>

On Tue, 19 Oct 1999 01:04:09 GMT, Hal Murray wrote:

>Had the same thing happen to me and went back to using PQ Magict.exe
>3.05.03.
>
>Their techs told me that PM 4 changes the file type for the extended
>partition to 05. I don't recall what type it was before using PM 4.

I have found PQMagic to be unreliable with Linux partitions that
are mixed with OS/2 partitions.

However PQMagic 3.xx (Text version) always seems to work properly.

An other problem with PQM 4.xx is the Boot Manager settings that
can be changed from within.  This does not work reliably.  In
some cases the settings simply disapear.  No amount of trying
will get them back and re-booting the machine renders BM partially
dis-functional.  Using PQMAGIGT 3.05 allows you to redo it again
and all is then OK.

Anthony

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telstra BigPond Internet Services (http://www.big
(1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          20-Oct-99 14:03:28
  To: All                                               20-Oct-99 19:50:26
Subj: Re: TrueSpectra help

From: piquant00@uswestmail.net (Annie K.)

On Wed, 20 Oct 1999 01:36:27, Clinton <cpeebles@_nospam_direct.ca> 
wrote:

:Maybe this is a dumb question, but I have downloaded TrueSpectra
:Photo>Graphics and installed it, but where, or how, do I enter the Key
:to unlock it?

 Help-->About-->Unlock Now

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           20-Oct-99 10:00:25
  To: All                                               20-Oct-99 19:50:27
Subj: (1/2) Re: Upgrade PMMail from v2.0 to v2.1?

From: "RichS" <worlock@frontiernet.net>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

It's wonderful that PMMail has a new life and is supported. The list of bug
fixes is impressive... But they didn't fix the number one bug in my book...
That's the address box with the auto-fill. It constantly drops characters as
you type and I'm constantly getting returned mail because of the missing
letters... Southsoft said they knew about this problem way back when...
Apparently, not a high priority one though.....


On Wed, 20 Oct 1999 10:47:02 +0200, Johannes Hromadka wrote:

>Doug Darrow wrote:
> 
>> The press releases I've seen didn't say anything about _development_
>> being taken over; just publishing and support. I think BoB and Icon are
>
>See: http://www.blueprintsoftwareworks.com/ubb/Forum1/HTML/000001.html
>
>
>	Hannes
>
>These are the major changes in the Blueprint Software Works 2.1 version.
>
>                   OS/2 Version
>                   ------------
>                   -Fixed a spelling error on a menu
>                   -Fixed LDAP support to allow a search root
>
>                   -Fixed a HUGE bug in vCard support that wouldn't QP
>encode stuff properly
>
>                   -Fixed a bug in PMMSend with respect to KOI8-R MIME
>headers
>                   -Fixed a bug in PMMSend with respect to encoding
>outgoing messages
>                   -Fixed a hotkey error on the popup folder menu
>                   -Fixed a crash when printing messages with *really*
>long lines
>
>                   -Added a filter option "Save All Attachments"...You
>select this and
>                   specify a directory and all attachments will be saved
>there.
>
>                   -Fixed some problems with decoding wierd header lines
>                   -Fixed a bug that would cause a message to have an
>incorrect body
>
>                   -Changed the behavior of opening a body in the
>outbox...when doing
>                   this, PMMail now defaults the message to NO
>SIG...this removes the
>                   double sig problem
>
>                   -Fixed a bug where the preview pane would not
>properly report an
>                   error when a file was not found
>
>                   -Fixed a bug with parsing the TZ environment
>variable, this also
>                   fixed correct determination of DST for southern
>hemisphere countries
>
>                   -Fixed a bug that caused high prio messages to never
>be marked as
>                   read when using the preview pane's "mark as read"
>option
>
>                   -Added some RMB cut, copy, and paste options
>
>                   -Fixed a bug with searching...sometimes the "search
>subfolder" option
>                   didn't work
>
>                   -Fixed a bug where moving addresses from one book to
>another would
>                   result in an incorrect error
>
>                   -Fixed a spelling error on the printed output
>                   -Added the option to use the spacebar to page through
>messages
>                   -Added a "/min" command line option to start PMMail/2
>minimized
>                   -Added a canned association for vcf files to vCards
>
>                   -Modified the "Print Message" filter action. It still
>defaults to
>                   your default printer, but you can now select another
>printer if you
>                   wish
>
>                   -Fixed a bug that would add a ficticious attachment
>in certain
>                   multipart/alternative messages
>
>                   -Fixed a bug where PGP statuses were not cleared when
>                   using up/down in the read window
>
>                   -Fixed a bug where messages would be double-sent from
>filters
>
>
>                   Windows Version
>                   ---------------
>
>                   -Fixed a spelling error on a menu
>                   -Fixed a HUGE bug in vCard support that wouldn't QP
>encode stuff properly
>                   -Fixed a hotkey error on the popup folder menu
>                   -Fixed a crash when printing messages with *really*
>long lines
>                   -Fixed some problems with decoding wierd header lines
>                   -Fixed a bug that would cause a message to have an
>incorrect body
>
>                   -Changed the behavior of opening a body in the
>outbox...when doing
>                   this, PMMail now defaults the message to NO
>SIG...this removes the
>                   double sig problem
>
>                   -Fixed a bug where the preview pane would not
>properly report an
>                   error when a file was not found
>
>                   -Fixed a bug with searching...sometimes the "search
>subfolder" option
>                   didn't work
>
>                   -Fixed a spelling error on the printed output
>                   -Added a canned association for vcf files to vCards
>
>                   -Fixed a bug that would add a ficticious attachment
>in certain
>                   multipart/alternative messages
>
>                   -Fixed (FINALLY) the bug where PGP statuses were not
>cleared when
>                   using up/down in the read window
>
>                   -Fixed (FINALLY) the bug where messages would be
>double-sent from
>                   incoming filters
>
>                   -Fixed a crash when adding a person to a group
>                   -Allow the user to turn off automatic addressing
>(PMMail->Properties)
>                   -Fixed the crash if Quick Interrogation was turned
>off
>                   -We now strip "mailto:" off of embedded e-mail
>addresses
>                   -The From and Date fields in a read window will now
>scroll
>                   -Fixed window positioning when PMMail was started
>minimized
>
>                   -Added the option to pass '%s' for the filename in a
>filter
>                   hook. This allows other arguments to be passed.
>
>                   -Fixed the problem with appending multiple messages
>to a file
>
>                   -Fixed a problem where the "quick path" for
>attachment saving
>                   would be corrupted and loose its trailing '\'
>
>                   -Bouncing a message no longer re-sends to the BCC
>list
>                   -Fixed the crash when saving large complex filters
>
>                   -The "In-Reply-To" header is now inserted so that
>mailers
>                   that can thread, will
>
>                   -Fixed a missing hotkey for "New Message" in the read
>window
>                   -Fixed a crash when using the filter builder
>
>                   * Information about attachments is cached. This
>should make opening
>                   messages *much* fater.
>
>                   * Canned replies now have variables. Examples are
>$h.to$ for the to
>                   field of the message you are replying to,
>$current.date$ for the 
>                   current date, etc.
>
>                   * A full list of all the variables is in the online
>help.
>                   This makes Canned Replies quite powerful, and they
>can be used as
>                   templates.
>
>                   * You can now fully customize the way your printed
>e-mail looks. To set
>                   this up Go to PMMail->Settings->Print Setup. It
>should be explained
>                   in the help from there. This is a good way to get
>used to the new
>                   variable structure being introduced in Canned Replies
>and Filters, as
>                   they are roughly the same as the ones used there.
>This quite powerful.
>                   We were able to incorporate almost all of the
>suggestions we got into
>                   this one interface. There is a way to set up
>virtually every way
>                   people wanted to see their printed e-mail.
>
>                   * You can now print out your address book. There are
>two styles,
>                   spreadsheet style, and a "verbose" style which prints
>all the info
>                   for each person, one per page. you can select the
>verbose option
>                   at print time.
>
>                   * There is now a Find Tool for the address book that
>is just like the
>                   Find Tool for the e-mail messages.
>
>                   * You can Export the contents of your address books
>to a Comma
>                   Separated File. The file format is defined in the
>online help.
>
>                   * You can also Import the same format of file into
>your Address Book.
>
>                   - LDAP support! You can use this stuff from the
>"Tools" menu in the
>                   address book manager.
>
>                   - Added a filter option "Save All Attachments"...You
>select this and
>                   specify a directory and all attachments will be saved
>there.
>
>                   - Modified the "Print Message" filter action. It
>still defaults to
>                   your default printer, but you can now select another
>printer if you
>                   wish
>
>                   - There are all new dictionaries in the product.
>these should finally
>                   include most of the common contractions and they
>should be found
>                   properly. As well, we have more then doubled the
>number of wordsin the
>                   dictionary to over 125,000. So, hopefully you will
>get much more
>                   meaningful suggestions.
>
>                   * There is now a Fetch All option under the PMMail
>menu. This 
>                   cycles through all of your account and performs a
>fetch.
>                   Of course, if the account is password protected and
>unopened,
>                   the account will be skipped.
>
>                   * When choosing to run the manual filters, you now
>are presented
>                   with a flyout menu which has a list of all of you
>manual filters
>                   as well as an "All" choice. You can use this to run a
>single
>                   manual filter, or all of them. The "All" choice is
>how it used to 
>                   work when choosing "Apply Manual Filters".
>
>                   * The same RMB quick-addressbook popup as when
>addressing an e-mail
>                   is now accessible when defining groups.
>
>                   - There are a whole lot of new additions to the
>Filters and
>                   specifically the ICSL.
>
>                   New ICSL Tag:
>                   -------------
>
>                   The P or PROGRAM tag. This will allow you to run a
>program
>                   on the message being filtered and use it's return
>value as
>                   a boolean test in the filter. It's syntax is: 
>                   PROGRAM.[.FLAGS]="STRING"
>                   you must have the program name, and the pointy braces
>around
>                   it. All flags work with this tag. The program you
>call
>                   is passed the name of the message file as well as a
>blank file 
>                   where it needs to write it's return value/information
>to.
>                   This file is then compared against the "STRING" you
>are
>                   searching for.
>
>                   New ICSL Fields:
>                   ----------------
>
>                   The H or HEADER tag now has 4 new fields. They are:
>                   h.fromname, h.fromid, h.toname, and h.toid. They
>                   further parse the h.to and h.from fields and
>                   break them down further into their name and e-mail
>                   address components.
>
>                   New ICSL Flags:
>                   ---------------
>
>                   We have finally introduced the notion of "wildcards" 
>                   into search strings. However, we have done it using
>                   two new flags. They are:
>
>                   -B This stand for Beginning, and the string must
>match the
>                   beginning of the string you are looking at. IE it is
>                   a WORD* match.
>
>                   -Z This stand for END, and the string must match the
>                   end of the string you are looking at. IE it is
>                   a *WORD match.
>
>                   Only one of -b, -z, and -e can be used, as they
>contradict each
>                   other. -e is the same as a -b AND -z search together.
>
>                   Variables in Search Strings!!! In simple and complex
>filters
>                   we now finally offer the ability to use certain
>predefined
>                   variablesin search strings. So, you can have a filter
>catching
>                   messages where the To: field and the From: field are
>the same.
>                   As well, you can use the variables to access current
>time and
>                   dates, as most importantly, you can use them to look
>people up
>                   in your address book and act if the are or are not in
>there.
>                   There is a full list of variables in the online help,
>as well as
>                   some do's and dont's about special characters that
>you now cannot
>                   use in the strings without a bit of padding and care.
>
>                   -PMMail now supports Dial-Up Networking. Please see
>the connection
>                   page in the account settings.
>
>                   - Reindexing has been made "safer" tool. and
>"Reindex" now moved from
>                   the Message menu to the tools menu.
>
>                   -PGP keys are handled differently. (pro version
>only). Check out
>                   the security tab. You can now select your default
>key. PMMail now
>                   remebers the KeyID (which is unique). Before, it used
>your e-mail
>                   address.
>
>                   -Fixed a crash when typing a lot of stuff in the
>address field of a
>                   new message.
>
>                   -Fixed a bug with account where turing off "Leave on
>server" would
>                   tell you there were messages up on the server when
>there weren't
>
>                   -Fixed "Delete remote/local" issues with filters.
>
>                   -Fixed filters so that bounces on outgoing messages
>only send one
>                   copy.
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           20-Oct-99 10:00:25
  To: All                                               20-Oct-99 19:50:27
Subj: (2/2) Re: Upgrade PMMail from v2.0 to v2.1?

>                   -Fixed problem with netscape URLs and launching in a
>new window.
>
>                   -Added key "Alt-B" for compose window to toggle
>Cc/Bcc
>
>                   -Fixed a crash on printing
>
>                   -Hopefully, I put in the last fix for the Dial-Up
>Networking stuff
>
>                   -Fixed the crash on clicking a URL
>
>                   -Dial-Up networking connections are reference
>counted. What's that
>                   mean to you and me? It means that 2 simultaneous
>fetches will not
>                   cause 2 connections, and that send after fetch will
>not cause a
>                   hangup and re-dial.
>
>                   -Fixed reindex so you could reindex folders properly.
>Part of our
>                   "threadsafeness" caused it to be safe from even
>itself.

******************************************************************************
Practice Random Acts of Kindness and Senseless...Umm...Uhh....
Oh - Heck...I never could remember all that "nice" stuff.
-
-----------------------------{worlock@frontiernet/net}-------------------------
-------
******************************************************************************



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: noconv

wj8DBQE4Db0wJUo5KMjfuWMRAoO+AKD2BzwFj+CPYLjK+TRhC/U15feGdACg4vOB
XaLwoP9QkVxR4Lv65ACPVxI=
=IIw2
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: pandpATattglobal.net                              20-Oct-99 15:09:21
  To: All                                               20-Oct-99 19:50:27
Subj: OS/2 and Rock Ridge Extensions

From: "Philip Nelson" <pandpATattglobal.net>

Is there any piece of software which will allow me to read a CD which
utilitises Rock Ridge extensions using the long file names rather than the
short equivalents.

This so that I can copy some data from a CD produced under Linux onto my hard
disk and get the long file names.

TIA


Philip Nelson
(pandp@attglobal.net)

Using PMINews and OS/2 Warp 4


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          20-Oct-99 23:37:11
  To: All                                               20-Oct-99 19:50:27
Subj: Re: TrueSpectra help

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

On Wed, 20 Oct 1999 05:15:28 -0700, Clinton wrote:

:>Wayne Bickell wrote:
:>> 
:>> Easy peasy. Right click on the the workspace (or press F12)
:>> select "About" then "Unlock now" Enter your name and code
:>> number and click on "Unlock"
:>
:>Like I said, dumb question.. Got it!  I must have tried every option
:>there was, but not About..

Bah, you should see me fumbling about, especially after a skinfull.

Have fun :-)

Cheers

Wayne

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
  Running on OS/2 Warp 4 (UK)  + FixPak 9
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: rascho@nospam.iname.com                           20-Oct-99 17:53:25
  To: All                                               20-Oct-99 19:50:27
Subj: Re: Enhanced E

From: "Rade Popovic" <rascho@nospam.iname.com>

On Wed, 20 Oct 1999 01:32:54 -0500, Wayne Swanson wrote:

>Hi Rade,
>
>John Price dropped me a line about your problem when I got home from
>WarpStock. It appears to be the same situation that he had.
>
>If the help file is corrupted, it will beep when you start up and the
>help will not work. I did download the archive from our website to check
>it and it did work for me but somehow it may not have gotten to you in
>one piece. Like John said, I fired a copy off to him and would be happy
>to email you another copy of it if the one from our website is not
>working for you. Just let me know if you still need it. My address is
>below.

I downloaded it from bmtmicro and now it works. Thank you.

>
>Same thing here with the Gradd drivers and an S3 ViRGE. Hopefully this
>will be addressed in the upcoming versions of Gradd but until then I am
>keeping Gradd installed. It's a small tradoff for the increased speed of
>Gradd over the native ViRGE drivers.

I thought it has something to do with video drivers, but you are right
GRADD are much better than native VIRGE drivers. Thank you again.

Rascho
e-mail:rascho@iname.com
ICQ# 49354974

------------------------
Hal 9000: "Dave, put those Windows disks down....Dave...DAVE!"


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Dugoprsti & Co. (1:109/42)

+----------------------------------------------------------------------------+

From: an479@lafn.org                                    20-Oct-99 09:23:14
  To: All                                               20-Oct-99 19:50:28
Subj: Netscape Certificates 

From: J. N. Pfisterer <an479@lafn.org>

On Wed, 20 Oct 1999 04:30:50 GMT, Jeffrey S. Kobal wrote:
>victori@exis.net wrote:
>> The pcert7.db file in my user directory was 0 bytes.  After I deleted
>> it NC 4.61 worked fine.  Thanks for the info.  If you don't mind a
>> question, What is the purpose/function ofpcert7.db file?
>
>It's the database of "certificates" that you've set up for
>your browser; it's a security thing, and most people don't
>use them for normal use of the browser.  The 0-byte file
>signified that the database got corrupted somehow, and
>deleting it caused a new (empty) database to be created.

