
                   comp.os.os2.apps                 (Usenet)

                 Saturday, 09-Oct-1999 to Friday, 15-Oct-1999

+----------------------------------------------------------------------------+

From: robin.hinde@nzpca.org.nz                          09-Oct-99 09:00:00
  To: All                                               09-Oct-99 04:16:19
Subj: NS 4.61 Pointer to Soluti

From: robin.hinde@nzpca.org.nz (ROBIN HINDE)

News@The-Net-4U.com (M.P. van Dobben de Bruijn) wrote:


MPVDD>This must undoubtedly been talked about before, but
MPVDD>I have problems locating the answers in Deja etc. I am
MPVDD>having problems with the NS 4.61 GA (not before I think)
MPVDD>not showing the search field entries at Deja, Hobbes etc. It
MPVDD>just shows a thin line where the "entry-field" should have been.
MPVDD>But it does not allow to type anything there. Do not have the sa-
MPVDD>me problem in NS 4.04 so it should not be hw / driver related. As
MPVDD>said don't think it was in beta's. I am on FP12 & GENGRADD 0.80

OK, my turn to help 'cos I asked exactly the same question :-)

You need to change your font settings
(edit|preferences|appearance|fonts)

Communicator assumes (incorrectly) that you have Courier New available -
probably not the best way to distribute the product in hindsight.

cheers

  -=rjh=-

---
 * OLX 2.1 TD * (robin.hinde@nzpca.org.nz      3:771/1680)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MegaBaud BBS, NZPCA, Wellington, New Zealand, 64-
(1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     08-Oct-99 19:45:23
  To: All                                               09-Oct-99 04:16:19
Subj: Re: FP12:  A Piece Of Cake!

From: yyyc186.illegaltospam@ibm.net

In <37FD5EE4.26B2@earthlink.net>, on 10/07/99 
   at 11:03 PM, "J. R. Fox" <jr_fox@earthlink.net> said:

>yyyc186.illegaltospam@ibm.net wrote:
>> 
>> In <7tc5ub$e8i$1@panix2.panix.com>, on 10/05/99
>>    at 02:30 AM, rcpj@panix.com (Pierre Jelenc) said:
>> 
>> IBM kissed off over 60% of the OS/2 user base with FP 12.  You can't get
>> your soundcard back and they have no intention of fixing it.  Unless you
>> can read the chip numbers and find the manufacturer you are screwed.
>> Actually, you are still screwed.  ESS has moved on to greater sound chips
>> and hasn't updated the OS/2 driver for the 1869 since 1997.  They have no
>> plans to.  They have moved onto chips with higher margins and greater
>> capabilities.
>> 
>> Give IBM a big round of applause for finally killing OS/2.
>> 
>> Roland
>> 

>I don't follow your logic here (or it is imprecisely written,  or I'm not
>reading it correctly): if this only applies to the ESS based cards, how
>does that account for 60 % of OS/2 users ? I doubt that many are using
>ESS.  At the moment, I've got 4  soundcards here (trying to line up the
>best one for Warp), and  *none* of them are ESS-based.  If you're saying
>that FP-12  breaks *any* installed soundcard -- and this turned out to be
>true -- that would indeed be serious.  But, to date, I haven't  heard
>this assertion anywhere else.

The ESS chipset is used enmasse by notebook vendors...the one product you
can't put a sound card in.  Any of the "generic" mail order places
shipping a box with a sound card and not specifying the brand is shipping
a generic card with an ESS chipset on it as that is their primary
market...as one poor sole in this thread found out.  The sad part is that
ESS has no interest in writing drivers for anything but their "current"
chipset line which leaves about 3 model years worth of notebook and
generic sound card owners swinging in the breeze.

I did get FP12 to seemingly function with the SB-16 card in my workstation
at home, but that is the only box FP-12 seems to function on.  Everything
else is a serious kludge of work arounds and do withouts.

The sad irony of all this, if memory serves me correctly, is that several
models of the IBM notebooks use the ESS chipset.  Not like they had to
travel far for a test machine is it????

Roland

-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     08-Oct-99 19:51:26
  To: All                                               09-Oct-99 04:16:19
Subj: Re: Oct 1st, still using 0s2 and ibm.net

From: yyyc186.illegaltospam@ibm.net

In <37FDBA8E.4C860169@ibm.net>, on 10/08/99 
   at 10:34 AM, Tony Wright <horseman@ibm.net> said:

>yyyc186.illegaltospam@ibm.net wrote:

>> In <37FC88C1.9CDE8AE1@ibm.net>, on 10/07/99
>>    at 12:49 PM, Tony Wright <horseman@ibm.net> said:
>>
>> >So if one has to expend some imponderable effort anyway I'm seriously
>> >wondering whether to evaluate other alternative ISP's before commencing
>> >the "pain" of changing IBM > ATTGLOBAL.
>> >The majority of other ISP's appear cheaper anyway although I don't know
>> >whether multi accounts, access reliability/speed can be comparable to
>> >IBM's former and presumably AT&T's quality/performance?.
>>
>> I just ordered a DSL line.  Will let you know when it is installed and how
>> it works.
>>
>> Roland

>Thanks (I'm assuming I'm not confused here and DSL == ADSL  and implies
>it's via AT&T and not some other telco?)...
>I'm UK based and British Telecom (local loop provider) and others (like
>my current C & W cable provider) are only currently(or
>thinking of<g>) embarking on ADSL pilots.... 
>Talking to C&W(UK) for my area seems to indicate we won't get this 
>option until well into 2000  earliest... :-(

>Hence problem of judging best time  in order to delay  changing addresses
>to multiple contacts while allowing sufficient time to evaluate a broad a
>spread of ISP's as possible.
>In UK at least ADSL may not be rolled out sufficiently before Oct2000 to
>give sufficient choice in that direction.   :-(

>Also with diversity of standards tween international PTT's/hardware can
>one reliably extrapolate experiences tween one user in one country and
>another? Even if they are using a common globally established telco?

It is a DSL line provided by Flashnet.  It allows the phone line to still
be used as a phone line while your on-line.  I'm putting it on my fax line
so I will still be able to receive faxes while connected to the wide and
wonderfull internet.

Roland


-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     08-Oct-99 19:55:09
  To: All                                               09-Oct-99 04:16:19
Subj: Re: Backing up and Restoring with Back Again/2

From: yyyc186.illegaltospam@ibm.net

In <SKfw30zmCGmZ-pn2-MtfWT6y8dLIk@localhost>, on 10/08/99 
   at 08:52 PM, doug.bissett"at"attglobal.net (Doug Bissett) said:

>On Fri, 8 Oct 1999 01:36:13, yyyc186.illegaltospam@ibm.net wrote:


>Anyhow, The SCSI design criteria says:

>TERMINATOR-DEVICE-DEVICE-CONTROLER-DEVICE-DEVICE-TERMINATOR

>Where devices may be missing in this string, and a second controler  can
>be inserted, as a device. 