A message screen (from my bank) at the start of on-line banking sessions
now informs me that the certificates in my Netscape 2.02 are expiring, 
and I must upgrade my browser in order to continue access to on-line 
banking.

Is a new file of certificates available for 2.02; or is an upgrade to 
4.61 the only way.  Was planning to upgrade to 4.61 in the next month or
so; but would like to know what my options are.  (Have ordered the 
WarpUP CD-ROM from Indelible Blue just in case :)

Jack P.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Los Angeles Free-Net (1:109/42)

+----------------------------------------------------------------------------+

From: beve@dds.nl                                       20-Oct-99 20:43:08
  To: All                                               20-Oct-99 19:50:28
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

From: "G. van der Veer" <beve@dds.nl>

> I'm looking for help to solve a performance problem when running Acrobat
> Reader
> for OS/2 under Warp V3.
>
> I have a 486 with 16MB of RAM and I have Warp V3 installed.  I installed
> Acrobat Reader for OS/2.  When I run Acrobat Reader to display a PDF I find
> that the screen painting time is painfully slow, even with simple documents.

Acrobat Reader is a heavy program and even slow on certain HP-UX workstations
(sometimes it takes a minute get a whole page on the screen).

I had the same problem with my previous computer (486 DX, 32 MB internal
memory,
1 MB video), but with my current system everything works fine (Pentium II-350
MHz, 320 MB internal memory, 4 MB video memory).  So more memory and Warp 4 or
Aurora will solve most of the problems I think.  Try ghostview, I'm sure it is
possible to print in landscape.

Berry van der Veer



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET-NL (http://www.nl.uu.net) (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     20-Oct-99 19:03:05
  To: All                                               20-Oct-99 19:50:28
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Wed, 20 Oct 1999 10:30:01, "Tom O'Dea" 
<todea@DeleteThisToSendMail.ibm.net> wrote:

..snip...
> Any suggestions?
> 
> NOTE:  I also tried to use Ghostscript as an alternative but couldn't get it
> to print landscape.  I will describe this in a separate post.
> 
> Thanks,
> Tom 
> 
> ----------------------------------------------------------------------
>  Tom O'Dea
>  Melbourne, Australia
>  (todea@ibm.net)
> 

I don't know if it will help, but:

You could try reinstalling Acrobat reader.

You could try updating/reinstalling your video driver. 

The problem could be insufficient memory, or a swapper file that is 
too small, depending on a lot of things. Try adding memory, and/or 
increase the default size of the swapper file (the SWAPPATH statement,
in CONFIG.SYS).

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                20-Oct-99 15:02:14
  To: All                                               20-Oct-99 19:50:28
Subj: Re: Netscape cache messing up

From: lifedata@xxvol.com

"Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com> said:
>Have you verified that when you are surfing around, files
>are being saved in your cache directory?

Yes, the cache directory "fills up" and the problem remains.

However, whatever it was has fixed itself.  I have done nothing to it for 3 or 
2
days, but suddenly about noon today the re-downloading of web pages stopped. 
I
also checked on the restarting of discontinued downloads.  It is working again
too.

Go figure.  I have no idea.

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: g.wulfes@berlin.snafu.de                          20-Oct-99 09:41:20
  To: All                                               20-Oct-99 19:50:28
Subj: Re: Partition Magic 4.0 Bug, I believe

From: "Georg Wulfes" <g.wulfes@berlin.snafu.de>

On Mon, 18 Oct 1999 22:51:11 GMT, Edward Germain wrote:

>I have been careful about working through this process and am fairly 
>certain about the conclusions I've posted.  However, if anyone has a 
>different experience in this particular situation or a different 
>analysis, please let me, and others, know.

Hi Ed,

at the end I add a message sent earlier about type of partition.
BTW, I've used pmagicot.exe, the text version  PMagic 3 for OS/2, to copy the
partitions of my old drives to a new large one after I'd booted from floppy.
This version is much faster as the GUI version.

Now what I found about types of partitions; it's time IBM enables OS/2
recognizing and handling this new type.

Georg

***
One hint is given in the german computer paper c't, Nr. 5, 1999,
http://www.heise.de/ct
so I don't know whether the article is online, search for hotline and
"Erweiterte Partition verschwunden".

This article deals with partition table -I'm not familiar to this.

They list types of partitions:

Code (hex)	Type
01		FAT12
04		FAT16<=32MB
05		extended *
07		HPFS or NTFS
0A		OS/2-Bootmanager
0B		FAT32
0C		Fat32(LBA)
0E		Fat16(LBA)
0F		extended(LBA) *
1x		as 0x, hidden
82		Linux Swap
83		Linux native

It may be, if the extended partition exceeds 1024 cyl. margin,
win95b, win98 and Partition Magic use type 0Fh instead 05h like
OS/2, DOS and older Linux for extended partition in the partition
table and therefore no logical partition can be seen by OS/2.

Solutions:

Editing the partition table with an diskeditor

or

http://www.toms.net/rb/

there should be an image of a bootable Linux-disk.
The fdisk-command "p" shows the partition table,
"t" allows to change the type of the extended partition
from 0Fh to 05h.
The article argues, that there may be conflicts in the future
due to the different extended types.

Thats a short, translated abstract of the article about a topic
I'm not familiar with, so be careful, use at your own risk.

***
-- 
g.wulfes@berlin.snafu.de


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: NN (1:109/42)

+----------------------------------------------------------------------------+

From: andrie@attglobal.net                              20-Oct-99 20:43:04
  To: pandp@attglobal.net                               20-Oct-99 19:50:28
Subj: Re: OS/2 and Rock Ridge Extensions

To: Philip Nelson <pandp@attglobal.net>
From: "Hans Andrieen" <andrie@attglobal.net>

Philip Nelson schrieb:
> 
> Is there any piece of software which will allow me to read a CD which
> utilitises Rock Ridge extensions using the long file names rather than the
> short equivalents.

Use the following line in CONFIG.SYS
ifs=c:\os2\boot\cdfs.ifs /Q /W

Bye/2
Hans

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: abacab@swissonline.ch                             20-Oct-99 21:08:09
  To: All                                               20-Oct-99 19:50:28
Subj: 1-2-3 and printing preview

From: Francois Hurter <abacab@swissonline.ch>

Hi, 
Running Warp4 FP10 and SmartSuite 1.1.1 
The printing preview is still very slooooow and if I'm issuing a printing
order from the   
preview window, most of the time, my sheet is blank.... I have to use the
file-print menu   
instead. 
Is this correct 
Using a HP LaserJet 6L, driver version 30.694 
Is there any solution 
TIA 
Francois 



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Swiss Online (Cablecom Media), Zurich, Switzerlan
(1:109/42)

+----------------------------------------------------------------------------+

From: dtander@agts.net                                  20-Oct-99 20:21:08
  To: All                                               20-Oct-99 19:50:28
Subj: Adobe Reader V.3 and NS4.16 -- How...?

From: dtander@agts.net (David T. Anderson)

I've installed the Adobe Actobat Reader V.3 and gotten it set up to 
work as a helper app with Netscape 4.16.  While this is satisfactory, 
I seem to recall that it can be set up to work within Netscape as a 
plugin.  However fiddling with the dlls doesn't seem to have any 
effect...it appears that something has changed in Netscape since the 
v.3 Reader was introduced.

_Is_ there a way to install the Reader as a plugin?  If so, could 
someone tell me how?
Thanks in advance...

David T. Anderson
Calgary, Alberta
http://www.agt.net/public/dtander/

Using ProNews/2 for OS/2 Warp

**NOSPAM**  To email me, remove the 's' from my address...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: gjohn@csom.umn.edu                                20-Oct-99 15:51:25
  To: All                                               20-Oct-99 19:50:28
Subj: Re: Ghostscript/GSView - OS/2 Warp V3 - Landscape Printing

From: George John <gjohn@csom.umn.edu>

Basically, Gsview has two limitations: 1.  you cannot print pdf files to a
postscript printer;
2. the postscript file itslef must already contain rotated text if you want to
print it in
landscape.  Or at least, that is my understanding, and I have used it for
quite
some time now.
So, use the original program (e.g., Wordpro) to print the rotated material to
a
file, and then use gsview to print that material.  It will come out in
landscape.




Tom O'Dea wrote:

> I'm looking for help in how to get Ghostscript/GSView to print PDF documents
> in landscape mode.
>
> I recently installed Ghostscript/GSView under OS/2 Warp V3.  I did this
> because I couldn't get Acrobat Reader for OS/2 to work (subject of a
separate
> post).  I got Ghostscript and GSView working OK, and I can view PDF files
OK.
>  I can also print pages from a PDF as long as the pages are Portrait.
> However, when I try to print pages which are Landscape, the page is printed
> with a Portrait orientation, i.e. the right hand part of the page is lost.
>
> GSView allows you to change the orientation of the pages on the display, but
> this makes no difference to how the pages are printed.  I cannot find
> anything in the documentation for Ghostscript or GSView that will allow me
to
> change the orientation of the page on the printer.
>
> Any suggestions?
>
> Thanks,
> Tom
>
> ----------------------------------------------------------------------
>  Tom O'Dea
>  Melbourne, Australia
>  (todea@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Minnesota, Twin Cities Campus (1:109/42)

+----------------------------------------------------------------------------+

From: abacab@swissonline.ch                             20-Oct-99 21:06:13
  To: All                                               20-Oct-99 19:50:28
Subj: WordPro and Help Window

From: Francois Hurter <abacab@swissonline.ch>

Hi, 
When starting WordPro by clicking a wordpro file, the Help Window opens itself 
and   
doesn't stop reopen when I'm trying to close it. 
I thought this was a bug from the past... 
Running Warp 4 FP10, SmartSuite 1.1.1 
What is the solution ? 
Francois 



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Swiss Online (Cablecom Media), Zurich, Switzerlan
(1:109/42)

+----------------------------------------------------------------------------+

From: tomodea@DeleteThisToSendMail.usa...               21-Oct-99 07:36:07
  To: All                                               20-Oct-99 19:50:28
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

Message sender: tomodea@DeleteThisToSendMail.usa.net

From: "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net>

Berry,
Thanks.

I've tried ghostview.  This addresses the performance problem.  I can view a
PDF which has landscape pages and I can change the orientation on the display
but I can't change the orientation when I send a page to the printer.

Tom

On Wed, 20 Oct 1999 20:43:16 +0100, G. van der Veer wrote:

>> I'm looking for help to solve a performance problem when running Acrobat
>> Reader
>> for OS/2 under Warp V3.
>>
>> I have a 486 with 16MB of RAM and I have Warp V3 installed.  I installed
>> Acrobat Reader for OS/2.  When I run Acrobat Reader to display a PDF I find
>> that the screen painting time is painfully slow, even with simple
documents.
>
>Acrobat Reader is a heavy program and even slow on certain HP-UX workstations
>(sometimes it takes a minute get a whole page on the screen).
>
>I had the same problem with my previous computer (486 DX, 32 MB internal
memory,
>1 MB video), but with my current system everything works fine (Pentium II-350
>MHz, 320 MB internal memory, 4 MB video memory).  So more memory and Warp 4
or
>Aurora will solve most of the problems I think.  Try ghostview, I'm sure it
is
>possible to print in landscape.
>
>Berry van der Veer
>
>
>

----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (tomodea@usa.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: centus@coqui.net                                  20-Oct-99 21:08:09
  To: All                                               20-Oct-99 19:50:28
Subj: Help!, joystick not detected by OS/2    8.-(

From: centus@coqui.net

Hi

I installed a new Crustal CS4289 PCI audio board. I have OS/2 v4 FP12.
 After installing MAME and the joysticmk driver OS/2 is UNABLE to 
detect the PC Propad 4 joystick.  IBM web site says the driver 
supports the PC Propad 4 joystick.  Actually, I was able to use it 
with an old ISA card.  I don't understand WHY OS/2 detects the card (I
have sound, CD audio) and the joystick is NOT detected.

Any guru out-there?

Edfel

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      20-Oct-99 18:15:11
  To: All                                               20-Oct-99 19:50:28
Subj: Re: Ghostscript/GSView - OS/2 Warp V3 - Landscape Printing

From: nospam@savebandwidth.invalid       (John Thompson)

In <gbqrnvozarg.fjxj9wc.pminews@news1.ibm.net>, "Tom O'Dea"
<todea@DeleteThisToSendMail.ibm.net> writes:

>I'm looking for help in how to get Ghostscript/GSView to print PDF documents
>in landscape mode.

You should be able to change this in the "Job Properties" for the
printer driver in the printer object.  You can either do this on 
an "as needed" basis or create a new printer object with 
landscape orientation as the default.

-John (John.Thompson@attglobal.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      20-Oct-99 18:12:25
  To: All                                               20-Oct-99 19:50:28
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

From: nospam@savebandwidth.invalid       (John Thompson)

In <gbqrnvozarg.fjxiu19.pminews@news1.ibm.net>, "Tom O'Dea"
<todea@DeleteThisToSendMail.ibm.net> writes:

>I'm looking for help to solve a performance problem when running Acrobat
>Reader for OS/2 under Warp V3.
>
>I have a 486 with 16MB of RAM and I have Warp V3 installed.  I installed
>Acrobat Reader for OS/2.  When I run Acrobat Reader to display a PDF I find
>that the screen painting time is painfully slow, even with simple documents. 

I'm not sure about your printing problems, but since Acrobat/2 
does its own font rendering instead of using PM that could 
account for the slowness.  16MB is kind of tight for OS/2.  If 
you can install more memory you will enjoy a performance benefit 
across the board.

-John (John.Thompson@attglobal.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: jata@aepiax.net                                   20-Oct-99 22:17:27
  To: All                                               20-Oct-99 21:23:24
Subj: Re: OS/2 and Rock Ridge Extensions

From: jata@aepiax.net (Julian Thomas)

In <cnaqcnggtybonyarg.fjx1860.pminews@news2.attglobal.net>, on 10/20/99 
   at 03:09 PM, "Philip Nelson" <pandpATattglobal.net> said:

>Is there any piece of software which will allow me to read a CD which
>utilitises Rock Ridge extensions using the long file names rather than
>the short equivalents.

>This so that I can copy some data from a CD produced under Linux onto my
>hard disk and get the long file names.

I haven't tried it to/from Linux, but infozip seems to transport long file
names fairly well - if zipping and ftp is an option.
 
-- 
 Julian Thomas: jt . epix @ net  http://home.epix.net/~jt
 remove letter a for email (or switch . and @)
 Boardmember of POSSI.org - Phoenix OS/2 Society, Inc  http://www.possi.org
 In the beautiful Finger Lakes Wine Country of New York State!
 -- --
 In most countries selling harmful things like drugs is punishable.
 Then howcome people can sell Microsoft software and go unpunished?



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: News@The-Net-4U.com                               20-Oct-99 19:05:21
  To: All                                               20-Oct-99 21:23:24
Subj: Re: LinkWiz

From: News@The-Net-4U.com (M.P. van Dobben de Bruijn)

> janswa@algonet.se (Jan Swartling) wrote:

Don't know if you found ways to contact them
on Linkwiz already (their site is still under re-con-
struction I think) but I saw that Indelible Blue has
both Linkwiz and BackUpWiz in their catalogue ...

Regards from Leeuwarden
Peter van Dobben de Bruijn
---
usethenet.at.the-net-4u.com (.at. becomes @)
----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TeleKabel (1:109/42)

+----------------------------------------------------------------------------+

From: tomodea@DeleteThisToSendMail.usa...               21-Oct-99 07:33:07
  To: All                                               20-Oct-99 21:23:24
Subj: Re: Ghostscript/GSView - OS/2 Warp V3 - Landscape Printing

Message sender: tomodea@DeleteThisToSendMail.usa.net

From: "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net>

George,
Thanks for the suggestions.

Two points:
1.  The printer I am using is not a Postscript printer.  It's a Lexmark
inkjet.

2.  The PDF file I want to view and print is not a file that I have created. 
It was downloaded from a web site.  The document is displayed in landscape. 
I can change the orientation on the display using GSView but I can't change
the orientation when I say Print.