As I said earlier in the original message "it defies the specification"

>Some newer cards do have second (and third) interfaces, BUT they are  NOT
>designed to be used with more than two at any one time. They are 
>provided, to make it easier to use older devices with newer  controlers.
>Some people do try to use more than two, and sometimes it  actually does
>work, BUT it is NOT supported according to the SCSI  design
>specifications. The controler only needs to be terminated, IF  it is at
>one end of the chain. 

In theory this is correct.  However, crummy vendors like Adaptec don't let
themselves be bothered with "specifications".  The bulk of their cards
which I have had the misfortune to utilize in the past impliment the
internal and external interfaces as two seperate PHYSICAL SCSI chains but
use the driver to make it LOGICALLY a single chain.



>As I said earlier, No wonder you are having problems...

As I said earlier, let me use this towel to dry you off a little.

Roland


-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     08-Oct-99 20:01:24
  To: All                                               09-Oct-99 04:16:19
Subj: Re: FP12: A Piece Of Cake!

From: yyyc186.illegaltospam@ibm.net

In <7tlpp3$93f$1@nnrp1.deja.com>, on 10/08/99 
   at 10:04 PM, ned_snow@my-deja.com said:

>In article
><37fd372d$1$lllp186.vyyrtnygbfcnz$mr2ice@news-s01.ny.us.ibm.net >,
>  yyyc186.illegaltospam@ibm.net wrote:
>> In <7tc5ub$e8i$1@panix2.panix.com>, on 10/05/99
>>    at 02:30 AM, rcpj@panix.com (Pierre Jelenc) said:
>>
>> IBM kissed off over 60% of the OS/2 user base with FP 12.
>You can't get
>> your soundcard back and they have no intention of fixing it.
>Unless you
>> can read the chip numbers and find the manufacturer you are
>screwed.
>> Actually, you are still screwed.  ESS has moved on to greater
>sound chips
>> and hasn't updated the OS/2 driver for the 1869 since 1997.
>>

>This appears not to be the case. I am running Warp 4/FP12 with an Eagle
>ESS1869 base card, and the sound is fine. When I
>installed FP11 and got the expected trap, I found this driver via a deja
>search of the OS/2 newsgroups. It can be obtained here:

>http://duanec.indelible-blue.com/fixes/LatestWarp4.html

>( Thanks Duane! ).

>The ESS drivers are the first thing on the page.

ESS drivers are only going to be available for the "new" chipsets.  The
ones which have been in production for well over a year are on their own. 
ESS isn't even releasing the sourcecode so someone else could fix it.  (I
would, gladly!)

Roland


-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  08-Oct-99 18:58:26
  To: All                                               09-Oct-99 04:16:19
Subj: Re: 1999 tax preparation software for OS/2???

From: Chuck McKinnis <mckinnis@ibm.net>

I was able to run TaxCut98 in a WinOS/2 window.  Don't know about 99.

"Alfred H. Cole, Jr." wrote:
> 
> Does anyone know of any 1999 tax preparation software that would run
> under OS/2.

-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: egermain@mediaone.net                             09-Oct-99 01:42:17
  To: All                                               09-Oct-99 04:16:19
Subj: Re: Java 1.1.8 ~ What the f*@#k? Summary

From: egermain@mediaone.net (Edward Germain)

On Fri, 8 Oct 1999 06:09:13, rlwalsh@packet.net (Rich Walsh) wrote:

> On Fri, 8 Oct 1999 04:07:54, egermain@mediaone.net (Edward Germain) wrote:
> 
> >[big snip]
> > 
> > I think the problem is in Feature Install; it's not processing the 
> > mods to Install.dll.  Does someone who knows more than I agree, and if
> > so what to do about it?  And if not, what is hanging us up?
> 
> Is the date on x:\OS2\DLL\INSTALL.DLL the same as the copy in FISETUP?
> If not, boot to a command line, then copy in the newer file.  Reboot
> and see what happens.
> 
> (FYI... All of the major files in my FI setup are dtd 07-Jun-99.)

The dates are precisely the same: 8/12/99, the sizes are the same.  

I've totally reinstalled Netscape 4.61, and Feature Install (twice, in
fact).  And when I try to install Java 1.1.8, it can't find Feature 
Install, and asks for a path.  I give it the path and the java & 
donuts hang-in for a moment, then I get the 3175 msg again, that there
is an access violation in install.dll.  And it hangs.  I'm stuck.

--Ed Germain

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Road Runner (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                08-Oct-99 22:10:20
  To: All                                               09-Oct-99 04:16:19
Subj: Re: Java 1.1.8 ~ What the f*@#k? Summary

From: lifedata@xxvol.com

egermain@mediaone.net (Edward Germain) said:

>> (FYI... All of the major files in my FI setup are dtd 07-Jun-99.)

>The dates are precisely the same: 8/12/99,

Say what?

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dwparsons@t-online.de                             09-Oct-99 10:26:18
  To: All                                               09-Oct-99 10:26:28
Subj: Re: Electronics CAD

From: dwparsons@t-online.de (Dave Parsons)

On Mon, 4 Oct 1999 19:51:43, "John W. Hardy" <jwhardy@ibm.net> wrote:

> Jim;
> 
> There WAS a program called EAGLE that does circuit board design, but I
> believe the company, Cadsoft, is no longer updating it in the OS/2
> version. There is a Windows version, and may be a Unix version, which
> are being updated. Their web address is:
> 
>  cadsoftusa.com
> 
> They rely on a sub-package by a 3rd party that is not being updated in
> the OS/2 version (or something like that), so they can't update Eagle
> for OS/2.

Yes, ZAF from Zinc.com, a multiplatform API. I was about to start using
it myself until they discontinued OS/2 support at version 5 (I think). 

-- 
Dave

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDL (1:109/42)

+----------------------------------------------------------------------------+

From: Girls Girls Girls Agency                          09-Oct-99 04:33:10
  To: All                                               09-Oct-99 10:26:28
Subj: Re: Need Xfree Help!

From: "www.girlsagent.com" <Girls Girls Girls Agency>

>If you see the grey screen with an X cursor then X is running, 
>but it appears you might not have a window manager defined.  Did 
>v3.3.5 perhaps overwrite your \XFree86\lib\X11\xinit\xinitrc.cmd 
>file?
>
>-John (John.Thompson@ibm.net)
>
On my comp the xfree log shows everything is fine and it appears X is running
but no Window manager loads. How can I Check xinitrc to see if there is one
set up (as in what should I look for) I had Xfree 3.3.3 with gimp running
fine, when I put in 3.3.5 this started so I removed all of the Xfree86
directory and did a fresh install with no change.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       09-Oct-99 08:59:24
  To: All                                               09-Oct-99 10:26:29
Subj: Re: I seem to recall....

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

On Sat, 02 Oct 1999 03:29:10 +0100 (BST), news@fenrir.demon.co.uk wrote:
>On Fri, 01 Oct 1999 14:51:12 GMT, John Thompson wrote:
>
>>Isn't that the reason for that "US Government Users rights 
>>restricted as per yadda, yadda, yadda" message we see when OS/2 
>>boots?
>
>*You* may see that message when OS/2 boots. I, however, do not ;-)

I noticed this message when updating Warp3 with a fixpack,
quite a while ago! (on Warp4 now!)

The Warp installation was UK, however the fixpack was US!

I'm far too impatient to wait for the UK version of fixpacks:-)

Cheers
Chris


-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dwparsons@t-online.de                             09-Oct-99 13:50:21
  To: All                                               09-Oct-99 10:26:29
Subj: Re: Java 1.1.8 ~ What the f*@#k?

From: dwparsons@t-online.de (Dave Parsons)

On Thu, 7 Oct 1999 16:23:36, Christoph Vogt <ch.vogt@gmx.net> wrote:

> >>>>>>>>>>>>>>>>>> Ursprngliche Nachricht <<<<<<<<<<<<<<<<<<
> 
> Am 07.10.99, 10.00.15, schrieb "Maximilian Stempfhuber"
> <st@bonn.iz-soz.de> zum Thema Re: Java 1.1.8 ~ What the f*@#k?:
> 
> 
> > On Wed, 06 Oct 1999 22:42:45 -0400, Thomas A. Heller wrote:
> 
> > >I've lost count of the times I have not been
> > >successful in installing the runtime version (w/o
> > >unicode) of Java 1.1.8 from Software Choice.
> > [...]
> > >After dinking around and re-re-re-reading the Readme
> > >for install, I am still baffled.  Can anyone help?
> 
> > Did you install the latest FeatureInstall (1.25) plugin?
> 
> > Regards
> 
> Try this:
> 
> Delete or rename Fi.ini and fisetup.log in x:\os2\install, then
> reinstall the latest FeatureInstall.
> It works at my System.

Don't forget to delete FI.BAK also if it exists.

-- 
Dave

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDL (1:109/42)

+----------------------------------------------------------------------------+

From: egermain@mediaone.net                             09-Oct-99 03:10:07
  To: All                                               09-Oct-99 11:03:24
Subj: Re: Java 1.1.8 ~ What the f*@#k? Summary

From: egermain@mediaone.net (Edward Germain)

On Sat, 9 Oct 1999 02:10:41, lifedata@xxvol.com wrote:

> egermain@mediaone.net (Edward Germain) said:
> 
> >> (FYI... All of the major files in my FI setup are dtd 07-Jun-99.)
> 
> >The dates are precisely the same: 8/12/99,
> 
> Say what?
> 
Sorry: the dates of the two install.dll files, one in c:\os2\dll, the 
other in ...\fisetup, are identical.  It is true the dates differ from
7 June.  I presume this was an earlier version of feature install.  
Perhaps that is the problem?

I remain puzzled.  I get the coffee, and no buttons.  And the bottom 
line says "Resolving Feature Install variable."  And the system locks.

ed germain 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Road Runner (1:109/42)

+----------------------------------------------------------------------------+

From: egermain@mediaone.net                             09-Oct-99 03:31:17
  To: All                                               09-Oct-99 11:03:24
Subj: Re: Java 1.1.8 ~ What the f*@#k?

From: egermain@mediaone.net (Edward Germain)

On Fri, 8 Oct 1999 13:21:39, jbbandos@hotmail.com (Jose' Bernardo 
Silva) wrote:

> Edward, try my answer to Craig Young, namely removing the 117 and 118
> directories under "x:\netscape\PROGRAM\JAVA\CLASSES\". If there is also a
104
> directory remove it too. Then try installing jdk 118 again.
> 
Thanks for the suggestion, but no luck.  The directories simply are 
gone, nothing replaces them.  The system is hanging on a Feature 
Install Exit screen, with an access violation to Install.DLL.

Why, I haven't a clue.  However, others are having the same problem.

Ed G.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Road Runner (1:109/42)

+----------------------------------------------------------------------------+

From: egermain@mediaone.net                             09-Oct-99 03:34:13
  To: All                                               09-Oct-99 11:03:24
Subj: Re: Java 1.1.8 ~ What the f*@#k?

From: egermain@mediaone.net (Edward Germain)

On Fri, 8 Oct 1999 04:19:47, "Doug Darrow" <d.s.darrow@nvinet.com> 
wrote:

> On Wed, 06 Oct 1999 22:42:45 -0400, Thomas A. Heller wrote:
> 
> >As far as I can tell, I'm all hot to trot, but all I
> >can get is that damned cup of coffee and a couple of
> >(by now stale) donuts!  Is that all there is?
> >
> How long did you enjoy the coffee and doughnuts? From personal
> experience, I can tell you that the search of FI which is going on
> while you are on your 'coffee break' is gauranteed to last about 20%
> longer than you expect it to. 
> 
No dice.  I look at that screen and I get the 3175 error. The bottom 
of the install screen says "Resolving Feature Install Variable."  It 
never does.  I've let it sit there a half-hour.  My system hangs.

e.g. 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Road Runner (1:109/42)

+----------------------------------------------------------------------------+

From: afjbell@onlink.net                                08-Oct-99 21:58:15
  To: All                                               09-Oct-99 11:03:24
Subj: Re: Mesa/2 Website

From: "Alex Bell" <afjbell@onlink.net>

On Wed, 06 Oct 1999 19:25:19 -0400, Thomas A. Heller wrote:

>Try a URL or a websearch with "sundial" or "sundial
>systems" in it.
>
Thanks, I already had the Sundial site, but had not noticed that the site I
wanted was linked to it.  The URL is

http://www.guide.mesa2.com/

Regards, Alex


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ontario Northland--ONLink (1:109/42)

+----------------------------------------------------------------------------+

From: afjbell@onlink.net                                08-Oct-99 21:59:14
  To: All                                               09-Oct-99 11:03:24
Subj: Re: Mesa/2 Website

From: "Alex Bell" <afjbell@onlink.net>

On Wed, 06 Oct 1999 22:39:10 -0400, Michael L. Semon wrote:

>Alex Bell wrote:
>> 
>> In a response to a previous post I was told that there is a website on
which
>> Mesa/2 users can post questions and support each other.  I have
unfortunately
>> lost the URL.  Can anyone tell me what it is?
>> 
>> Regards,  Alex
>
>Though I don't have a public forum, my Mesa 2 site is at
>http://www.guide.mesa2.com/ . I haven't found a site quite like what
>you're requesting.  Have fun!
>
>						--Michael
>
Thanks, Michael, your site is most helpful. 