Tom

On Wed, 20 Oct 1999 15:51:50 -0500, George John wrote:

>Basically, Gsview has two limitations: 1.  you cannot print pdf files to a
>postscript printer;
>2. the postscript file itslef must already contain rotated text if you want
to
>print it in
>landscape.  Or at least, that is my understanding, and I have used it for
quite
>some time now.
>So, use the original program (e.g., Wordpro) to print the rotated material to 
a
>file, and then use gsview to print that material.  It will come out in
landscape.
>
>
>
>
>Tom O'Dea wrote:
>
>> I'm looking for help in how to get Ghostscript/GSView to print PDF
documents
>> in landscape mode.
>>
>> I recently installed Ghostscript/GSView under OS/2 Warp V3.  I did this
>> because I couldn't get Acrobat Reader for OS/2 to work (subject of a
separate
>> post).  I got Ghostscript and GSView working OK, and I can view PDF files
OK.
>>  I can also print pages from a PDF as long as the pages are Portrait.
>> However, when I try to print pages which are Landscape, the page is printed
>> with a Portrait orientation, i.e. the right hand part of the page is lost.
>>
>> GSView allows you to change the orientation of the pages on the display,
but
>> this makes no difference to how the pages are printed.  I cannot find
>> anything in the documentation for Ghostscript or GSView that will allow me
to
>> change the orientation of the page on the printer.
>>
>> Any suggestions?
>>
>> Thanks,
>> Tom
>>
>> ----------------------------------------------------------------------
>>  Tom O'Dea
>>  Melbourne, Australia
>>  (todea@ibm.net)
>

----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (tomodea@usa.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               21-Oct-99 00:22:01
  To: All                                               20-Oct-99 21:23:24
Subj: Re: OS/2 and Rock Ridge Extensions

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

"Hans Andrieen" schrieb:
> 
> Philip Nelson schrieb:
> >
> > Is there any piece of software which will allow me to read a CD which
> > utilitises Rock Ridge extensions using the long file names rather than the
> > short equivalents.
> 
> Use the following line in CONFIG.SYS
> ifs=c:\os2\boot\cdfs.ifs /Q /W

The /W switch only activates Joliet support, but not support for
Rockridge AFAIK. RSJ claims that their CD-Writer filesystem is also
capable of Rockridge support, but I've never tried to read such a CD
using it and never found any TRANS.TBL files on the CDs that I made
myself. Download the demo-version and see yourself.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               21-Oct-99 00:24:19
  To: All                                               20-Oct-99 21:23:24
Subj: Re: Help!, joystick not detected by OS/2    8.-(

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

centus@coqui.net schrieb:
> 
> Hi
> 
> I installed a new Crustal CS4289 PCI audio board. I have OS/2 v4 FP12.
>  After installing MAME and the joysticmk driver OS/2 is UNABLE to
> detect the PC Propad 4 joystick.  IBM web site says the driver
> supports the PC Propad 4 joystick.  Actually, I was able to use it
> with an old ISA card.  I don't understand WHY OS/2 detects the card (I
> have sound, CD audio) and the joystick is NOT detected.
> 
> Any guru out-there?

Maybe your gameport is deactivated. There should be some setup utility
(probably running under DOS) where you can switch it on and off, select
IRQs and the like.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: prytula@netspace.net.au                           21-Oct-99 11:35:13
  To: All                                               21-Oct-99 03:14:02
Subj: Winos2 and w32s125.zip

From: prytula@netspace.net.au

Can anyone help with w32s125.zip? Is this to enable Win95 programs to be
run in Winos2? I assumed this was the purpose but maybe I am wrong :( I
tried but get an error message:- "Win32s error: invalid format." The
readme of 1995 from IBM says to expect this but I had hoped that this was
superceded by w32s125.zip.

Secondly, warp32s.zip, also on Hobbes, is dated later than w32s125.zip.
The details say it is for Warp 3+ Does this mean Warp 3 + Fixpaks, or does
it mean Warp 3 + Warp 4? Any help would be *very* welcome :)
Richard


Richard Prytula, Melbourne, Australia
(prytula@netspace.net.au)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A customer of Netspace Internet (1:109/42)

+----------------------------------------------------------------------------+

From: fpalmis@mailandnews.com                           20-Oct-99 19:56:22
  To: All                                               21-Oct-99 03:14:02
Subj: Is there a Kill Command?

From: "Frank" <fpalmis@mailandnews.com>

I don't use OS/2 now although I did at one time.  I seem to recall there was
a command or facility to completely remove a file such that it could not be
recovered (similar to what might be accomplished with Norton WipeFile).  Can
anyone confirm this?

Thanks!


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    21-Oct-99 01:07:24
  To: All                                               21-Oct-99 03:14:02
Subj: Re: Help!, joystick not detected by OS/2    8.-(

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

centus@coqui.net wrote:

: I installed a new Crustal CS4289 PCI audio board. I have OS/2 v4 FP12.
:  After installing MAME and the joysticmk driver OS/2 is UNABLE to 
: detect the PC Propad 4 joystick.  IBM web site says the driver 
: supports the PC Propad 4 joystick.  Actually, I was able to use it 
: with an old ISA card.  I don't understand WHY OS/2 detects the card (I
: have sound, CD audio) and the joystick is NOT detected.

	In the ISA chipset CS's have a switch for their CWAUDIO.SYS 
basedev statement (J:), I have mine at J:200.  Perhaps adding that could 
help.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      20-Oct-99 22:51:26
  To: All                                               21-Oct-99 03:14:02
Subj: Re: OS/2 and Rock Ridge Extensions

From: nospam@savebandwidth.invalid       (John Thompson)

In <380E619D.CC39045F@attglobal.net>, "Hans Andrieen" <andrie@attglobal.net>
writes:

>Philip Nelson schrieb:
>> 
>> Is there any piece of software which will allow me to read a CD which
>> utilitises Rock Ridge extensions using the long file names rather than the
>> short equivalents.

>Use the following line in CONFIG.SYS
>ifs=c:\os2\boot\cdfs.ifs /Q /W

IIRC, the "/W" switch enables the Microsoft "Joliet" lfn 
extensions.  I am not aware of any OS/2 software that handles the
Rock Ridge extensions used on linux CD's.

-John (John.Thompson@attglobal.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: solune@netaxs.com                                 21-Oct-99 03:17:28
  To: All                                               21-Oct-99 03:14:02
Subj: Unsupported Java

From: solune@netaxs.com

Hi, 

On some web pages i'm getting an unsupported java version dialogue. 
I've popped by the software choice web page, and there are a lot of 
files to download, but i'm unsure of which to download to update my 
Java for web browsing.

I'm not a developer, so all the tools they have might not matter.

I'm running Warp 4, with FP10 applied (but not committed) and Netscape
4.61.

What do I gotta do?

any help would be appreciated.
Thanks.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: newsread.com ISP News Reading Service (http://www
(1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           21-Oct-99 04:19:21
  To: All                                               21-Oct-99 03:14:02
Subj: Re: Winos2 and w32s125.zip

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Thu, 21 Oct 1999 00:35:26, prytula@netspace.net.au wrote:

> Can anyone help with w32s125.zip? Is this to enable Win95 programs to be
> run in Winos2? I assumed this was the purpose but maybe I am wrong :( I
> tried but get an error message:- "Win32s error: invalid format." The
> readme of 1995 from IBM says to expect this but I had hoped that this was
> superceded by w32s125.zip.
> 
> Secondly, warp32s.zip, also on Hobbes, is dated later than w32s125.zip.
> The details say it is for Warp 3+ Does this mean Warp 3 + Fixpaks, or does
> it mean Warp 3 + Warp 4? Any help would be *very* welcome :)
> Richard
> 

The w32s125.zip is the 1.25 version of the WIN32S API implementation.
It allows a subset of WIN32S applications to run on Warp 3 or Warp 4.

The warp32s.zip file contains files that update Warp 3 to allow
the use of the w32s125.zip file. The updates in the warp32s.zip
file are already contained in Warp 4.

NOTE - the latest (last) version of WIN32S was version 1.3. Programs
written to use this API level will NOT run under winos2. The defaults
for the version 1.3 WIN32S provide for memeory allocation
above the 512Mbyte limit that is handled by Warp 3 and Warp 4.

The "invalid format" message indicates that the program is
a native WIN95/98 executable file. These files are in
"PE" format rather than "LX" format (the one used by
Win 3.1 and readable by OS/2). The "PE" format executable
files cannot be loaded by OS/2.

There is a "PE2LX" converter available (Alpha code). This is
the "Project Odin" code formerly known as WIN32-OS2.

URL http://www.netlabs.org/odin

This project allows you to either convert and run or 
"convert on load" PE executable files in OS/2.

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: spam_free_norrisg@linkline.com                    20-Oct-99 22:34:06
  To: All                                               21-Oct-99 03:14:02
Subj: Re: Winos2 and w32s125.zip

From: "Graham C. Norris" <spam_free_norrisg@linkline.com>

Win32s is a subset of Win32 and it runs some, but by no means all, Win32
programs. Any written specifically for Win95, 98, NT4 or 2000 are highly
unlikely to work.

Graham.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: jwhardy@attglobal.net                             21-Oct-99 01:04:00
  To: All                                               21-Oct-99 03:14:02
Subj: NICs: which have good OS/2 drivers?

From: "John W. Hardy" <jwhardy@attglobal.net>

Hello;

I would like to get a 10/100 network kit, typically a 5-port hub with
two NICs. 3COM NICs are pricey, so I've been looking at D-Link and
Linksys. Drivers are available on the OS/2 site, but they seem rather
dated and may not be appropriate for the latest NICs. No mention of OS/2
on the D-Link and Linksys sites. Any suggestions? I'm willing to buy
3COM if necessary, but I'm sure I've heard of others that are cheaper
and have good drivers. Thank you.

John

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: willem@horizontes-informatica.com                 21-Oct-99 06:36:03
  To: All                                               21-Oct-99 05:18:01
Subj: Re: NICs: which have good OS/2 drivers?

From: "Willem Clements" <willem@horizontes-informatica.com>

On Thu, 21 Oct 1999 01:04:00 -0400, John W. Hardy wrote:

>Hello;
>
>I would like to get a 10/100 network kit, typically a 5-port hub with
>two NICs. 3COM NICs are pricey, so I've been looking at D-Link and
>Linksys. Drivers are available on the OS/2 site, but they seem rather
>dated and may not be appropriate for the latest NICs. No mention of OS/2
>on the D-Link and Linksys sites. Any suggestions? I'm willing to buy
>3COM if necessary, but I'm sure I've heard of others that are cheaper
>and have good drivers. Thank you.
>
>John

I have obtained good results with cards with RealTek chips.
The cards are cheap, and the drivers are at http://www.realtek.com.tw,
both for 10 and 100Mb cards



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Wanadoo (1:109/42)

+----------------------------------------------------------------------------+

From: peter@seagoon.newcastle.edu.au                    21-Oct-99 07:16:01
  To: All                                               21-Oct-99 05:18:01
Subj: Re: NICs: which have good OS/2 drivers?

From: peter@seagoon.newcastle.edu.au (Peter Moylan)

John W. Hardy <jwhardy@attglobal.net> wrote:
>Hello;
>
>I would like to get a 10/100 network kit, typically a 5-port hub with
>two NICs. 3COM NICs are pricey, so I've been looking at D-Link and
>Linksys. Drivers are available on the OS/2 site, but they seem rather
>dated and may not be appropriate for the latest NICs. No mention of OS/2
>on the D-Link and Linksys sites. Any suggestions? I'm willing to buy
>3COM if necessary, but I'm sure I've heard of others that are cheaper
>and have good drivers. Thank you.

I'm using a D-Link DE-530CT+, and I'm perfectly satisfied with it.
For 10/100 you'd need a different model - I've forgotten the model
number, but I've tried it and it worked fine with OS/2.  Installing
the driver was completely trouble-free.

-- 
Peter Moylan                                         peter@ee.newcastle.edu.au
See http://eepjm.newcastle.edu.au for OS/2 information and software

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: baking@nznet.gen.nz                               21-Oct-99 20:15:18
  To: All                                               21-Oct-99 05:18:01
Subj: Re: EscapeGL 3.0 and OpenGL problems...

From: "Brian King" <baking@nznet.gen.nz>

On Tue, 19 Oct 1999 09:11:52 -0400 (EDT), RichS wrote:

>No, I didn't want to go that route until necessary and I had a chance to get
>things working myself. They gave the impression that opengl problems were not
>their thing, but maybe not?

Are you using random mode...because this has caused problems in the past!!!!
-------------------------------------------------------------------------------
------------
Brian King
baking@nznet.gen.nz

OS/2 Warp 4 advocate and fulltime listener of  NZ music...
Helensville, New Zealand.
-------------------------------------------------------------------------------
------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: NZNET Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  21-Oct-99 07:47:28
  To: All                                               21-Oct-99 05:18:01
Subj: Re: Unsupported Java

From: l_luciano@da.mob (Stan Goodman)

What version of Java are you running that these web pages think is 
unsupported? If you have not installed anything later than "Java for OS/2",
which is version 1.02, the pages are probably right. If that is so, you 
need to install something more modern. The current version is 1.1.8.

On Thu, 21 Oct 1999 03:17:56, solune@netaxs.com wrote:

> Hi, 
> 
> On some web pages i'm getting an unsupported java version dialogue. 
> I've popped by the software choice web page, and there are a lot of 
> files to download, but i'm unsure of which to download to update my 
> Java for web browsing.
> 
> I'm not a developer, so all the tools they have might not matter.
> 
> I'm running Warp 4, with FP10 applied (but not committed) and Netscape
> 4.61.
> 
> What do I gotta do?
> 
> any help would be appreciated.
> Thanks.
> 

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: abacab@swissonline.ch                             20-Oct-99 21:10:14
  To: All                                               21-Oct-99 10:33:27
Subj: 1-2-3 and printing preview

From: Francois Hurter <abacab@swissonline.ch>

Hi, 
Running Warp4 FP10 and SmartSuite 1.1.1 
The printing preview is still very slooooow and if I'm issuing a printing
order from the   
preview window, most of the time, my sheet is blank.... I have to use the
file-print menu   
instead. 
Is this correct 
Using a HP LaserJet 6L, driver version 30.694 
Is there any solution 
TIA 
Francois 



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Swiss Online (Cablecom Media), Zurich, Switzerlan
(1:109/42)

+----------------------------------------------------------------------------+

From: ivaes@hr.nl                                       21-Oct-99 10:46:09
  To: All                                               21-Oct-99 10:33:27
Subj: Re: Winos2 and w32s125.zip

From: Illya Vaes <ivaes@hr.nl>

Lorne Sunley wrote:
> On Thu, 21 Oct 1999 00:35:26, prytula@netspace.net.au wrote:
>>Can anyone help with w32s125.zip? Is this to enable Win95 programs to be
>>run in Winos2? I assumed this was the purpose but maybe I am wrong :( I
>>tried but get an error message:- "Win32s error: invalid format." The
>>readme of 1995 from IBM says to expect this but I had hoped that this was
>>superceded by w32s125.zip.
>The "invalid format" message indicates that the program is
>a native WIN95/98 executable file. These files are in
>"PE" format rather than "LX" format (the one used by
>Win 3.1 and readable by OS/2). The "PE" format executable
>files cannot be loaded by OS/2.

All Win32 by definition have the PE (Portable Executable) format.
The LX (Linear eXecutable) format is the OS/2 native 32bit format.
Win 3.1 programs are NE (New Executable) format.
At least LX and (AFAIK) NE actually start with an MS-DOS header (MZ are the
first two "characters" of any MS-DOS EXE), but continue with the non-MS-DOS
stuff. Non-knowledgable loaders/OSes will run a stub contained in (referenced
from?) the MS-DOS header that says eg. "This program cannot be run under
MS-DOS" or "This program requires Microsoft Windows".

OS/2 only identifies the PE format as "some Windows stuff" and starts
Win-OS/2. If that has Win32s installed, it can identify _and load_ PE
executables, provided they are Win32s and don't _demand_ a win32s 1.30.
 
>There is a "PE2LX" converter available (Alpha code). This is
>the "Project Odin" code formerly known as WIN32-OS2.
>URL http://www.netlabs.org/odin
>This project allows you to either convert and run or
>"convert on load" PE executable files in OS/2.

Some PE executables. Only those that use API calls that can be mapped to OS/2
API calls and which have actually been mapped/implemented too.

-- 
Illya Vaes   (ivaes@hr.nl)        "Do...or do not, there is no 'try'" - Yoda
Holland Railconsult BV, Integral Management of Railprocess Systems
Postbus 2855, 3500 GW Utrecht
Tel +31.30.2653273, Fax 2653385           Not speaking for anyone but myself

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Holland Railconsult BV (1:109/42)

+----------------------------------------------------------------------------+

From: nospam_ktk@netlabs.org                            21-Oct-99 12:40:04
  To: All                                               21-Oct-99 10:33:27
Subj: Re: Is there a Kill Command?

From: "Adrian Gschwend" <nospam_ktk@netlabs.org>

On Wed, 20 Oct 1999 19:56:45 -0500, Frank wrote:

>I don't use OS/2 now although I did at one time.  I seem to recall there was
>a command or facility to completely remove a file such that it could not be
>recovered (similar to what might be accomplished with Norton WipeFile).  Can
>anyone confirm this?