Regards, Alex


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ontario Northland--ONLink (1:109/42)

+----------------------------------------------------------------------------+

From: dariusz@mnsi.net                                  09-Oct-99 02:54:20
  To: All                                               09-Oct-99 11:03:24
Subj: Re: Fp12 and default fonts

From: dariusz@mnsi.net (Dariusz Piatkowski)

Hi Everyone!

I've got exactly the same problem here...on top of this there are some
other weird graphic related things going on...stuff like missing dialogue
buttons, etc....hmm, will give FP12 a try for a few days...but I just might
uninstall if this keeps up.

In message <z3F1sghqDj8g-pn2-Hd4KuUVQMZrl@cnq57-73.cablevision.qc.ca> -
racette@cablevision.qc.ca (Martin Racette) writes:
>
>On Thu, 7 Oct 1999 11:47:33, 
>nospam@nospam.com (Bruce LaZerte) wrote:
>
>> On Wed, 6 Oct 1999 17:55:12, racette@cablevision.qc.ca (Martin Racette) 
>> wrote:
>> 
>> > BTW. My video card is a Matrox Mullenium
>> > G200, with the 2.31.100 drivers, and I 
>> > had no problem of this kind before
>> 
>> Didn't happen here with the G200. You know you can change the default 
>> system font in the Matrox MGA  Settings object?
>> 
>> ----------------------
>> Bruce LaZerte 	
>> Muskoka,Ontario,Canada
>> freshwat at muskoka dot com	
>
>I do know but this will also change the 
>size of the window, which I don't want 
>to change, I just want to get back to 
>the default font: "System Proportionale 
>12", which is what still appears in the 
>"MGA Setting" notebook
>
>//-------------------------
>Thank you in advance
>
>Merci a l'avance
>
>Martin
>
>http://205.237.57.73/
>
>ICQ #48552954



- Dariusz

=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
-=
Dariusz Piatkowski
dariusz@mnsi.net
ncc@mnsi.net
http://www.mnsi.net/~ncc

New Concepts Consulting - Your One Stop For Hardware And Software Solutions
Chatham, Ontario, Canada, call (519) 380-0384
=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
-=

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://extra.newsguy.com (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                09-Oct-99 04:00:09
  To: All                                               09-Oct-99 11:03:24
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: baden@unixg.ubc.ca    (Baden Kudrenecky)

In <7tlbfe$u3o$1@nnrp1.deja.com>, Siobhan Perricone
<morgannalefey@my-deja.com> writes:
>In article <7tl4g6$2mm1$1@thoth.cts.com>,
>  Will Rose <cwr@cts.com> wrote:

>I just spent the morning researching utilities that help me terminate
>applications that are hung up.  I dl'd a bunch of things from hobbes
>and installed them to see what they did only to find that many of them
>need me to give a PID in order to "kill a process" (I know what the
>means, but, honestly...).  Further research revealed that I could find
>the PID by using PSTAT.  So now I'm trying to figure out how the hell
>to read whatever it is that PSTAT gives me.

   The best is 'Watchcat', which install's its own driver to
terminate processes.  I also use 'go' for remote maintenance,
and 'PSPM/2', however Watchcat can be configured to use one key,
and you can use th mouse or key pad to operate it.

>ALL I wanted to do was close a window that was hung up.  It was a
>delete confirmation window for the deletion of some print jobs that
>were sitting in a printer device window.  The confirmation window hung
>and I wanted to close it.  The online help is only useful if you

   You cannot kill shell messages from a process killer, as they
do not have their own process.  A message, such as you received,
may have had another modal window that was covered up.  The best
way to access those, is to bring up the Window List, and select
the root object (eg printer).  As a last resort, you could kill
then PM Shell, and it should restart itself.

   Also, printing is all done through the PM Shell, so you have
to manipulate and delete jobs from the printer object(s).
Occasionally, with bigger jobs that have been interrupted, the
printer has to be reset, as well as the print jobs deleted from
the printer object.


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            09-Oct-99 04:04:17
  To: All                                               09-Oct-99 11:03:24
Subj: Re: Backing up and Restoring with Back Again/2

From: mike.luther@ziplog.com

In <37FE36FE.66B0F8@datatone.com>, Alan Beagley <abeagley@datatone.com>
writes:

>Well, I am using Warp 4 with FP 12. I corrected the problem by connecting the 
tape drive to a different
>SCSI card. I believe that many people have found that tape drives doen't play 
nicely with the more
>exotic Adaptec SCSI controllers such as the AHA2940, and they keep their
older SCSI cards specifically
>for use with the tape drive -- and not even specifically for OS/2.
>
>Alan

That was one of the reasons I was posting the results of he CLREST
project with the 2940UW series and the Seagate Scorpion units...  The
FP8 SCSI driver and both the 2940UW and 2940UW Pro apparently work fine
with these tape units ..

We also were furnished a 2940UW2 or is it 29402UW to test.  To date,
although there are still some more options on how to hook things to it
to try, I cannot get it to read the CLREST combo.  The site is a TDY
trip.  I've just not gotten there to test the latest suggestions and
drivers yet.  I suspect that there is a later driver yet in the mess
there to test as well..

I will post the results...  If we can't immdiately clone a whole system
from tape if needed, without a fuss, the whole system is worthless.


--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            09-Oct-99 04:27:09
  To: All                                               09-Oct-99 11:03:25
Subj: Re: Backing up and Restoring with Back Again/2

From: mike.luther@ziplog.com

In <SKfw30zmCGmZ-pn2-MtfWT6y8dLIk@localhost>, doug.bissett"at"attglobal.net
(Doug Bissett) writes:
>On Fri, 8 Oct 1999 01:36:13, yyyc186.illegaltospam@ibm.net wrote:

Yes, Doug ..

>Anyhow, The SCSI design criteria says:
>
>TERMINATOR-DEVICE-DEVICE-CONTROLER-DEVICE-DEVICE-TERMINATOR
>
>Where devices may be missing in this string, and a second controler 
>can be inserted, as a device. 

Yes.

>Some newer cards do have second (and third) interfaces, BUT they are 
>NOT designed to be used with more than two at any one time. They are 
>provided, to make it easier to use older devices with newer 
>controlers. Some people do try to use more than two, and sometimes it 
>actually does work, BUT it is NOT supported according to the SCSI 
>design specifications. The controler only needs to be terminated, IF 
>it is at one end of the chain. 

Noted.  There are some curious variations.  It is unlikely that the
average user here will be using things like the 3940UW ..  We do use
them in places.  As far as I uderstand that card, it is actually two
complete hardware operations on a single PCI card.  It has two complete
operational channels on that single card, each of which has the above,
general termination logic.  However, both channels can report in to the
buss slot as if it were, more or less, one 'card.'

They are .. 'another device' as in your above, sort of built in one
card, as I think I understand these cards...

More important, the card uses TWO interrupts as well.  Although some
setups will assign the same interrupt, in error, it seems, to both the
channels, you must, somehow, get that card into the system with two of
them, not one for the paired channels.

Since we have and use thes cards, and I had no documentation at all, nor
any drivers furnished with the on-board Adaptec controller in the mother
board embedded version, I really had no idea of what to expect when
faced with both a pair of 68 pin connectors and a pair of 50 pin
connectors coming out of the same board!

What would you expect an uninformed user to use for configuration
knowledge under those circumstances?  What actually is the embedded
device setup?  I still have no documentation for it at all; have no idea
what it presents as a user interface, other than what pops up in the
Award BIOS that drives the ASUS boards!

At near full-time in this game since 1974, I'm still at a loss if I have
no data on the device and implementation .. :)


>If the card doesn't work like that, it is not designed properly, or 
>you have not connected, and terminated, the chain properly (more 
>likely). On the other hand, there are a lot of devices, that are 
>supposed to have "automatic" built in termination, that do not work 
>properly, AND there are a LOT of terminators that do not work properly
>(especially the "dynamic" ones). 

Yes.

>If you have three terminators in the chain, you are operating outside 
>of the design criteria, and it may, or may not, work properly, 
>depending a lot on what devices are on the chain, how long the cables 
>are, and if you are switching bus widths somewhere.
>
>As I said earlier, No wonder you are having problems...

And yet, if you are using the later WD 9.18GB hard disks and it is the
only device on the 68 pin cable, and you enable termination on it, on a
2940UW, it will:

        1.) Prep - using the built in Adaptec utility,
        2.) Verify - using the built in Adaptec utility,
        3.) Fdisk using the OS/2 FP8 IBM utility and 7870 driver,
        4.) Format using the OS/2 FP8 IBM utility and 7870 driver,
        5.) Go through a complete CLREST rebuild using that 7780 driver,
        6.) Then ... on initial boot, you will see the Adaptec
            controller tell you something like, "Improper termination.."

At that point, you may pop on a passive or active 68 pin terminator.
The error message will go away.  That's three terminations on one cable
channel.

You may then disable the WD termination, power or not pin, as you like,
it makes no difference.

As long as the extenal cable terminator is on the end of the cable and
the drive is in the middle as in your example. it all works as well...

What's wrong with WD?

--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: rmahoney@_REMOVE_THIS_netusa.net                  09-Oct-99 05:13:23
  To: All                                               09-Oct-99 11:03:25
Subj: Re: SmartCache

From: rmahoney@_REMOVE_THIS_netusa.net (Robert Mahoney)

On Tue, 5 Oct 1999 15:54:19, Anssi Saari <as@sci.fi> wrote:

> rmahoney@_REMOVE_THIS_netusa.net (Robert Mahoney) writes:
> 
> > On Thu, 23 Sep 1999 00:01:13, jdc0014@InfoNET.st-johns.nf.ca (John 
> > Hong) wrote:
> >  
> > > 	Is it possible to have both SmartCache and Internet Junkbuster 
> > > running at the same time for a browser?  There is only room there for
one 
> > > http proxy...
> > 
> >   Sure, I have them chained.   Netscape has a localhost proxy to port 
> > 8080 which is the Smart Cache port.  In the Smart Cache config file 
> > have a line...
> 
> But what's the point? I haven't used Junkbuster any more after
> starting Smart Cache. Smart Cache seems to block what I want it to
> block pretty good.

  I've found excellent block files for junkbuster.  Junkbuster seems 
to have a 
far more flexible block format and I didn't feel like translating the 
block file to Smart Cache.

  Plus Junkbuster replaces the annoying gifs with 1x1 transparent 
images so you don't even see the ads.

Bob
--
Robert Mahoney
2Rud Software and Consulting
http://www.netusa.net/~rmahoney

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: 2Rud Software (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 09-Oct-99 03:31:02
  To: All                                               09-Oct-99 11:03:25
Subj: Re: Java 1.1.8 ~ What the f*@#k? Summary

From: hamei@pacbell.net

In <EC3EJ5uiPEfW-pn2-4rrFddg86Pdl@egermain.ne.mediaone.net>,
egermain@mediaone.net (Edward Germain) writes:
>On Fri, 8 Oct 1999 06:09:13, rlwalsh@packet.net (Rich Walsh) wrote:
>
>> On Fri, 8 Oct 1999 04:07:54, egermain@mediaone.net (Edward Germain) wrote:
>> 
>> >[big snip]
>> > 
>> > I think the problem is in Feature Install; it's not processing the 
>> > mods to Install.dll.  Does someone who knows more than I agree, and if
>> > so what to do about it?  And if not, what is hanging us up?
>> 
snip
>
>I've totally reinstalled Netscape 4.61, and Feature Install (twice, in
>fact).  And when I try to install Java 1.1.8, it can't find Feature 
>Install, and asks for a path.  I give it the path and the java & 
>donuts hang-in for a moment, then I get the 3175 msg again, that there
>is an access violation in install.dll.  And it hangs.  I'm stuck.
>

I'm still wondering about what you said earlier -- you downloaded 
Javainuf.exe and unzipped it in x:\java11. That's the directory where 
Feature Installer attempts to install java . . even if this did work (and I 
have my doubts) you'd end up with a right terrible mess in that directory.

Is this what you are doing, or is it just my bad comprehension ?
 

>--Ed Germain
>
--
Hrad ngravvrd


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 09-Oct-99 05:05:01
  To: All                                               09-Oct-99 11:03:25
Subj: Re: Backing up and Restoring with Back Again/2

From: zayne@omen.com.au (Mooo)

Alan Beagley <abeagley@datatone.com> wrote:

I didnt change anything here, except to go to fixpack 30 (as I recall)
- broke BA/2 straight away.  After heaps (I mean heaps!) of fiddling
and testing I could never get it to work properly again.  This was
using a 1542 ISA, a very old and mature card so I don't know what to
say.