I think there is a tool called blackhole, check http://hobbes.nmsu.edu and
serach for it.

cu

Adrian


---
Adrian Gschwend
@ OS/2 Netlabs

ICQ: 22419590
ktk@netlabs.org
-------
The OS/2 OpenSource Project:
http://www.netlabs.org


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: OS/2 Netlabs (1:109/42)

+----------------------------------------------------------------------------+

From: janswa@algonet.se                                 21-Oct-99 12:30:02
  To: All                                               21-Oct-99 14:39:10
Subj: Re: LinkWiz

From: janswa@algonet.se (Jan Swartling)

On Wed, 20 Oct 1999 19:05:43, News@The-Net-4U.com (M.P. van Dobben de 
Bruijn) wrote:

> Don't know if you found ways to contact them
> on Linkwiz already (their site is still under re-con-
> struction I think) but I saw that Indelible Blue has
> both Linkwiz and BackUpWiz in their catalogue ...
> Peter van Dobben de Bruijn

Peter,

Thanks for the info .

Jan Swartling
 Blue Soft
 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Blue Soft (1:109/42)

+----------------------------------------------------------------------------+

From: centus@coqui.net                                  21-Oct-99 12:39:26
  To: All                                               21-Oct-99 14:39:10
Subj: Re: Help!, joystick not detected by OS/2    8.-(

From: centus@coqui.net

On Thu, 21 Oct 1999 01:07:48, jdc0014@InfoNET.st-johns.nf.ca (John 
Hong) wrote:

> centus@coqui.net wrote:
> 
> : I installed a new Crustal CS4289 PCI audio board. I have OS/2 v4 FP12.
> :  After installing MAME and the joysticmk driver OS/2 is UNABLE to 
> : detect the PC Propad 4 joystick.  IBM web site says the driver 
> : supports the PC Propad 4 joystick.  Actually, I was able to use it 
> : with an old ISA card.  I don't understand WHY OS/2 detects the card (I
> : have sound, CD audio) and the joystick is NOT detected.
> 
> 	In the ISA chipset CS's have a switch for their CWAUDIO.SYS 
> basedev statement (J:), I have mine at J:200.  Perhaps adding that could 
> help.
> 
Thanks.  But still not working.  I am including info generated with 
scanpci.exe.
I need to know (1) which address the joystick should be located and 
(2) if
the card appears to be ok from the report generated by scanpci.exe

Apprecaite all the help!

Edfel
centus@coqui.net




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: centus@coqui.net                                  21-Oct-99 12:49:22
  To: All                                               21-Oct-99 14:39:10
Subj: Re: Help!, joystick not detected by OS/2    8.-(

From: centus@coqui.net

On Thu, 21 Oct 1999 12:39:52, centus@coqui.net wrote:

> On Thu, 21 Oct 1999 01:07:48, jdc0014@InfoNET.st-johns.nf.ca (John 
> Hong) wrote:
> 
> > centus@coqui.net wrote:
> > 
> > : I installed a new Crustal CS4289 PCI audio board. I have OS/2 v4 FP12.
> > :  After installing MAME and the joysticmk driver OS/2 is UNABLE to 
> > : detect the PC Propad 4 joystick.  IBM web site says the driver 
> > : supports the PC Propad 4 joystick.  Actually, I was able to use it 
> > : with an old ISA card.  I don't understand WHY OS/2 detects the card (I
> > : have sound, CD audio) and the joystick is NOT detected.
> > 
> > 	In the ISA chipset CS's have a switch for their CWAUDIO.SYS 
> > basedev statement (J:), I have mine at J:200.  Perhaps adding that could 
> > help.
> > 
> Thanks.  But still not working.  I am including info generated with 
> scanpci.exe.
> I need to know (1) which address the joystick should be located and 
> (2) if
> the card appears to be ok from the report generated by scanpci.exe
> 
> Apprecaite all the help!
> 
> Edfel
> centus@coqui.net

Sorry I forgot to 'paste' the report...

here it is:
 PCI bus: 0x0; Card: 0x0b; Function: 0x00
 Cirrus Logic (Device unknown)
 Vendor ID 0x1013, Device ID 0x6003. Revision ID: 0x01.
  Multimedia device, audio

  IRQ line :  10	  PCI INT pin  :  A

 Status register: 0x0210
  Detected parity error     : No	Detected System Error     : No
  Received Master-Abort     : No	Received Target-Abort     : No
  Signaled Target-Abort     : No	Detected Data Parity Error: No
  Fast Back To Back Capable : No	Device select timing      : Medium
 Command register: 0x0006
  Fast Back-to-Back         : Disabled	Memory Write & Invalidate : 
Disabled
  Special Cycle recognition : Disabled	Bus Master                : 
Enabled 
  Memory access (mem-on)    : Enabled 	I/O access (I/O-on)       : 
Disabled
  BASE0     0xda800000  addr 0xda800000  MEM
  BASE1     0xda000000  addr 0xda000000  MEM

Could this be a 'faulty' card?

Anyone with this card (Onspeed Crystal cs4280 chipset PCI)?

Whats the setup for the game port or joystick?

THanks!

Edfel
centus@coqui.net



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           21-Oct-99 09:08:07
  To: All                                               21-Oct-99 14:39:10
Subj: Re: EscapeGL 3.0 and OpenGL problems...

From: "RichS" <worlock@frontiernet.net>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

Yes I'm using the random mode. To me, that is the whole point of the program
to switch to different modules. I really hate seeing the same thing over and
over on the screen... But besides the point, the problem also occur when
having only one module selected.

I did finally ask for support from Snow Storm and got a quick reply. They
suggested I try the ogl9635 files (older version) rather than the oglgold I
was running. So far, it doesn't look like that helped any. I've also updated
to fixpack 12 and the driver fp1. Didn't help either... I have to do a bit
more testing and then get back to them...

Thanks...

On Thu, 21 Oct 1999 20:15:36 +1300 (NZDT), Brian King wrote:

>On Tue, 19 Oct 1999 09:11:52 -0400 (EDT), RichS wrote:
>
>>No, I didn't want to go that route until necessary and I had a chance to get
>>things working myself. They gave the impression that opengl problems were
not
>>their thing, but maybe not?
>
>Are you using random mode...because this has caused problems in the past!!!!
>------------------------------------------------------------------------------
-------------
>Brian King
>baking@nznet.gen.nz
>
>OS/2 Warp 4 advocate and fulltime listener of  NZ music...
>Helensville, New Zealand.
>------------------------------------------------------------------------------
-------------
>
>

******************************************************************************
Practice Random Acts of Kindness and Senseless...Umm...Uhh....
Oh - Heck...I never could remember all that "nice" stuff.
-
-----------------------------{worlock@frontiernet/net}-------------------------
-------
******************************************************************************



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: noconv

wj8DBQE4DwJSJUo5KMjfuWMRAvMCAJ4vbMjtEJmk2gJ/vpgxq6oNLoL8qQCgjhxk
N1Yj6GQMafs6X103aG12Pmw=
=thMw
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: tomodea@DeleteThisToSendMail.usa...               21-Oct-99 23:59:11
  To: All                                               21-Oct-99 14:39:10
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

Message sender: tomodea@DeleteThisToSendMail.usa.net

From: "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net>

John,
I agree with you.  16MB is really tight.  I would be happy to add extra
memory, but the PC only supports a maximum of 16MB.

Thanks,
Tom

On Wed, 20 Oct 1999 18:12:50 GMT, John Thompson wrote:

>In <gbqrnvozarg.fjxiu19.pminews@news1.ibm.net>, "Tom O'Dea"
<todea@DeleteThisToSendMail.ibm.net> writes:
>
>>I'm looking for help to solve a performance problem when running Acrobat
>>Reader for OS/2 under Warp V3.
>>
>>I have a 486 with 16MB of RAM and I have Warp V3 installed.  I installed
>>Acrobat Reader for OS/2.  When I run Acrobat Reader to display a PDF I find
>>that the screen painting time is painfully slow, even with simple documents. 

>
>I'm not sure about your printing problems, but since Acrobat/2 
>does its own font rendering instead of using PM that could 
>account for the slowness.  16MB is kind of tight for OS/2.  If 
>you can install more memory you will enjoy a performance benefit 
>across the board.
>
>-John (John.Thompson@attglobal.net)
>

----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (tomodea@usa.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: tomodea@DeleteThisToSendMail.usa...               22-Oct-99 00:02:10
  To: All                                               21-Oct-99 14:39:10
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

Message sender: tomodea@DeleteThisToSendMail.usa.net

From: "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net>

Doug,
Thanks for the suggestions.

I've tried reinstalling Acrobat reader.  I've also tried updating the video
driver.  I suspect it's memory.  I would like to add more, but the PC only
supports 16MB max.

Tom

On 20 Oct 1999 19:03:11 GMT, Doug Bissett wrote:

>On Wed, 20 Oct 1999 10:30:01, "Tom O'Dea" 
><todea@DeleteThisToSendMail.ibm.net> wrote:
>
>...snip...
>> Any suggestions?
>> 
>> NOTE:  I also tried to use Ghostscript as an alternative but couldn't get
it
>> to print landscape.  I will describe this in a separate post.
>> 
>> Thanks,
>> Tom 
>> 
>> ----------------------------------------------------------------------
>>  Tom O'Dea
>>  Melbourne, Australia
>>  (todea@ibm.net)
>> 
>
>I don't know if it will help, but:
>
>You could try reinstalling Acrobat reader.
>
>You could try updating/reinstalling your video driver. 
>
>The problem could be insufficient memory, or a swapper file that is 
>too small, depending on a lot of things. Try adding memory, and/or 
>increase the default size of the swapper file (the SWAPPATH statement,
>in CONFIG.SYS).
>
>Hope this helps...
>******************************
>From the PC of Doug Bissett
>doug.bissett at attglobal.net
>The " at " must be changed to "@"
>******************************

----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (tomodea@usa.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: tvv@sbs.kiev.ua                                   21-Oct-99 12:56:21
  To: All                                               21-Oct-99 14:39:10
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

From: tvv@sbs.kiev.ua (Vit Timchishin)

Try to disable smothtext in preferences (And may be other drawing options).

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Navigator Online Internet News Server (1:109/42)

+----------------------------------------------------------------------------+

From: tomodea@DeleteThisToSendMail.usa...               22-Oct-99 00:10:19
  To: All                                               21-Oct-99 14:39:10
Subj: Re: Ghostscript/GSView - OS/2 Warp V3 - Landscape Printing

Message sender: tomodea@DeleteThisToSendMail.usa.net

From: "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net>

John,
Good suggestion.

I tried this and had some success, but....

With GSView there are a number of printers I can choose from.  The REAL
Printer I am using is an IBM ExecJet 4072.  However, this is not on the
GSView list.  The only printer types that will work with GSView where I can
get anything printed on the 4072 are: BJE10 and OS2PRN. 

When I select BJE10, the printing still comes out as Portrait even though I
am sending it to a new printer object with Landscape in the Job Properties. 
I even verified that the printer definition is correct by dropping a text
file on the printer and seeing it printed sideways, so I know that the
printer definition is OK.  It looks like GSView is insisting that the Print
job is handled as Portrait and the Job Properties has no effect.

When I select OS2PRN, the printing comes out as Landscape.  However, instead
of black on white as expected, I get white on black.  In other words, the
print orientation is Landscape but the image is reversed!!!!  If I could only
figure out a way of telling GSView to reverse the image....

Tom


On Wed, 20 Oct 1999 18:15:22 GMT, John Thompson wrote:

>In <gbqrnvozarg.fjxj9wc.pminews@news1.ibm.net>, "Tom O'Dea"
<todea@DeleteThisToSendMail.ibm.net> writes:
>
>>I'm looking for help in how to get Ghostscript/GSView to print PDF documents
>>in landscape mode.
>
>You should be able to change this in the "Job Properties" for the
>printer driver in the printer object.  You can either do this on 
>an "as needed" basis or create a new printer object with 
>landscape orientation as the default.
>
>-John (John.Thompson@attglobal.net)
>









----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (tomodea@usa.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: tomodea@DeleteThisToSendMail.usa...               22-Oct-99 00:19:27
  To: All                                               21-Oct-99 14:39:11
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

Message sender: tomodea@DeleteThisToSendMail.usa.net

From: "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net>

Vit,
Thanks.  I never thought of looking at those options.  I'll try it.

Tom

On 21 Oct 1999 12:56:42 GMT, Vit Timchishin wrote:

>Try to disable smothtext in preferences (And may be other drawing options).

----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (tomodea@usa.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: frank.palmisano@ssa.gov                           21-Oct-99 10:12:02
  To: All                                               21-Oct-99 14:39:11
Subj: Re: Is there a Kill Command?

From: "Frank" <frank.palmisano@ssa.gov>

    Thanks for the lead but I need to know if there is something intrinsic
in OS/2 to provide this functionality.  I already have some freeware to do
it but it is a long story....

Thanks


Adrian Gschwend <nospam_ktk@netlabs.org> wrote in message
news:xgxargynofbet.fjyoyx0.pminews@news.aart.ch...
> On Wed, 20 Oct 1999 19:56:45 -0500, Frank wrote:
>
> >I don't use OS/2 now although I did at one time.  I seem to recall there
was
> >a command or facility to completely remove a file such that it could not
be
> >recovered (similar to what might be accomplished with Norton WipeFile).
Can
> >anyone confirm this?
>
> I think there is a tool called blackhole, check http://hobbes.nmsu.edu and
> serach for it.
>
> cu
>
> Adrian
>
>
> ---
> Adrian Gschwend
> @ OS/2 Netlabs
>
> ICQ: 22419590
> ktk@netlabs.org
> -------
> The OS/2 OpenSource Project:
> http://www.netlabs.org
>
>


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Social Security Administration (1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 21-Oct-99 14:58:08
  To: All                                               21-Oct-99 14:39:11
Subj: Re: Upgrade PMMail from v2.0 to v2.1?

From: zayne@omen.com.au (Mooo)

engs0011@sable.ox.ac.uk (Ian Johnston) wrote:

>: There is at least one improvement.  You no longer get black 'blobs' at
>: the end of every line when you print an email on an HP LJ :)
>
>I've been printing to a LJ1100 from PMMAil v2.0 for ages without ever seeing
>these blobs.

wow!  I too have been using an 1100 for ages and I got this from day
one!  I wonder if its driver related or some other weird internal
difference.

craig

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nothing I say is my own opinion (1:109/42)

+----------------------------------------------------------------------------+

From: nospam_ktk@netlabs.org                            21-Oct-99 17:24:03
  To: All                                               21-Oct-99 14:39:11
Subj: Re: Is there a Kill Command?

From: "Adrian Gschwend" <nospam_ktk@netlabs.org>

On Thu, 21 Oct 1999 10:12:04 -0500, Frank wrote:

>    Thanks for the lead but I need to know if there is something intrinsic
>in OS/2 to provide this functionality.  I already have some freeware to do
>it but it is a long story....

ah, I see. I don't know about built in functionality, maybe you should ask in
comp.os.os2.programmer.* 

cu

Adrian


---
Adrian Gschwend
@ OS/2 Netlabs

ICQ: 22419590
ktk@netlabs.org
-------
The OS/2 OpenSource Project:
http://www.netlabs.org


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: OS/2 Netlabs (1:109/42)

+----------------------------------------------------------------------------+

From: jkobal@NOSPAMus.ibm.com                           21-Oct-99 12:11:08
  To: All                                               21-Oct-99 16:48:11
Subj: Re: SYS3175 in PMMERGE with Comm/2 4.61 GA

From: "Jeffrey S. Kobal" <jkobal@NOSPAMus.ibm.com>

Dave Parsons wrote:

> Since upgrading to the GA version of Comm/2 4.61 and also FP12
> I have started to get crashes using Netscape when doing nothing
> special, just starting to download a new page.
>
> 10-16-1999  10:11:30  SYS3175  PID 0334  TID 0001  Slot 0060
> E:\NETSCAPE\PROGRAM\NETSCAPE.EXE
> c0000005
> 1bdfdef1
> P1=00000001  P2=00000103  P3=XXXXXXXX  P4=XXXXXXXX
> EAX=178f0028  EBX=0000057c  ECX=00000060  EDX=00000584
> ESI=00000584  EDI=000000ff
> DS=0053  DSACC=d0f3  DSLIM=1fffffff
> ES=0053  ESACC=d0f3  ESLIM=1fffffff
> FS=150b  FSACC=00f3  FSLIM=00000030
> GS=3503  GSACC=10f3  GSLIM=00003fff
> CS:EIP=005b:1bdfdef1  CSACC=d0df  CSLIM=1fffffff
> SS:ESP=0053:007c60f8  SSACC=d0f3  SSLIM=1fffffff
> EBP=007c6128  FLG=00012206
>
> PMMERGE.DLL 0004:000fdef1

> Is the fault in NC/2 GA or pmmerge from FP12?