Its now down to CDS, as I tested Cristie's PC-Bax and it works like a
champ.  I also tried using GTAK GTAR for a while to prove my hardware
- it works and works fine.

Craig


>Well, I am using Warp 4 with FP 12. I corrected the problem by connecting the 
tape drive to a different
>SCSI card. I believe that many people have found that tape drives doen't play 
nicely with the more
>exotic Adaptec SCSI controllers such as the AHA2940, and they keep their
older SCSI cards specifically
>for use with the tape drive -- and not even specifically for OS/2.
>
>Alan
>
>
>Mooo wrote:
>
>> Alan Beagley <abeagley@datatone.com> wrote:
>>
>> >I have found that I m getting a slew of "CRC mismatch" error messages when 
I try to verify backups
>> >that were made using BA/2 Pro ver. 4.0i with the tape drive connected to
my on-board Adaptec SCSI
>>
>> This is the error that started around FP26 (was it 26?) for Warp3 and
>> was never corrected.
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nothing I say is my own opinion (1:109/42)

+----------------------------------------------------------------------------+

From: bdavis@fn.net                                     09-Oct-99 06:19:27
  To: All                                               09-Oct-99 11:03:25
Subj: Re: cdwriter support

From: bdavis@fn.net (Brian Davis)

On Fri, 8 Oct 1999 23:24:06, rknebel@rknebel.uplink.net (Rick Knebel) 
wrote:

> Hi,
> 
> I was just curious if there is a program that will support cdwriting under
> os2.
> 
> I have a yamaha cd r/w/rw.
> 
> Thanks
> Rick
> 
> 
> -- 
> Rick Knebel
> rknebel@uplink.net
> http://rknebel.uplink.net

Have a look at this URL
http://www.os2voice.org/VNL/past_issues/VNL0899H/vnewsf5.htm

I have a Yamaha 4416s, haven't tried it with Warp4 yet been to
busy. I burned a small image using Cdrecord and Linux so I know
the hardware works. This weekend I'll have the time to try it with
OS/2. Good luck.


Brian Davis (bdavis@fn.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dcurren@ibm.net                                   09-Oct-99 06:34:28
  To: All                                               09-Oct-99 14:41:27
Subj: Re: cdwriter support

From: "Dale Curren" <dcurren@ibm.net>

On Sat, 09 Oct 1999 05:01:44 -0800, Alex Smariga wrote:

>

But it costs nearly 200 dollars!!!


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                09-Oct-99 11:45:17
  To: All                                               09-Oct-99 14:41:27
Subj: Re: Java 1.1.8 ~ What the f*@#k? Summary

From: lifedata@xxvol.com

hamei@pacbell.net said:

>I'm still wondering about what you said earlier -- you downloaded 
Javainuf.exe
>and unzipped it in x:\java11. That's the directory where  Feature Installer
>attempts to install java . . even if this did work (and I  have my doubts)
>you'd end up with a right terrible mess in that directory.

>Is this what you are doing, or is it just my bad comprehension ?

I thought that was a good question too.  The javainuf files should be inzipped
to a temporary directory, not the Java11 directory.

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    09-Oct-99 16:58:04
  To: All                                               09-Oct-99 16:32:21
Subj: Re: FP12:  A Piece Of Cake!

From: rcpj@panix.com (Pierre Jelenc)

Trevor Hemsley <Trevor-Hemsley@dial.pipex.com> writes:
> 
> No. The problem is that the 1997 driver has a bug in it. It doesn't affect
> anything until you apply the later fixpacks at which point it blows up. 

Oh, then that's bad because that's the only driver there is at the ESS web
site as well!

I had FP11 before my ill-fated attempt at 12 and I did not see any problem
then, but maybe I was lucky? I am now at FP6, so perhaps I should not
tempt fate? There was something I needed from one of the later FPs but I
don't remember what it was.

As of now, I get problems with many install/setup programs that close with
an access violation in DOSCALL1.DLL but it seems that the installations
themselves ran OK (most were used only to recreate desktop objects.)

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       09-Oct-99 17:39:17
  To: All                                               09-Oct-99 16:32:21
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: Will Rose <cwr@cts.com>

Siobhan Perricone <morgannalefey@my-deja.com> wrote:
: In article <7tl4g6$2mm1$1@thoth.cts.com>,
:   Will Rose <cwr@cts.com> wrote:

:> [OFFTOPIC]

: Off topic?  I'd think it was spot on. :)

:> If you're new to maintaining OS/2 systems, be aware that you really
:> need an INI file cleaner for reliability; I use Unimaint to handle
:> the desktop backup and INI file cleaning, but there are several PD
:> programs which will do the job.  Junk in the INI files has a bad
:> effect, especially on FAT systems.

: Here are the words I understood from the above paragraph:

: "If you're new to maintaining OS/2 systems...lkj;afo weina;kdjf
: laljskdfj"

: You lost me, really.  I'm starting to feel like OS/2 is similar to
: Amiga, in that you need to know a hell of a lot about how the system
: operates in order to keep it stable and get things to run.  What pisses
: me off about this is I AM NOT AN IDIOT.  I have been a computer
: hobbyist and technical support person for years.  I STARTED on a VIC20,
: moved to a Commodore 64 and until four years ago I was operating only
: Amiga 3000s at my house.  I ran a BBS on an Amiga for crying out loud.
: I'M NO NEWBIE.

I'm sorry I upset you; OS/2 really isn't difficult to maintain.  My
present 3.0 system is around four years old, depending; it's been
upgraded with Fixpacks in that time of course, but it would be older
if a disk hadn't failed and I'd taken the opportunity to do a re-install
of the OS and a reload of the apps from tape (using BA/2, in fact).

However, there is one thing, as I said, that you do need.  OS/2 keeps a
lot of system information in \os2\os2.ini and \os2\os2sys.ini.  If these
files are hosed, you've either got a dead system or a lot of re-installing
to do.  There are ways of recovering them, well documented in the manuals,
and you can usually restore either your last saved state or the default
'boot' state; but you need to read up the problem ahead of time.

The other problem is that the two files get full of junk entries, of files
and drives long deleted or disconnected.  This junk does the OS no good;
at best it slows things down and at worst it confuses the system enough
to crash it.  There are several PD programs which remove dead entries
(clean up) the INI files, and at least one commercial program, UNIMAINT,
which is the one I'm familiar with.  This program also saves and
restores the desktop; also useful, since configuring a desktop takes 
time and you don't want to do it more than once.


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    09-Oct-99 18:54:21
  To: All                                               09-Oct-99 19:56:25
Subj: Re: FP12: A Piece Of Cake!

From: rcpj@panix.com (Pierre Jelenc)

 <ned_snow@my-deja.com> writes:
> 
> This appears not to be the case. I am running Warp 4/FP12 with
> an Eagle ESS1869 base card, and the sound is fine. When I
> installed FP11 and got the expected trap, I found this driver
> via a deja search of the OS/2 newsgroups. It can be obtained
> here:
> 
> http://duanec.indelible-blue.com/fixes/LatestWarp4.html

The 1869 driver is indeed newer than my original one, but it does not seem
to work. I renamed the old driver and copied this one into \MMOS2, then
rebooted. I got no error during the boot process, but when I try to play a
CD I get no sound, and when I try to play an MP3 with PM123 I get the
following error: "MCI Error 5134: No device driver found."

Rebooting with Alt-F2 shows that the driver is indeed not loaded as far as
I can tell. The line in config.sys is:

DEVICE=C:\MMOS2\ES1869DD.SYS /B:220 /D:1 /F:3 /I:5 /C:4 /M:300,1 /W:0
/N:ES18691$

I restored the 1997 driver and it loaded fine.

Pierre, still at FP6
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 09-Oct-99 19:27:27
  To: All                                               09-Oct-99 19:56:25
Subj: DECTalk - Pathworks

From: hamei@pacbell.net

Anyone have a need for an OS/2 client for a DECTalk network ? 
Grabbed this at a computer sale, Pathworks for OS/2 v5, if someone
could actually *use* it that'd be better than sitting on my shelf
looking pretty. Afraid of the consequences if it doesn't leave here  - 
nothing like having an excuse to install a VAX 750 in the laundry room.

--
Hrad ngravvrd


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: dink@dont.spam.me                                 09-Oct-99 15:23:12
  To: All                                               09-Oct-99 19:56:25
Subj: Re: cdwriter support

From: "dinkmeister" <dink@dont.spam.me>

On Sat, 09 Oct 1999 06:34:57 -0600 (MDT), Dale Curren wrote:

:On Sat, 09 Oct 1999 05:01:44 -0800, Alex Smariga wrote:
:
:>
:
:But it costs nearly 200 dollars!!!

Try CDRecord/2, its free & I wouldn't use anything else =)
Heres the url:
http://www.geocities.com/SiliconValley/Sector/5785/cdrecord/cdrecordmain.htm

Theres a nice gui front end for it at hobbes, do a search for "cdwrit"

- dink ( http://dink.org )




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none (1:109/42)

+----------------------------------------------------------------------------+

From: nospam_hkelder@capgemini.nl                       09-Oct-99 21:41:18
  To: All                                               09-Oct-99 19:56:25
Subj: Re: Java install failure

From: Henk kelder <nospam_hkelder@capgemini.nl>

John,

Don't know the cause, but I have exactly the same problem.

Also, After this failed installation, my \OS2\BOOK directory suddenly is
called:
'7 OS/2 Java Internationalization - Inventory'

Henk

John Mandeville wrote:
> 
> I've tried installing Java 1.1.8, but the installation fails after all
> the files are copied.  It tells be to check
> x:\os2\install\wpinstal.log.  After adding x:\Java11\rmi-iiope to the
> path, it gives the message "**NULLID"" :: Exception -1073741819 returned
> to instthrd.c 7301".  Not knowing what exception -1073741819 is, I'm
> don't know what to do next.  It got far enough that some of my Java apps
> run OK, but others do not.  Ideas?
> 
> --
> John Mandeville

> jemandy at earthlink dot net

-- 
Remove nospam when replying..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: capgemini.nl (1:109/42)

+----------------------------------------------------------------------------+

From: nospam_hkelder@capgemini.nl                       09-Oct-99 23:02:26
  To: All                                               09-Oct-99 19:56:25
Subj: Re: Java install failure

From: Henk kelder <nospam_hkelder@capgemini.nl>

Just found the cause of the problems and solved it (at least for myself)

The problem is in x:\OS2\INSTALL\FI.INI (where x is your boot drive)

This file appearantly keeps a list of all installed features.
Per installed feature it keeps the WPS internal objecthandle of the
directory where the feature installer has stored it's install
information (note: not the installed feature, but just the info about
it).

On my PC two entries pointed to incorrect directories. I manually
changed the entries to the correct values and bingo: JAVA 1.1.8 suddenly
installs without a problem.

To scan FI.INI for which locations it contains please download:

http://www.os2ss.com/information/readfi.exe
http://www.os2ss.com/information/WPTOOLS.NEW

and place this in \OS2\INSTALL

And rename WPTOOLS.NEW on your machine to WPTOOLS.DLL. (Note: this is a
newer version as in WPTOOLxx.ZIP and is NOT compatible with the one in
that archive. So make sure you keep the one from the archive)

The run READFI. This will read all entries in FI.INI and show to what
paths it points.

They should all be in \OS2\INSTALL or a subdirectory from it.

Henk

Henk kelder wrote:
> 
> John,
> 
> Don't know the cause, but I have exactly the same problem.
> 
> Also, After this failed installation, my \OS2\BOOK directory suddenly is
> called:
> '7 OS/2 Java Internationalization - Inventory'
> 
> Henk
> 
> John Mandeville wrote:
> >
> > I've tried installing Java 1.1.8, but the installation fails after all
> > the files are copied.  It tells be to check
> > x:\os2\install\wpinstal.log.  After adding x:\Java11\rmi-iiope to the
> > path, it gives the message "**NULLID"" :: Exception -1073741819 returned
> > to instthrd.c 7301".  Not knowing what exception -1073741819 is, I'm
> > don't know what to do next.  It got far enough that some of my Java apps
> > run OK, but others do not.  Ideas?
> >
> > --
> > John Mandeville
> 
> > jemandy at earthlink dot net
> 
> --
> Remove nospam when replying..

-- 
Remove nospam when replying..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: capgemini.nl (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            08-Oct-99 23:28:26
  To: All                                               09-Oct-99 19:56:25
Subj: Re: FP12:  A Piece Of Cake!