I'm afraid it looks like a problem in the FP12 PMMERGE, as
far as I can tell.  At this instruction, the EDI register should be
holding a pointer to the next free block on the heap, but it is
not a valid pointer.  Communicator should not be able to
corrupt the free chain in a PM heap, so I'd have to assume
that a bug was introduced in FP12.

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Corporation (1:109/42)

+----------------------------------------------------------------------------+

From: martin.schaffoener@student.uni-m...               21-Oct-99 19:48:18
  To: All                                               21-Oct-99 16:48:11
Subj: Re: Sun StarOffice and PGP???

Message sender: martin.schaffoener@student.uni-magdeburg.de

From: martin.schaffoener@student.uni-magdeburg.de (Martin Schaffner)

On Mon, 18 Oct 1999 12:03:51, 
martin.schaffoener@student.uni-magdeburg.de (Martin Schaffner) wrote:

> On Mon, 4 Oct 1999 01:30:04, "RichS" <worlock@frontiernet.net> wrote:
> 
>  >I just talked to one of the StarOffice developers this weekend and 
> > >here is what I picked up "by accident":  The hooks are all in there 
> > >and they would work if there was a native PGP interface in os/2.  
> > >There is one on Windows in the winpgp.dll or something like that.  
> > >Now, he said that SUN would not sit down and write this interface, 
> > >which I can understand as it is not their job, but if we could find 
> > >anybody to do it, we would have pgp-enabled staroffice.
> > 
> > That's great news! Thanks... Now if we could find someone to write it? And
> > would Sun be willing to give up the information needed? Or a StarOffice
api
> > library of sorts... At least there's hope...
> >
> 
> Well, there actually seems to be an api planned, called StarOne or so.
>  There used to be a c-toolkit and starone is supposed to be based on 
> that.  I'll be in contact with somebody from stardivision, I hope ...
> 

Bad style to follow-up to my own post, but I just found something very
interesting:  Take a look at the office51\help\starone\ directory...  
Not the environment yet, but some very interesting slides.

Martin Schaffner

Suzuki GS650G Katana
OS/2 Warp 4 with FixPak 11
There are currently 33 processes
with 118 threads active.
This machine's uptime 0h 58min 53sec.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Otto-von-Guericke-Universitaet Magdeburg (1:109/42)

+----------------------------------------------------------------------------+

From: isaacl@bulls.ece.ubc.ca                           21-Oct-99 19:22:04
  To: All                                               21-Oct-99 16:48:12
Subj: Re: Is there a Kill Command?

From: isaacl@bulls.ece.ubc.ca (e-frog)

Adrian Gschwend (nospam_ktk@netlabs.org) wrote:
: On Thu, 21 Oct 1999 10:12:04 -0500, Frank wrote:

: >    Thanks for the lead but I need to know if there is something intrinsic
: >in OS/2 to provide this functionality.  I already have some freeware to do
: >it but it is a long story....

: ah, I see. I don't know about built in functionality, maybe you should ask
in
: comp.os.os2.programmer.* 

Okay, this is a bit off-topic and not the right "kill", but here is the
best kill command ever, IMHO :)

http://www.cs.unm.edu/~dlchao/flake/doom/

I wonder if it could be ported to OS/2? Doom/2 made it, why not the kill?


Isaac

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ITServices, University of British Columbia (1:109/42)

+----------------------------------------------------------------------------+

From: rde@tavi.co.uk                                    21-Oct-99 19:32:11
  To: All                                               21-Oct-99 16:48:12
Subj: Re: cdwriter support

From: rde@tavi.co.uk (Bob Eager)

On Sat, 9 Oct 1999 12:34:57, "Dale Curren" <dcurren@ibm.net> wrote:

> But it costs nearly 200 dollars!!!

You get what you pay for.

1) A CDR/W filing system, as an IFS. Mount the CD as a drive and do 
whatever you want. FORMAT erases rewritables as you'd expect. CHKDSK 
works...everything.

2) A track copier. Will copy tracks to image files on hard disk for 
small scale copying.

It's cheapest (or was) via BMT Micro.

-- 
Bob Eager
rde at tavi.co.uk
PC Server 325; PS/2s 8595*3, 9595*3 (2*P60 + P90), 8535, 8570, 9556*2,
8580*6,
8557*2, 8550, 9577, 8530, P70, PC/AT..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tavi Systems (1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    20-Oct-99 11:04:05
  To: All                                               21-Oct-99 16:48:12
Subj: Re: Bios/Large HD Install Question

From: "seth berk" <snberk@ibm.net>

On Tue, 19 Oct 1999 16:17:06 -0400, Brad BARCLAY wrote:

>seth berk wrote:
>> Now you tell me... actually, I managed to find a site that listed
>> model numbers, so I could cross reference that manufacturers, that
>> lead to the ASUS site (Thank you Dogpile - search terms were "Triton
>> Award Bios") and well, now I have an updated Bios that is both Y2K (I
>> hope - I guess I should check) compliant and recognizes the HD.
>
>	Well, if you've successfully rebooted the computer, I'd be willing to
>say it obviously worked :).
>
>	I just can't caution everyon enough, however, on making certain that
>they have the *exact* correct BIOS flash file that goes with their
>specific motherboard manufacturer and model before attempting to flash
>it.  I have seen many people flash their boards with the wrong flash
>BIOS update only to find afterwards that their board was useless

*Now* you tell me ;-)  As noted, it seemed to have worked.  Although
I managed to flash the bios with the copy of old bios saved to disk
(the process had me save a copy of the original bios to diskette,
then asked for a the name of the file of the new bios.  It was
late... I put in the name of the file I saved the old bios to.  Took
me awhile to figure out why the new bios looked a whole lot like the
old one.


edit edit


>	I really wish that the flash designers could put a fixed model ID
>number into their cihps so that the flashing programs can verify that
>the flash BIOS file matches the intended motherboard model number.  This
>would cut down on user errors resulting in useless hardware.

But then they wouldn't sell as many boards!

-more editing

>	Three laws of computer science:
>
>		1) You can never have too much storage space,
>		2) You can never have too many available CPU cycles,
>		3) You can never have enough bandwidth.
>
>	IMHO, the more, the merrier! :).
>

I'll second that

Thanks for the reply

Seth


>Brad BARCLAY
>
>=-=-=-=-=-=-=-=-=-=
>Posted from the OS/2 WARP v4.5 desktop of Brad BARCLAY.
>E-Mail:  bbarclay@ca.ibm.com		Location:  2G43D@Torolabs



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jan.hartman@fil.lu.se                             21-Oct-99 22:41:21
  To: All                                               21-Oct-99 20:06:28
Subj: Re: Ghostscript/GSView - OS/2 Warp V3 - Landscape Printing

From: "Jan Hartman" <jan.hartman@fil.lu.se>

On Wed, 20 Oct 1999 21:39:32 +1100 (EDT), Tom O'Dea wrote:

:>I'm looking for help in how to get Ghostscript/GSView to print PDF documents
:>in landscape mode.
:>
:>I recently installed Ghostscript/GSView under OS/2 Warp V3.  I did this
:>because I couldn't get Acrobat Reader for OS/2 to work (subject of a
separate
:>post).  I got Ghostscript and GSView working OK, and I can view PDF files
OK.
:> I can also print pages from a PDF as long as the pages are Portrait. 
:>However, when I try to print pages which are Landscape, the page is printed
:>with a Portrait orientation, i.e. the right hand part of the page is lost.
:>
:>GSView allows you to change the orientation of the pages on the display, but
:>this makes no difference to how the pages are printed.  I cannot find
:>anything in the documentation for Ghostscript or GSView that will allow me
to
:>change the orientation of the page on the printer.
:>
:>Any suggestions? 
:>
:>Thanks,
:>Tom
:>
I am no experto on this, but have you tried changing to landscape
in the settings for the printer driver?

/ Jan


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Lund University (1:109/42)

+----------------------------------------------------------------------------+

From: bbarclay@ca.ibm.com                               21-Oct-99 16:48:24
  To: All                                               21-Oct-99 20:06:28
Subj: Re: Bios/Large HD Install Question

From: Brad BARCLAY <bbarclay@ca.ibm.com>

seth berk wrote:
> >       I just can't caution everyon enough, however, on making certain that
> >they have the *exact* correct BIOS flash file that goes with their
> >specific motherboard manufacturer and model before attempting to flash
> >it.  I have seen many people flash their boards with the wrong flash
> >BIOS update only to find afterwards that their board was useless
> 
> *Now* you tell me ;-)  As noted, it seemed to have worked.  Although
> I managed to flash the bios with the copy of old bios saved to disk
> (the process had me save a copy of the original bios to diskette,
> then asked for a the name of the file of the new bios.  It was
> late... I put in the name of the file I saved the old bios to.  Took
> me awhile to figure out why the new bios looked a whole lot like the
> old one.

	Heh heh - I love it when I do that :).

	Saving the old BIOS is almost a sort of sick joke:  if the new BIOS
totally busticates your system, you won't be able to boot your system up
to resport the old BIOS.  Such backups are useful if the new BIOS
introduces a minor bug, and you need to backout, but it doesn't protect
anyone who installs the wrong BIOS update.

	Oh well - as I mentioned, you obviously got everything right - so none
of this pertains to you :).

Brad BARCLAY

=-=-=-=-=-=-=-=-=-=
Posted from the OS/2 WARP v4.5 desktop of Brad BARCLAY.
E-Mail:  bbarclay@ca.ibm.com		Location:  2G43D@Torolabs

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Toronto Labs, DB2 for OS/2 Install Developer (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@auerbach_at_unity.ncsu.edu                 21-Oct-99 17:09:03
  To: All                                               21-Oct-99 20:06:28
Subj: Re: 1999 tax preparation software for OS/2???

From: nospam@auerbach_at_unity.ncsu.edu

I order AM-Tax again and also queried them about their move from DOS to
WIndoze.  Here's what I got:

Thank you for your comments.  We do realize that a good number of our
customers are like yourself, people who know what they are doing and
appreciate the inherent strengths of a DOS based program.

We appreciate your situation and would love to maintain both a DOS and
Windows version, if it were feasible; And while we have not made any
design decisions that would preclude offering both versions, when we look
at everything involved it just doesn't appear to be a very realistic
prospect. Also, while we can't go into details, the design we envision
for the program would make an OS/2 version unlikely.

Sorry we couldn't bring you better news. We feel it is important that you
have accurate information regarding our future plans and hope you
appreciate our honesty.

We do thank you for your comments and thank you again for choosing
AM-Tax!


-- 
                                         Regards, 
                                         David
What is patriotism but the love of the good things we ate in our childhood.
	-Lin Yutang
"What would life be without arithmetic, but a scene of horrors?"
                       -Rev. Sydney Smith, letter to young lady, 22 July 1835


-----------------------------------------------------------
David Auerbach                   nospam@auerbachatunity.ncsu.edu            
Department of Philosophy & Religion
NCSU
Box 8103
Raleigh, 27695-8103
-----------------------------------------------------------




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Duke University, Durham, NC, USA (1:109/42)

+----------------------------------------------------------------------------+

From: bosmith@ismi.net                                  21-Oct-99 17:44:01
  To: All                                               21-Oct-99 20:06:28
Subj: Sending Binary Files via sendmail?

From: bosmith <bosmith@ismi.net>

I am running Warp v3.0 with the IBM TCPIP stack.  I use sendmail to
email text reports to users and it works quite well.  I now have a need
to send a binary file (an Excel spreadsheet) and find that sendmail
won't deliver it properly.

Can anybody suggest a way to get this done outside of manually mailing
the report?

All thoughts deeply appreciated.

Bob Smith
Univ of Michigan - Hospital Financial Services
Ann Arbor, MI 48109
bosmith@umich.edu


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: DAMNSPAMMERSks@karicobs.com                       21-Oct-99 22:00:26
  To: All                                               21-Oct-99 20:06:28
Subj: Sending Binary Files via sendmail?

From: DAMNSPAMMERSks@karicobs.com (ks@karicobs.com)

Thursday October 21 1999 17:44, bosmith wrote to All:

 b> I am running Warp v3.0 with the IBM TCPIP stack.  I use sendmail to
 b> email text reports to users and it works quite well.  I now have a
 b> need to send a binary file (an Excel spreadsheet) and find that
 b> sendmail won't deliver it properly.

Which client are you using? Sounds like an encoding problem.

 KS


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bbs.karicobs.com - Toronto, Canada (1:109/42)

+----------------------------------------------------------------------------+

From: reiknir@my-deja.com                               21-Oct-99 22:19:25
  To: All                                               21-Oct-99 21:24:22
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

From: reiknir@my-deja.com

In article <gbzbqrnhfnarg.fjzkjw2.pminews@news1.ibm.net>,
  "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net> wrote:
> Doug,
> Thanks for the suggestions.
>
> I've tried reinstalling Acrobat reader.  I've also tried updating the
video
> driver.  I suspect it's memory.  I would like to add more, but the PC
only
> supports 16MB max.

hmm that means you have either a IBM or cyrix 486 SLC..(ca 1994)
time for a motherboard swap, since you will have trouble with this
configuration at the turn of the century. (that may not be a big issue
if you are not running any database or accouniting apps)
surplus dealers are adwertising new pentium boards with 166 processor
and 32mb memory for less tha USD 100 all ower the world, even in the
sillier parts of it like the US or Au.   ......


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: ernfisch@home.com                                 21-Oct-99 22:36:22
  To: All                                               21-Oct-99 21:24:22
Subj: Re: NICs: which have good OS/2 drivers?

From: ernfisch@home.com (Ernie Fisch)

On Thu, 21 Oct 1999 07:16:02, peter@seagoon.newcastle.edu.au (Peter 
Moylan) wrote:

> 
> I'm using a D-Link DE-530CT+, and I'm perfectly satisfied with it.
> For 10/100 you'd need a different model - I've forgotten the model
> number, but I've tried it and it worked fine with OS/2.  Installing
> the driver was completely trouble-free.

I am using the D-Link DFE-530TX which is a 10/100 adapter.  I 
downloaded the drivers
(called OS/2 patch, I believe) off of the D-Link site.  The card 
installed with no problem.
Another member of POSSI did the same.  It is my connection to the net.

ernie fisch

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   21-Oct-99 17:06:14
  To: All                                               21-Oct-99 21:24:22
Subj: Re: Sending Binary Files via sendmail?

From: Kris Kadela <kris@dgraph.com>


bosmith wrote:
> 
> I am running Warp v3.0 with the IBM TCPIP stack.  I use sendmail to
> email text reports to users and it works quite well.  I now have a need
> to send a binary file (an Excel spreadsheet) and find that sendmail
> won't deliver it properly.
> 
> Can anybody suggest a way to get this done outside of manually mailing
> the report?
> 
> All thoughts deeply appreciated.

Sendmail only works with ascii only, no matter what version or platform.
Binary encoding (mime, etc...) is the resposibility of the client app.
uuencode the file first, then whoever gets it will have to uudecode.


> 
> Bob Smith
> Univ of Michigan - Hospital Financial Services
> Ann Arbor, MI 48109
> bosmith@umich.edu

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: centus@coqui.net                                  21-Oct-99 23:05:22
  To: All                                               21-Oct-99 21:24:22
Subj: Re: Help!, What is missing here??? Was: No joystick detected.....

From: centus@coqui.net

Ok, installed a OnSpeed CS4280-based PCI sound card.  Installed driver
CWOS2303.ZIP.
Card is detected by BIOS and by OS/2.  CD Audio works ok, system 
sounds works ok, BUT
joysitick is not detected.  I include the devices calls in the 
config.sys:
BASEDEV=CWGMSG.SYS
BASEDEV=CWCSPUD.SYS
BASEDEV=CWCMMPM.SYS /N:CWCAUD1$
DEVICE=C:\MMOS2\CWGUTIL.SYS 
DEVICE=C:\MMOS2\CWWINVDD.SYS
RUN=C:\MMOS2\CWCUTIL.EXE 
RUN=C:\MMOS2\CWDAEMON.EXE
DEVICE=C:\MMOS2\OPL3.SYS /N:OPL31$

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: peter@seagoon.newcastle.edu.au                    21-Oct-99 23:22:17
  To: All                                               21-Oct-99 21:24:22
Subj: Re: Sending Binary Files via sendmail?

From: peter@seagoon.newcastle.edu.au (Peter Moylan)

bosmith <bosmith@ismi.net> wrote:
>I am running Warp v3.0 with the IBM TCPIP stack.  I use sendmail to
>email text reports to users and it works quite well.  I now have a need
>to send a binary file (an Excel spreadsheet) and find that sendmail
>won't deliver it properly.

It's not just sendmail.  All SMTP implementations will have trouble
with binary files, because the SMTP standard is built around the
assumption that e-mail is "plain text".
>
>Can anybody suggest a way to get this done outside of manually mailing
>the report?

You need to preprocess the file to convert it into a mailable format
like Base64 or UUencode.  The usual e-mail client programs (PMMail,
MR/2 ICE, etc.) can do this automatically for you when you use their
"attachment" option.  (And almost anything your users are likely to
be running will be able to decode the attachments.)

If you want to stick with direct use of sendmail, you'll need to find
encoding software that will do the conversion.  I've just taken a
quick look on Hobbes and noticed a program called dev/rexx/base64.zip
- I've never tried this, but it looks as if it's what you need.
Further poking around on Hobbes will probably turn up some other
options.

-- 
Peter Moylan                                         peter@ee.newcastle.edu.au
See http://eepjm.newcastle.edu.au for OS/2 information and software

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: solune@netaxs.com                                 22-Oct-99 00:28:07
  To: All                                               22-Oct-99 02:30:00
Subj: Re: Unsupported Java

From: solune@netaxs.com

On Thu, 21 Oct 1999 07:47:57, l_luciano@da.mob (Stan Goodman) wrote:

> What version of Java are you running that these web pages think is 
> unsupported? If you have not installed anything later than "Java for OS/2",
> which is version 1.02, the pages are probably right. If that is so, you 
> need to install something more modern. The current version is 1.1.8.
> 
according to the syslevel, i'm running version 1.10.

My main question, is to support a later version, do I have to download
*everything* on the software choice site? there are a lot of megs of 
stuff to download, so if Idon't need it all, I don't want to burn 
time.

Pete

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: newsread.com ISP News Reading Service (http://www
(1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  21-Oct-99 20:53:24
  To: All                                               22-Oct-99 02:30:00
Subj: Re: Unsupported Java

From: mchasson@ibm.net

In <yuCf4DrVOd31-pn2-gMcpqBbNkCJV@ppp17.blackbox1-mfs.netaxs.com>, on
10/22/99 at 12:28 AM,
   solune@netaxs.com said:

>On Thu, 21 Oct 1999 07:47:57, l_luciano@da.mob (Stan Goodman) wrote:

>> What version of Java are you running that these web pages think is 
>> unsupported? If you have not installed anything later than "Java for OS/2",
>> which is version 1.02, the pages are probably right. If that is so, you 
>> need to install something more modern. The current version is 1.1.8.
>> 
>according to the syslevel, i'm running version 1.10.

>My main question, is to support a later version, do I have to download
>*everything* on the software choice site? there are a lot of megs of 
>stuff to download, so if Idon't need it all, I don't want to burn  time.

>Pete

No. you only need the runtime package and the swing package-maybe.

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           22-Oct-99 01:04:05
  To: All                                               22-Oct-99 02:30:00
Subj: Re: NICs: which have good OS/2 drivers?

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Thu, 21 Oct 1999 05:04:00, "John W. Hardy" <jwhardy@attglobal.net> 
wrote:

> Hello;
> 
> I would like to get a 10/100 network kit, typically a 5-port hub with
> two NICs. 3COM NICs are pricey, so I've been looking at D-Link and
> Linksys. Drivers are available on the OS/2 site, but they seem rather
> dated and may not be appropriate for the latest NICs. No mention of OS/2
> on the D-Link and Linksys sites. Any suggestions? I'm willing to buy
> 3COM if necessary, but I'm sure I've heard of others that are cheaper
> and have good drivers. Thank you.

I have two machines, connected to the Internet with a hub and
cable modem.

One machine Pentium 233 uses a D-Link DFE530TX 10/100 card
using the drivers from the D-Link web site. This machine is running
Warp 4 FP 12 and no problems have occured with the card or driver.

The second machine is a dual 400 Mhz Pentium II box using an
OvisLink 10/100 card that is based on an RTL8139 chipset. Drivers
were included with the card and both the card and drivers work OK.
The drivers included with the card had an incorrect .NIF file so
I had to download the driver set from the Realtek web site. This
machine is running Warp Server for e-Business SMP.

This machine originally had another DFE530TX card but there
was a problem with card/driver under WSeB SMP. The copying
of large files between the two machines would fail with a
"insufficient disk space" message using the Warp 4 file and
print services client to the server drive. The NETBIOS protocol
was used for the connection between the two machines.

Lorne Sunley


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jwhardy@attglobal.net                             21-Oct-99 20:32:21
  To: All                                               22-Oct-99 02:30:00
Subj: Re: NICs: which have good OS/2 drivers?

From: "John W. Hardy" <jwhardy@attglobal.net>

To All;

Thanks for the NIC recommendations. I just ordered a D-Link network kit,
#DFE-910 (5-port hub and two 10/100 PCI cards), so I should be in great
shape.

John

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Exovede@ImpaleTheSpammers.Com@Vi...               22-Oct-99 02:03:14
  To: All                                               22-Oct-99 02:30:00
Subj: Re: Is there a Kill Command?

Message sender: Exovede@ImpaleTheSpammers.Com@Videotron.ca

From: Exovede@ImpaleTheSpammers.Com@Videotron.ca (Michel A Goyette)

Thu, 21 Oct 1999 00:56:45, "Frank" <fpalmis@mailandnews.com> a crit:

> I don't use OS/2 now although I did at one time.  I seem to recall there was
> a command or facility to completely remove a file such that it could not be
> recovered (similar to what might be accomplished with Norton WipeFile).  Can
> anyone confirm this?

	If you use the "/F" switch on the "Del" command to erase your 
file(s), they can't be recovered.  However, I wonder up to which point
they can't.  ;-)

Salut,

	Michel (sur OS/2 Warp 4.07)
	ICQ #13376913
	http://pages.infinit.net/exovede

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           21-Oct-99 22:51:05
  To: All                                               22-Oct-99 02:30:00
Subj: Re: EscapeGL 3.0 and OpenGL problems...

From: "RichS" <worlock@frontiernet.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: lazaga1@attglobal.net                             21-Oct-99 20:43:14
  To: All                                               22-Oct-99 02:30:00
Subj: Re: NICs: which have good OS/2 drivers?

From: Paul Lazaga <lazaga1@attglobal.net>


>>>>>>>>>>>>>>>>>> Original Message <<<<<<<<<<<<<<<<<<

On 21.10.99, 5:04:00, "John W. Hardy" <jwhardy@attglobal.net> wrote 
regarding NICs: which have good OS/2 drivers?:


> Hello;

> I would like to get a 10/100 network kit, typically a 5-port hub with
> two NICs. 3COM NICs are pricey, so I've been looking at D-Link and
> Linksys. Drivers are available on the OS/2 site, but they seem rather
> dated and may not be appropriate for the latest NICs. No mention of 
OS/2
> on the D-Link and Linksys sites. Any suggestions? I'm willing to buy
> 3COM if necessary, but I'm sure I've heard of others that are cheaper
> and have good drivers. Thank you.

> John

I recently installed 2 Linksys LNE100TX and was up and running in less 
than  hour total with the provided drivers.

-- 
Paul Lazaga, eMail: lazaga1@attglobal.net
WTW Group, Los Gatos, California, USA
Tel: 408-378-8636, Fax: 408-378-5927
Web: http://www.wtwgroup.com



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           21-Oct-99 22:53:02
  To: All                                               22-Oct-99 02:30:01
Subj: Problem fixed! Re: EscapeGL 3.0 and OpenGL problems...

From: "RichS" <worlock@frontiernet.net>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

Gees, I hate to replay to myself.....

But just in case anyone might get the idea that there's a problem with
excapegl, I figured I'd post an update...

I check my system with Unimaint on a regular basis and usually find no major
problems. Since this odd behavior with excapegl, I decided to give checkini a
try. Good grief what a list of problems it found. Mostly harmless, some very
odd (like os2.ini hvaing two object ID's). I did a backup and let it fix most
of the problems. Some I didn't understand what the consequence of the fix
would be and passed on this time around.

I reinstalled the newer version of opengl and rebooted to find that ecapegl
finally works as advertised! I haven't had the time to really give it a
thorough test, and haven't tried the random mode yet, but it deffinitely does
work now!

Although this may not be overly good news for me (why were there so many
problems in my system and why didn't Unimaint find them!), it's good news to
anyone thinking about EscapeGL and their new version 3.0... Boy, some of
those modules are great!

Rich...



On Thu, 21 Oct 1999 09:08:15 -0400 (EDT), RichS wrote:

>-----BEGIN PGP SIGNED MESSAGE-----
>Hash: SHA1
>
>Yes I'm using the random mode. To me, that is the whole point of the program
>to switch to different modules. I really hate seeing the same thing over and
>over on the screen... But besides the point, the problem also occur when
>having only one module selected.
>
>I did finally ask for support from Snow Storm and got a quick reply. They
>suggested I try the ogl9635 files (older version) rather than the oglgold I
>was running. So far, it doesn't look like that helped any. I've also updated
>to fixpack 12 and the driver fp1. Didn't help either... I have to do a bit
>more testing and then get back to them...
>
>Thanks...
>
>On Thu, 21 Oct 1999 20:15:36 +1300 (NZDT), Brian King wrote:
>
>>On Tue, 19 Oct 1999 09:11:52 -0400 (EDT), RichS wrote:
>>
>>>No, I didn't want to go that route until necessary and I had a chance to
get
>>>things working myself. They gave the impression that opengl problems were
not
>>>their thing, but maybe not?
>>
>>Are you using random mode...because this has caused problems in the past!!!!
>>-----------------------------------------------------------------------------
--------------
>>Brian King
>>baking@nznet.gen.nz
>>
>>OS/2 Warp 4 advocate and fulltime listener of  NZ music...
>>Helensville, New Zealand.
>>-----------------------------------------------------------------------------
--------------
>>
>>
>
>******************************************************************************

>Practice Random Acts of Kindness and Senseless...Umm...Uhh....
>Oh - Heck...I never could remember all that "nice" stuff.
>-
-----------------------------{worlock@frontiernet/net}-------------------------
-------
>******************************************************************************

>
>
>
>-----BEGIN PGP SIGNATURE-----
>Version: PGPfreeware 5.0 OS/2 for non-commercial use
>Comment: PGP 5.0 for OS/2
>Charset: noconv
>
>wj8DBQE4DwJSJUo5KMjfuWMRAvMCAJ4vbMjtEJmk2gJ/vpgxq6oNLoL8qQCgjhxk
>N1Yj6GQMafs6X103aG12Pmw=
>=thMw
>-----END PGP SIGNATURE-----
>

******************************************************************************
Practice Random Acts of Kindness and Senseless...Umm...Uhh....
Oh - Heck...I never could remember all that "nice" stuff.
-
-----------------------------{worlock@frontiernet/net}-------------------------
-------
******************************************************************************



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: noconv

wj8DBQE4D8OdJUo5KMjfuWMRAr6fAKDS37sLuHRlX9YLlLidTOeQFXtMDACg/lh7
5+NQoh48DVQgunRJRkcxp3Y=
=fx1n
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@sancoatjpsdotnet.void                      21-Oct-99 10:40:00
  To: All                                               22-Oct-99 05:24:02
Subj: Re: Adobe Reader V.3 and NS4.16 -- How...?

From: nospam@sancoatjpsdotnet.void (Sander Nyman)

On 10/20/99 at 08:21 PM, dtander@agts.net (David T. Anderson) said:

>I've installed the Adobe Actobat Reader V.3 and gotten it set up to  work
>as a helper app with Netscape 4.16.  While this is satisfactory,  I seem
>to recall that it can be set up to work within Netscape as a  plugin. 
>However fiddling with the dlls doesn't seem to have any  effect...it
>appears that something has changed in Netscape since the  v.3 Reader was
>introduced.

>_Is_ there a way to install the Reader as a plugin?  If so, could 
>someone tell me how?
>Thanks in advance...

Check the Netscape PLUGINS folder for the file NPPDFOS2.DLL.  If it is not
there, copy it over to PLUGINS.

The next time you open Communicator, click on Help, and then, About
Plugins.  You should see Acrobat listed.

Sander Nyman

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jwhardy@attglobal.net                             21-Oct-99 23:44:23
  To: All                                               22-Oct-99 05:24:02
Subj: Re: NICs: which have good OS/2 drivers?

From: "John W. Hardy" <jwhardy@attglobal.net>

Paul;

> I recently installed 2 Linksys LNE100TX
> and was up and running in less 
> than  hour total with the provided drivers.

I just ordered a D-Link network kit, but it's good to know that Linksys
works with OS/2 as well. I'll try Linksys if I need more cards. Thanks
for the information.

John

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: nospam@sancoatjpsdotnet.void                      21-Oct-99 10:57:05
  To: All                                               22-Oct-99 05:24:02
Subj: Re: EscapeGL 3.0 and OpenGL problems...

From: nospam@sancoatjpsdotnet.void (Sander Nyman)

On 10/21/99 at 09:08 AM, "RichS" <worlock@frontiernet.net> said:

>Yes I'm using the random mode. To me, that is the whole point of the
>program to switch to different modules. I really hate seeing the same
>thing over and over on the screen... But besides the point, the problem
>also occur when having only one module selected.

>I did finally ask for support from Snow Storm and got a quick reply. They
>suggested I try the ogl9635 files (older version) rather than the oglgold
>I was running. So far, it doesn't look like that helped any. I've also
>updated to fixpack 12 and the driver fp1. Didn't help either... I have to
>do a bit more testing and then get back to them...

Rich, please let us know what you come up with, since I will likely
upgrade to v3.0.  BTW, I am a big fan of random mode as well.  ;->

Sander Nyman

>On Thu, 21 Oct 1999 20:15:36 +1300 (NZDT), Brian King wrote:

>>On Tue, 19 Oct 1999 09:11:52 -0400 (EDT), RichS wrote:
>>
>>>No, I didn't want to go that route until necessary and I had a chance to
get
>>>things working myself. They gave the impression that opengl problems were
not
>>>their thing, but maybe not?
>>
>>Are you using random mode...because this has caused problems in the past!!!!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dwparsons@t-online.de                             22-Oct-99 08:26:23
  To: All                                               22-Oct-99 05:24:03
Subj: Re: SYS3175 in PMMERGE with Comm/2 4.61 GA

From: dwparsons@t-online.de (Dave Parsons)

On Thu, 21 Oct 1999 17:11:16, "Jeffrey S. Kobal" <jkobal@NOSPAMus.ibm.com>
wrote:

> 
> Dave Parsons wrote:
> 
> > Since upgrading to the GA version of Comm/2 4.61 and also FP12
> > I have started to get crashes using Netscape when doing nothing
> > special, just starting to download a new page.
> >
> 
> > Is the fault in NC/2 GA or pmmerge from FP12?
> 
> I'm afraid it looks like a problem in the FP12 PMMERGE, as
> far as I can tell.  At this instruction, the EDI register should be
> holding a pointer to the next free block on the heap, but it is
> not a valid pointer.  Communicator should not be able to
> corrupt the free chain in a PM heap, so I'd have to assume
> that a bug was introduced in FP12.
> 
> Jeffrey S. Kobal
> IBM Corporation
> 

Thanks Jeff,
I'll continue with the setup as it is for now and go back to
PMMERGE from FP11 if it becomes too frequent. 

-- 
Dave

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDL (1:109/42)

+----------------------------------------------------------------------------+

From: j.welton@mailcity.com                             22-Oct-99 07:00:09
  To: All                                               22-Oct-99 05:24:03
Subj: PMView 2.0?

From: j.welton@mailcity.com

I thought the final release of PMView 2.0 would be out by now.  I
remember reading in these newsgroups that it was to be released at the
time of Warpstock.  According to the PMView web site the author offered
a pair of floppies with a special version of PMView 2.0 just for
Warpstock attendees.

I'm a registered user of PMView 1.05 and after a very bad experience
using beta software, in particular, SciTech Display Doctor, I will
never again chance my system with a beta or preview release of anything
and that includes the current beta of PMView 2.0.

My inquiry, therefore, is directed to those who attended Warpstock and
received the exclusive Warpstock only release of PMView 2.0.  What can
we expect in this new version?  Will I be able to create and edit
(video) movies?  Does this PMView 2.0 offer the OS/2 user anything new
or worthwhile or is this long awaited release just an opportunity for
the author to break into the Microsoft OS market with a branched Win32
release?  Will OS/2 users see any major features and improvements?

I bought and registered PMView because it was advertised as a graphics
program that would read/view/edit WordPerfect graphic files (WPG) of
which I have thousands from my old WP5.1 days.  But PMView apparently
sees/edits/saves a type of WPG that I've never seen because it has
never been able to read/edit/save any of my WP5.1 WPG files.  I even
have some WP6.0 graphics and they are not recognized by PMView so I'm
not sure what WPG the author believes works with his product.  Can
someone who has tried the Warpstock exclusive version of PMView 2.0
tell me whether or not this newer product will see/edit/save a WP5.1
WGP graphic file?

Also, if I chose not to upgrade to PMView 2.0 (I don't run any Windows
applications so if this release does little for OS/2 users I'd really
have little reason to chance my current system on a new release) is my
current PMView 1.05 Y2K compliant?

Jeff


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: pandpATattglobal.net                              21-Oct-99 17:00:16
  To: All                                               22-Oct-99 05:24:03
Subj: Re: OS/2 and Rock Ridge Extensions

From: "Philip Nelson" <pandpATattglobal.net>

All,

Thanks for your replies.

I enabled the /W option and read the RedHat CD fine.

Thanks very much.

Phil Nelson
(pandp@attglobal.net)



On Wed, 20 Oct 1999 22:17:54 GMT, Julian Thomas wrote:

>In <cnaqcnggtybonyarg.fjx1860.pminews@news2.attglobal.net>, on 10/20/99 
>   at 03:09 PM, "Philip Nelson" <pandpATattglobal.net> said:
>
>>Is there any piece of software which will allow me to read a CD which
>>utilitises Rock Ridge extensions using the long file names rather than
>>the short equivalents.
>
>>This so that I can copy some data from a CD produced under Linux onto my
>>hard disk and get the long file names.
>
>I haven't tried it to/from Linux, but infozip seems to transport long file
>names fairly well - if zipping and ftp is an option.
> 
>-- 
> Julian Thomas: jt . epix @ net  http://home.epix.net/~jt
> remove letter a for email (or switch . and @)
> Boardmember of POSSI.org - Phoenix OS/2 Society, Inc  http://www.possi.org
> In the beautiful Finger Lakes Wine Country of New York State!
> -- --
> In most countries selling harmful things like drugs is punishable.
> Then howcome people can sell Microsoft software and go unpunished?
>
>
>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  22-Oct-99 08:34:14
  To: All                                               22-Oct-99 10:21:21
Subj: Re: Unsupported Java

From: l_luciano@da.mob (Stan Goodman)

On Fri, 22 Oct 1999 00:28:14, solune@netaxs.com wrote:

> On Thu, 21 Oct 1999 07:47:57, l_luciano@da.mob (Stan Goodman) wrote:
> 
> > What version of Java are you running that these web pages think is 
> > unsupported? If you have not installed anything later than "Java for
OS/2",
> > which is version 1.02, the pages are probably right. If that is so, you 
> > need to install something more modern. The current version is 1.1.8.
> > 
> according to the syslevel, i'm running version 1.10.
> 
> My main question, is to support a later version, do I have to download
> *everything* on the software choice site? there are a lot of megs of 
> stuff to download, so if Idon't need it all, I don't want to burn 
> time.

As someone else has said, you need the runtime package. There are two 
versions of this, one with and one without the Unicode font. If there is 
any chance at all that you will want to view non-English fonts, get the 
latter.

Although the other advice was that "maybe" you need the Swing file, you 
should get it. Applications and even Applets that require it are not 
unusual, and they will not run in the absence of Swing.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: nospam_ktk@netlabs.org                            22-Oct-99 11:04:26
  To: All                                               22-Oct-99 10:21:21
Subj: Re: Problem fixed! Re: EscapeGL 3.0 and OpenGL problems...

From: "Adrian Gschwend" <nospam_ktk@netlabs.org>

On Thu, 21 Oct 1999 22:53:04 -0400 (EDT), RichS wrote:

>Although this may not be overly good news for me (why were there so many
>problems in my system and why didn't Unimaint find them!), it's good news to
>anyone thinking about EscapeGL and their new version 3.0... Boy, some of
>those modules are great!

Great to hear that it is working. I wait with V3.0 until I get SDD/2 with
hardware opengl acceleration, I think then SDD/2 will rock :-)

cu

Adrian


---
Adrian Gschwend
@ OS/2 Netlabs

ICQ: 22419590
ktk@netlabs.org
-------
The OS/2 OpenSource Project:
http://www.netlabs.org


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: OS/2 Netlabs (1:109/42)

+----------------------------------------------------------------------------+

From: csaba.raduly@sophos.com                           22-Oct-99 09:45:00
  To: All                                               22-Oct-99 10:21:21
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

From: Csaba Raduly <csaba.raduly@sophos.com>

Tom O'Dea wrote:
> 
> Berry,
> Thanks.
> 
> I've tried ghostview.  This addresses the performance problem.  I can view a
> PDF which has landscape pages and I can change the orientation on the
display
> but I can't change the orientation when I send a page to the printer.
> 
> Tom

This may be a printer(driver) problem. Try opening the 
properties on the printer and go to Queue options.
Check the "Job dialog before print" checkbox.
This should make a Job properties dialog box pop up
when you print; try changing the orientation there.

HTH
Csaba 
> 
> On Wed, 20 Oct 1999 20:43:16 +0100, G. van der Veer wrote:
> 
[snip]

-- 
-----BEGIN GEEK CODE BLOCK----- 
Version 3.1
GCS/>GMU d- s:- a30 C++$ UL+ P+>+++ L++ E- W+ N++ o? K? w++>$ O++$ M-
V- PS PE Y PGP- t+ 5 X++ R* tv++ b++ DI+++ D++ G- e+++ h-- r-- !y+
-----END GEEK CODE BLOCK----- 

Csaba Raduly,    Software Developer (OS/2),    Sophos Anti-Virus
mailto:csaba.raduly@sophos.com            http://www.sophos.com/
US Support +1 888 SOPHOS 9            UK Support +44 1235 559933
Life is complex, with real and imaginary parts.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SOPHOS Plc (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      22-Oct-99 01:51:13
  To: All                                               22-Oct-99 10:21:21
Subj: Re: Sending Binary Files via sendmail?

From: nospam@savebandwidth.invalid       (John Thompson)

In <380FB352.788FC15E@ismi.net>, bosmith <bosmith@ismi.net> writes:

>I am running Warp v3.0 with the IBM TCPIP stack.  I use sendmail to
>email text reports to users and it works quite well.  I now have a need
>to send a binary file (an Excel spreadsheet) and find that sendmail
>won't deliver it properly.
>
>Can anybody suggest a way to get this done outside of manually mailing
>the report?

You need to encode it as plain text (use MIME or uuencode) before
sending.  Even if your local sendmail MTA could be persuaded to 
transmit non-acsii content there is no guarantee that other 
systems handling your mail wouldn't munge the binary content and 
ruin it for the recipient.

-John (John.Thompson@attglobal.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: cb@lim.nl                                         22-Oct-99 13:22:13
  To: All                                               22-Oct-99 10:21:22
Subj: Re: Adobe Reader V.3 and NS4.16 -- How...?

From: Colin Brace <cb@lim.nl>

In <380f5256$1$fnapb$mr2ice@news.jps.net>, on 10/21/99 
   at 10:40 AM, nospam@sancoatjpsdotnet.void (Sander Nyman) said:

> Check the Netscape PLUGINS folder for the file NPPDFOS2.DLL.  If it is
> not there, copy it over to PLUGINS.

thanks. I was also wondering how to do this.

-- 
  Colin Brace <cb@lim.nl>
  Amsterdam
  http://www.lim.nl


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A2000 Kabeltelevisie en Telecommunicatie (1:109/42)

+----------------------------------------------------------------------------+

From: wagner@grz.at                                     22-Oct-99 13:38:05
  To: All                                               22-Oct-99 10:21:22
Subj: Java for Warp3 ?????

From: Christoph Wagner <wagner@grz.at>

Hello all,

does anybody know if and how I can implement java ( in OS2 Warp3. I only
found it in Warp4, but I dont want to change the whole system!
(I need it for the application "Connect:Direct" from Sterling Commerce!)

Thanks in advance,
Chris
wagner@grz.at

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Genossenschafts Rechenzentrum Linz (1:109/42)

+----------------------------------------------------------------------------+

From: ivan@protein.bio.msu.su                           22-Oct-99 15:58:26
  To: All                                               22-Oct-99 10:21:22
Subj: Re: SYS3175 in PMMERGE with Comm/2 4.61 GA

From: "Ivan Adzhubei" <ivan@protein.bio.msu.su>

In <380F4934.55B94862@NOSPAMus.ibm.com>, on 10/21/99 
   at 12:11 PM, "Jeffrey S. Kobal" <jkobal@NOSPAMus.ibm.com> said:

Same here, all sorts of weird memory problems and WPS lockups due to
NC4.61 after installing FP12:

------------------------------------------------------------

10-20-1999  18:16:17  SYS3175  PID 0919  TID 0001  Slot 00c1
C:\NETSCAPE\PROGRAM\NETSCAPE.EXE
c0000005
1be3bda2
P1=00000001  P2=0000007c  P3=XXXXXXXX  P4=XXXXXXXX  
EAX=00000000  EBX=00000000  ECX=00000000  EDX=13e8b0d4
ESI=007c49f0  EDI=007c0004  
DS=0053  DSACC=d0f3  DSLIM=1fffffff  
ES=0053  ESACC=d0f3  ESLIM=1fffffff  
FS=150b  FSACC=00f3  FSLIM=00000030
GS=08ab  GSACC=10f3  GSLIM=00003fff
CS:EIP=005b:1be3bda2  CSACC=d0df  CSLIM=1fffffff
SS:ESP=0053:007c4994  SSACC=d0f3  SSLIM=1fffffff
EBP=007c49c4  FLG=00012202

PMMERGE.DLL 0004:0013bda2

Cheers,
Ivan

>Dave Parsons wrote:

>> Since upgrading to the GA version of Comm/2 4.61 and also FP12
>> I have started to get crashes using Netscape when doing nothing
>> special, just starting to download a new page.
>>
>> 10-16-1999  10:11:30  SYS3175  PID 0334  TID 0001  Slot 0060
>> E:\NETSCAPE\PROGRAM\NETSCAPE.EXE
>> c0000005
>> 1bdfdef1
>> P1=00000001  P2=00000103  P3=XXXXXXXX  P4=XXXXXXXX
>> EAX=178f0028  EBX=0000057c  ECX=00000060  EDX=00000584
>> ESI=00000584  EDI=000000ff
>> DS=0053  DSACC=d0f3  DSLIM=1fffffff
>> ES=0053  ESACC=d0f3  ESLIM=1fffffff
>> FS=150b  FSACC=00f3  FSLIM=00000030
>> GS=3503  GSACC=10f3  GSLIM=00003fff
>> CS:EIP=005b:1bdfdef1  CSACC=d0df  CSLIM=1fffffff
>> SS:ESP=0053:007c60f8  SSACC=d0f3  SSLIM=1fffffff
>> EBP=007c6128  FLG=00012206
>>
>> PMMERGE.DLL 0004:000fdef1

>> Is the fault in NC/2 GA or pmmerge from FP12?

>I'm afraid it looks like a problem in the FP12 PMMERGE, as far as I can
>tell.  At this instruction, the EDI register should be holding a
>pointer to the next free block on the heap, but it is not a valid
>pointer.  Communicator should not be able to corrupt the free chain in
>a PM heap, so I'd have to assume that a bug was introduced in FP12.

>Jeffrey S. Kobal
>IBM Corporation


-- 
-----------------------------------------------------------
"Ivan Adzhubei" <ivan@protein.bio.msu.su>
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Moscow State University (1:109/42)

+----------------------------------------------------------------------------+

From: bosmith@ismi.net                                  22-Oct-99 08:09:23
  To: All                                               22-Oct-99 12:35:25
Subj: Re: Sending Binary Files via sendmail?

From: bosmith <bosmith@ismi.net>

I'm using OS/2 v3.0 CSD XR03001; LAPS 2.20.5 CSD 7060; and TCP V2.00 CSD
UN64092.

"ks@karicobs.com" wrote:

> Thursday October 21 1999 17:44, bosmith wrote to All:
>
>  b> I am running Warp v3.0 with the IBM TCPIP stack.  I use sendmail to
>  b> email text reports to users and it works quite well.  I now have a
>  b> need to send a binary file (an Excel spreadsheet) and find that
>  b> sendmail won't deliver it properly.
>
> Which client are you using? Sounds like an encoding problem.
>
>  KS

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: ccsten@usa.net                                    22-Oct-99 08:53:02
  To: All                                               22-Oct-99 12:35:25
Subj: Re: SYS3175 in PMMERGE with Comm/2 4.61 GA

From: Terry Norton <ccsten@usa.net>

This must be the usual machine specific problems.  I just applied
FP12 to 2 machine on my LAN.  One is a Cyrix and the other an AMD
CPU.  I'm just not seeing all these problems.  I was having some
SYS3175's due to the 4.6.1 bugs while one was on FP10 and the other
on FP9, but I simply don't see NS misbehaving more with FP12.  The
only time NS 4.6.1 locks my system is when I try to Empty the trash,
but that was before FP12 anyway.


Ivan Adzhubei wrote:
> 
> 
> Same here, all sorts of weird memory problems and WPS lockups due to
> NC4.61 after installing FP12:
> 
> ------------------------------------------------------------
> 


-- 

Terry Norton
Warped with OS/2

I started out with nothing & still have most of it left.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Together Networks - Burlington, VT. (1:109/42)

+----------------------------------------------------------------------------+

From: dholmes@trellis.net                               22-Oct-99 08:51:28
  To: All                                               22-Oct-99 12:35:25
Subj: Re: Problem fixed! Re: EscapeGL 3.0 and OpenGL problems...

From: Dan Holmes <dholmes@trellis.net>

Adrian Gschwend wrote:
> 
> Great to hear that it is working. I wait with V3.0 until I get SDD/2 with
> hardware opengl acceleration, I think then SDD/2 will rock :-)
> 
I see no reason to wait.  I have V3 with a Matrox G200 and
if i disable DIVE then the matrox drivers work quite well. 
When i did try SDD, DIVE performance was remarkable. 
Although it is slower without SDD (and without hardware
acceleration) it is still worth it.
-- 
-------------------
Dan Holmes
Integrated Visual Systems, Inc.
voice 704-847-3379
fax   704-847-4655
mailto:dholmes@trellis.net
work -> http://www.ivsi.com
play -> http://www.geocities.com/heartland/hollow/3097

Insert Disclaimer:
Most of the time i think for myself, at least that is what
they tell me.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: tomodea@DeleteThisToSendMail.usa...               22-Oct-99 23:12:20
  To: All                                               22-Oct-99 12:35:25
Subj: Re: Acrobat Reader for OS/2 - Performance Problems under Warp V3

Message sender: tomodea@DeleteThisToSendMail.usa.net

From: "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net>

Csaba,
Thanks for the suggestion.

I've tried this and found something very interesting.

With GSView there are a number of printers I can choose from.  The REAL
Printer I am using is an IBM ExecJet 4072.  However, this is not on the
GSView list.  The only printer types that will work with GSView where I can
get anything printed on the 4072 are: BJE10 and OS2PRN. 

When I select BJE10, the printing still comes out as Portrait even though I
am sending it to a new printer object with Landscape in the Job Properties. 
I even verified that the printer definition is correct by dropping a text
file on the printer and seeing it printed sideways, so I know that the
printer definition is OK.  It looks like GSView is insisting that the Print
job is handled as Portrait and the Job Properties has no effect.

When I select OS2PRN, the printing comes out as Landscape.  However, instead
of black on white as expected, I get white on black.  In other words, the
print orientation is Landscape but the image is reversed!!!!  If I could only
figure out a way of telling GSView to reverse the image....

Tom


On Fri, 22 Oct 1999 09:45:01 +0100, Csaba Raduly wrote:

>Tom O'Dea wrote:
>> 
>> Berry,
>> Thanks.
>> 
>> I've tried ghostview.  This addresses the performance problem.  I can view
a
>> PDF which has landscape pages and I can change the orientation on the
display
>> but I can't change the orientation when I send a page to the printer.
>> 
>> Tom
>
>This may be a printer(driver) problem. Try opening the 
>properties on the printer and go to Queue options.
>Check the "Job dialog before print" checkbox.
>This should make a Job properties dialog box pop up
>when you print; try changing the orientation there.
>
>HTH
>Csaba 
>> 
>> On Wed, 20 Oct 1999 20:43:16 +0100, G. van der Veer wrote:
>> 
>[snip]
>
>-- 
>-----BEGIN GEEK CODE BLOCK----- 
>Version 3.1
>GCS/>GMU d- s:- a30 C++$ UL+ P+>+++ L++ E- W+ N++ o? K? w++>$ O++$ M-
>V- PS PE Y PGP- t+ 5 X++ R* tv++ b++ DI+++ D++ G- e+++ h-- r-- !y+
>-----END GEEK CODE BLOCK----- 
>
>Csaba Raduly,    Software Developer (OS/2),    Sophos Anti-Virus
>mailto:csaba.raduly@sophos.com            http://www.sophos.com/
>US Support +1 888 SOPHOS 9            UK Support +44 1235 559933
>Life is complex, with real and imaginary parts.



----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (tomodea@usa.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: tomodea@DeleteThisToSendMail.usa...               22-Oct-99 23:10:15
  To: All                                               22-Oct-99 12:35:25
Subj: Re: Ghostscript/GSView - OS/2 Warp V3 - Landscape Printing

Message sender: tomodea@DeleteThisToSendMail.usa.net

From: "Tom O'Dea" <tomodea@DeleteThisToSendMail.usa.net>

Jan,
Thanks.  I've tried this and found something very interesting.

With GSView there are a number of printers I can choose from.  The REAL
Printer I am using is an IBM ExecJet 4072.  However, this is not on the
GSView list.  The only printer types that will work with GSView where I can
get anything printed on the 4072 are: BJE10 and OS2PRN. 

When I select BJE10, the printing still comes out as Portrait even though I
am sending it to a new printer object with Landscape in the Job Properties. 
I even verified that the printer definition is correct by dropping a text
file on the printer and seeing it printed sideways, so I know that the
printer definition is OK.  It looks like GSView is insisting that the Print
job is handled as Portrait and the Job Properties has no effect.

When I select OS2PRN, the printing comes out as Landscape.  However, instead
of black on white as expected, I get white on black.  In other words, the
print orientation is Landscape but the image is reversed!!!!  If I could only
figure out a way of telling GSView to reverse the image....

Tom


On Thu, 21 Oct 1999 22:41:42 +0200 (CET), Jan Hartman wrote:

>On Wed, 20 Oct 1999 21:39:32 +1100 (EDT), Tom O'Dea wrote:
>
>:>I'm looking for help in how to get Ghostscript/GSView to print PDF
documents
>:>in landscape mode.
>:>
>:>I recently installed Ghostscript/GSView under OS/2 Warp V3.  I did this
>:>because I couldn't get Acrobat Reader for OS/2 to work (subject of a
separate
>:>post).  I got Ghostscript and GSView working OK, and I can view PDF files
OK.
>:> I can also print pages from a PDF as long as the pages are Portrait. 
>:>However, when I try to print pages which are Landscape, the page is printed
>:>with a Portrait orientation, i.e. the right hand part of the page is lost.
>:>
>:>GSView allows you to change the orientation of the pages on the display,
but
>:>this makes no difference to how the pages are printed.  I cannot find
>:>anything in the documentation for Ghostscript or GSView that will allow me
to
>:>change the orientation of the page on the printer.
>:>
>:>Any suggestions? 
>:>
>:>Thanks,
>:>Tom
>:>
>I am no experto on this, but have you tried changing to landscape
>in the settings for the printer driver?
>
>/ Jan
>
>

----------------------------------------------------------------------
 Tom O'Dea
 Melbourne, Australia
 (tomodea@usa.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          22-Oct-99 14:19:13
  To: All                                               22-Oct-99 14:21:14
Subj: Re: PMView 2.0?

From: piquant00@uswestmail.net (Annie K.)

On Fri, 22 Oct 1999 07:00:19, j.welton@mailcity.com wrote:

:I bought and registered PMView because it was advertised as a graphics
:program that would read/view/edit WordPerfect graphic files (WPG) of
:which I have thousands from my old WP5.1 days.  But PMView apparently
:sees/edits/saves a type of WPG that I've never seen because it has
:never been able to read/edit/save any of my WP5.1 WPG files.  I even
:have some WP6.0 graphics and they are not recognized by PMView so I'm
:not sure what WPG the author believes works with his product. 

 It states in Pmview's online help "PMView supports WPG versions 5.x. 
This version of 
PMView only reads files that contain raster graphics. 
WPG files with vector graphics or postscript cannot be 
read in this version [1.05] of PMView.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: jasper_de_keijzer@nl.compuware.com                22-Oct-99 16:36:15
  To: All                                               22-Oct-99 14:21:14
Subj: New homepage for DrawIt under construction

From: Jasper de Keijzer <jasper_de_keijzer@nl.compuware.com>

If you wanna have a sneak preview of the new homepage for drawit.
A famous dutch artis, Paul Evenbleij, is contstructing the home page.

Just have a look at this link
http://www.knoware.nl/users/paulpaul/projects/drawit.html



This will change in the future to

http://home-5.worldonline.nl/~jdekeij


regards,
Jasper

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Compuware Uniface Amsterdam (1:109/42)

+----------------------------------------------------------------------------+

From: swanee@pillarsoft.net                             22-Oct-99 10:50:10
  To: All                                               22-Oct-99 14:21:14
Subj: Re: PMView 2.0?

From: Wayne Swanson <swanee@pillarsoft.net>

j.welton@mailcity.com wrote:
> 
> I thought the final release of PMView 2.0 would be out by now.  I
> remember reading in these newsgroups that it was to be released at the
> time of Warpstock.  According to the PMView web site the author offered
> a pair of floppies with a special version of PMView 2.0 just for
> Warpstock attendees.
> 
> I'm a registered user of PMView 1.05 and after a very bad experience
> using beta software, in particular, SciTech Display Doctor, I will
> never again chance my system with a beta or preview release of anything
> and that includes the current beta of PMView 2.0.
> 
> My inquiry, therefore, is directed to those who attended Warpstock and
> received the exclusive Warpstock only release of PMView 2.0.  What can
> we expect in this new version?  Will I be able to create and edit
> (video) movies?  Does this PMView 2.0 offer the OS/2 user anything new
> or worthwhile or is this long awaited release just an opportunity for
> the author to break into the Microsoft OS market with a branched Win32
> release?  Will OS/2 users see any major features and improvements?
 
I didn't see anything on PmView at WarpStock. They may have been there
but I was not able to get around to all the vendors. (including some
that I had intended to buy software from during the show)

The new PmView is very nice and has been stable on this machine for as
long as I have had it but I kept the 1.05 version installed also. They
will co-exist and 1.05 is just a little lighter. I don't know about your
WP 5.x files but I believe that Peter Nielsen has added more formats and
he is always working with customer requests.

Sorry I don't have more information but at least I can tell you that it
is probably not going to cause any damage for you. As a registered
PmView user you can get it by joining the beta program/mailing list and
they will direct you to the archive.


Wayne Swanson
------------------------------------------------------------
email: swanee@pillarsoft.net
PillarSoft: http://www.pillarsoft.net
Developers of: WarpZip, DeskTop Backup (DTB), SFX Installer
               ShowTime/2 and the Enhanced E Editors
Vice President: VOICE (Virtual OS/2 International Consumer Education)
VOICE: http://www.os2voice.org
------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PillarSoft (1:109/42)

+----------------------------------------------------------------------------+

From: domi@kenavo.NOSPAM.fi                             22-Oct-99 15:40:04
  To: All                                               22-Oct-99 14:21:14
Subj: Re: Java for Warp3 ?????

From: domi@kenavo.NOSPAM.fi (Dominique Pivard)

On Fri, 22 Oct 1999 11:38:10, Christoph Wagner <wagner@grz.at> wrote:
> 
> does anybody know if and how I can implement java ( in OS2 Warp3. I only
> found it in Warp4, but I dont want to change the whole system!
> (I need it for the application "Connect:Direct" from Sterling Commerce!)

The latest Java (JDK 1.1.8 IBM build o118-19990910) works fine here 
(Warp 3, FP 42)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: mkaply@NOSPAMus.ibm.com                           22-Oct-99 10:42:08
  To: All                                               22-Oct-99 14:21:14
Subj: Re: NS 4.04 & NS 4.61 characters

From: Michael Kaply <mkaply@NOSPAMus.ibm.com>

I tried to send mail to you but it bounced.

Go http://members.aol.com/pspmikek/charsets

Click on the left link for Latin-1

Tell me if what you see in the table at the top matches the GIF below it.

Thanks

Mike Kaply
IBM

Allen Cogbill wrote:

>I've been using NS 4.04 until today, when I installed NS 4.61. Under 4.04,
>I've had a problem displaying the degree symbol (code table value 248 when
>using Code Table 850; the HTML code number is 176). I was hoping that that
>problem would go away after installing NS 4.61, but the problem remains.
>What should be the degree symbol appears as a square pattern of 9 small,
>solid squares. Note that when using WebExplorer, the degree symbol is
>displayed correctly.
>
>I'm using Warp 4 Fixpak 5, and my font display is set to "Western".
>
>Anyone know what's going on?
>
>Thanks,
>Allen Cogbill

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM (1:109/42)

+----------------------------------------------------------------------------+

From: Thomas.Billert@rz.uni-jena.de                     22-Oct-99 22:18:20
  To: All                                               22-Oct-99 21:23:08
Subj: Re: PMView 2.0?

From: Thomas.Billert@rz.uni-jena.de (Thomas Billert)

On 22 Oct 1999 10:14:29 PDT, Cityboy@Spam-No-More.Net wrote in 
comp.os.os2.apps:

>What are the changes in 2.0 anyway. I downloaded 1.05 but didn't
>
from PMView 2.0's online help:

***snip***

PMView 2.0 is the first multi-platform version of PMView. This version is 
available for OS/2 Warp v3/v4/SMP and Windows 95/98/NT4. The user interface 
code has been rewritten and a lot of changes and improvements have been made. 
Here's a list of changes and improvements in PMView v2.0. Because of the large 

number of changes only major changes and new features are listed.   

The following features are new in v2.0 :   

1. Tool bar with Move, Zoom, Scroll, and Selection tools. The tool bar is 
optional and can be disabled.
2. Status bar with progress bar and
sizing grip. The status bar is optional and  can be disabled. Note that
the sizing grip has added functionality:  Double-clicking on the grip
does the same as View->Wrap Image.
3. User configurable shortcut keys
(hot keys). The keys can be configured on the  new "Keys" page in
PMView's options notebook.
4. New thumbnail option that lets you use
"On-the-fly Thumbnails". On-the-fly  thumbnails are created on-the-fly
and are not written to disk like Icon  Thumbnails. On-the-fly
Thumbnails have the advantage can they can be used  on read-only media.
There is also a "Mixed" mode option that loads an Icon  Thumbnail if
available or otherwise creates a On-the-fly Thumbnail.
5. New menu option "File->New->Image" that lets you create a new empty
canvas.
6. New menu option "File->New->PMView Window" that lets you start a new
PMView session.
7. Progressive TWAIN support. The image appears in
PMView's main window  line-by-line as it is being scanned.
8. New print dialog. Three optional methods for mapping the image to the 
printer: pixelwise, image resolution, or fit page. Print preview and 
drag"-style adjustment of print margins. There is now also a page 
orientation selector including an option for automatic selection of
orientation.
9. New drag&drop enabled drive+directory list in File
Open/Save Windows
10. Screen Capture: Support for capturing by hot key.
11. Screen Capture: Support for including the mouse pointer in
the capture.
12. The number of colors is reported for deep color
images.
13. File Sequencer: Background preloading (read ahead) of next
file (optional)
14. File Sequencer: Directory caching (OS/2: optional, Windows: automatic)
15. BMP: Support for 15-, 16-, and 32-bit bitmaps.
16. BMP: Support for Win32 specific bitmaps (BI_BITFIELDS)
17. BMP: Support for top-down bitmaps (bitmaps with negative height).
18. EPS (Encapsulated Postscript) file support (write only)
19. PSD (Adobe Photoshop Document) file support (read/write)
20. G3 (CCITT Group 3 Facsimile) file support (read/write)
21. SFW (Seattle Filmworks) file support (read only)
22. TIFF: JPEG-in-TIFF file support (read/write) 
23. TIFF: ZIP-in-TIFF file support (read/write)
24. TIFF: L*A*B* color support (read only)
25. TIFF: PMView will now read TIFFs even if the Orientation tag is invalid.
26. New command line option /ZOOm that lets you set the initial zoom 
percentage
27. New window sizing and positioning options: center
window on screen,  respect system task bar, and more.
28. New "Grid" view mode in the file open and slideshow container.
29. New zooming commands that let you zoom by factor.
30. New commands that delete the
current image and automatically load the next  or previous image.
(These commands are only available via shortcut keys.  The default keys
are Ctrl-Del and Alt-Del.)
31. New options in the File Open and File Save windows that lets you choose
whether the dialog should always float on top of PMView's main window
and  whether the dialog should be hidden or not when you double-click
on an  image or press "Open".
32. New option to hide the scroll bars. (This option is located under
View->Show->Scroll Bars).
33. New option that lets you select if the delete command automatically should
load the next image after deleting the current image. (This option is
located  on the "Loading" page in PMView's options notebook).
34. Corrupt files in the File Open container are hilited with a red
background.  This feature is optional and can be disabled.
35. New Autostart option that will automatically start a loaded slideshow.
This option can be found in PMView's options notebook on the "Slideshow"
page.
36. New menu options for creating a slideshow from a directory,
or a directory  including all subdirectories. 


Here is a list of notable changes between v2.0 and v1.0 for OS/2:   

1. All dialogs and controls now scale dynamically. This means that
dialogs look  good regardless of system font differences (texts are not
truncated nor is  there excessive white space in dialogs).
2. Hot keys have been changed to be compatible between platforms
3. Some menus are rearranged (Selection Info (formely called Track
Info), Image  Info, Show Menu, and Show Controller are now found under
the  View->Show-> menu.)
4. Thumbnails are no longer kept in memory in the form of OS/2 bitmaps.
This  requires less memory and solves a bitmap resource problem that
has been  observed on some systems.
5. The open/close state of the image info dialog is remembered. If the
image  info dialog is visible when closing PMView, it will
automatically be shown  when PMView is restarted.
6. TWAIN memory handling is improved. When using a TWAIN source that 
supports transfer of data in small blocks (e.g. CFM) the memory need is
only  50% compared to PMView v1.0.
7. User configurations are now stored as version independent option
keys in the OS/2 USER INI file. 


The following bugs and problems are fixed in PMView v2.0:   

1. PMView is now able to correctly display images with a height and/or width 
larger than 65535 pixels. 
2. TWAIN: On some systems scanning with CFM Twain does not work correctly. 
The TWAIN code in v2.0 is rewritten and now works correctly. 
3. Mouse Properties dialog in the System Setup Folder: Dragging from PMView's 
file open container or slideshow does not work when the OS/2 "Dragging 
Objects" property is set to "Button 1". 
4. File sequencer: When keeping the '+' or '-' (alternatively Shift+PgUp/PgDn) 

key pressed, PMView will get stuck in a four image loop although there are 
more images in the current directory. This problem is fixed in PMView v2.0 
that has a completely new file sequencer with preloading (read-ahead) and 
optional directory caching. 
5. File Open Window: Scrolling the file open container does not work correctly 

if there is a large number of files in the container. This is an OS/2 bug. The 

problem no longer appears in PMView v2.0, because it uses its own 
container control instead of the control provided by the system. 
6. File Open Window: No cursor is drawn in detail view mode. This means that 
the Shift+F8 method of selection cannot be used. 

***snap***

>register it because there are a couple things about it I just didn't
>like.  It takes way too long to load the files. If you have a directory
>with several thousand JPG's it takes a full two minutes just to load the
>thumbnails. I have a winos/2 program called Thumbsplus that loads the
>same directory in 5 seconds.  The other thing is the interface just
>
this is a result of PMView storing and loading the thumbnails in the
extended attributes. These take time to be read out. Dunno how
Thumbsplus stores thunbnails, though. 

>works backwards in my opinion. The first thing you get is a blank image
>viewing window and the file listing is opened from there. This results
>
agreed, a command line switch /opendlg or such, causing PMView to come
up with the file open dialog would be useful. You should ask Peter if
he could implement it, I guess that's not much work. Peter is very open
to new ideas and constructive criticism.

>in only being able to have 1 image window open at a time. The file
>
no, you can have many image windows and work with one open file dialog.
Just set PMView's WPS object to load a new window when you click it
again, and there you have it. You can use one file dialog and drag and
drop image files to both (ore more) image windows to load them.

>listing should be the first thing that opens and you should open the
>viewing windows from the thumbnails thereby allowing multiple viewing
>windows.
>
agreed, would be a nice feature to be able to open multiple images in
new windows just by doubleclicking them in the file open dialog. The
current behaviour is that PMView opens the image in the image window the
file open dialog was opened from. To open it in another image window
you have to use drag and drop, see above.

regards, Billy.
-- 
Thomas Billert using OS/2 Warp 4   *   Thomas.Billert@rz.uni-jena.de
http://www.uni-jena.de/~c5thbi     *   Thomas.Billert@t-online.de
                                   *   PGP public keys available on my
OS/2-Usergroup Jena und Umgebung:  *               website
http://www.uni-jena.de/~c5thbi/os2jena.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          23-Oct-99 07:13:17
  To: All                                               22-Oct-99 21:23:08
Subj: Re: PMView 2.0?

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

On Fri, 22 Oct 1999 10:50:21 -0500, Wayne Swanson wrote:

:>> I'm a registered user of PMView 1.05 and after a very bad experience
:>> using beta software, in particular, SciTech Display Doctor, I will
:>> never again chance my system with a beta or preview release of anything
:>> and that includes the current beta of PMView 2.0.

The PMView beta has been very stable here. So much so that I didn't bother
installing 1.05 when I built this new machine.

Cheers

Wayne

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
  Running on OS/2 Warp 4 (UK)  + FixPak 9
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

+============================================================================+