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Thu, 07 Oct 1999 23:03:00 -0400, J. R. Fox wrote:

>yyyc186.illegaltospam@ibm.net wrote:
>> 
>> In <7tc5ub$e8i$1@panix2.panix.com>, on 10/05/99
>>    at 02:30 AM, rcpj@panix.com (Pierre Jelenc) said:
>> 
>> IBM kissed off over 60% of the OS/2 user base with FP 12.  You can't get
>> your soundcard back and they have no intention of fixing it.  Unless you
>> can read the chip numbers and find the manufacturer you are screwed.
>> Actually, you are still screwed.  ESS has moved on to greater sound chips
>> and hasn't updated the OS/2 driver for the 1869 since 1997.  They have no
>> plans to.  They have moved onto chips with higher margins and greater
>> capabilities.
>> 
>> Give IBM a big round of applause for finally killing OS/2.
>> 
>> Roland
>> 
>
>I don't follow your logic here (or it is imprecisely written, 
>or I'm not reading it correctly): if this only applies to the
>ESS based cards, how does that account for 60 % of OS/2 users ?
>I doubt that many are using ESS.  At the moment, I've got 4 
>soundcards here (trying to line up the best one for Warp), and 
>*none* of them are ESS-based.  If you're saying that FP-12 
>breaks *any* installed soundcard -- and this turned out to be
>true -- that would indeed be serious.  But, to date, I haven't 
>heard this assertion anywhere else.
>
><jf>

And of the ESS cards it applies only to some if any.

I have a 1688 with a driver dated 23-OCT-98 and have no 
problems with FP 12.

ek





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     09-Oct-99 21:19:08
  To: All                                               09-Oct-99 19:56:25
Subj: Re: Backing up and Restoring with Back Again/2

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Sat, 9 Oct 1999 04:27:19, mike.luther@ziplog.com wrote:

..snip...
> Noted.  There are some curious variations.  It is unlikely that the
> average user here will be using things like the 3940UW ..  We do use
> them in places.  As far as I uderstand that card, it is actually two
> complete hardware operations on a single PCI card.  It has two complete
> operational channels on that single card, each of which has the above,
> general termination logic.  However, both channels can report in to the
> buss slot as if it were, more or less, one 'card.'
> 
> They are .. 'another device' as in your above, sort of built in one
> card, as I think I understand these cards...
> 
> More important, the card uses TWO interrupts as well.  Although some
> setups will assign the same interrupt, in error, it seems, to both the
> channels, you must, somehow, get that card into the system with two of
> them, not one for the paired channels.

That does sound like it has two controlers on one card. In that case, 
you would need 4 terminators, two for each bus. It is possible that 
there is a permanent terminator, at the card end, for each bus, in 
which case, you only need the devices attached to each interface 
terminated. You would need the installation instructions to determine 
the proper termination that is required.
 
> Since we have and use thes cards, and I had no documentation at all, nor
> any drivers furnished with the on-board Adaptec controller in the mother
> board embedded version, I really had no idea of what to expect when
> faced with both a pair of 68 pin connectors and a pair of 50 pin
> connectors coming out of the same board!
> 
> What would you expect an uninformed user to use for configuration
> knowledge under those circumstances?  What actually is the embedded
> device setup?  I still have no documentation for it at all; have no idea
> what it presents as a user interface, other than what pops up in the
> Award BIOS that drives the ASUS boards!

Personally, I would EXPECT to get some documentation with the card (or
the motherboard, or the PC). Is there something available from the 
Adaptec web site (sorry, I don't have a web address)?
 
> At near full-time in this game since 1974, I'm still at a loss if I have
> no data on the device and implementation .. :)

You should not need to guess at these things. You should have got 
documentation with the adapter.
 
..snip...
> And yet, if you are using the later WD 9.18GB hard disks and it is the
> only device on the 68 pin cable, and you enable termination on it, on a
> 2940UW, it will:
> 
>         1.) Prep - using the built in Adaptec utility,
>         2.) Verify - using the built in Adaptec utility,
>         3.) Fdisk using the OS/2 FP8 IBM utility and 7870 driver,
>         4.) Format using the OS/2 FP8 IBM utility and 7870 driver,
>         5.) Go through a complete CLREST rebuild using that 7780 driver,
>         6.) Then ... on initial boot, you will see the Adaptec
>             controller tell you something like, "Improper termination.."
> 
> At that point, you may pop on a passive or active 68 pin terminator.
> The error message will go away.  That's three terminations on one cable
> channel.

It sounds to me like the termination on the drive is one of those 
things that does not work correctly.
 
> You may then disable the WD termination, power or not pin, as you like,
> it makes no difference.

Probably, because it doesn't work at all. If you have a real 
terminator installed, I would jumper it for no termination, just to 
make sure you don't have a partial termination.
 
> As long as the extenal cable terminator is on the end of the cable and
> the drive is in the middle as in your example. it all works as well...
> 
> What's wrong with WD?
> 
> --> Sleep well; OS2's still awake! ;)
> 
> Mike.Luther@ziplog.com
> Mike.Luther@f3000.n117.z1.fidonet.org
> 

I don't know if there is a problem with WD, or there could be some 
"automatic" termination thing that is kicking in when it shouldn't. In
any case, it seems that the built in drive termination is either 
broken, or incompatible with your setup. The fix seems to be to use an
external terminator, and turn off the drive termination (just to make 
sure).

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     09-Oct-99 21:19:10
  To: All                                               09-Oct-99 19:56:25
Subj: Re: Backing up and Restoring with Back Again/2

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Fri, 8 Oct 1999 23:55:18, yyyc186.illegaltospam@ibm.net wrote:

>  
> In theory this is correct.  However, crummy vendors like Adaptec don't let
> themselves be bothered with "specifications".  The bulk of their cards
> which I have had the misfortune to utilize in the past impliment the
> internal and external interfaces as two seperate PHYSICAL SCSI chains but
> use the driver to make it LOGICALLY a single chain.
>   

If there are two physical chains, then you need FOUR terminations, and
I would expect the two chains to have built in termination at the card
end. If the card doesn't work acording to the SCSI specification, then
don't use it. In any case, you should NEVER need three terminators on 
a SCSI bus. If you do, there is something else wrong, and it should be
fixed.

I do hope I am making myself clear...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     09-Oct-99 21:19:12
  To: All                                               09-Oct-99 19:56:25
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Fri, 8 Oct 1999 18:00:19, Siobhan Perricone 
<morgannalefey@my-deja.com> wrote:

..snip...
> I'M NO NEWBIE.

Well, actually, you are. OS/2 is a very complicated operating system, 
once you get below the surface. I suggest that you may find a lot of 
good information at the OS/2 supersite (http://www.os2ss.com). There 
is a link there for new users, with a LOT of good information (even 
for experienced users).

> I just spent the morning researching utilities that help me terminate
> applications that are hung up.  I dl'd a bunch of things from hobbes
> and installed them to see what they did only to find that many of them
> need me to give a PID in order to "kill a process" (I know what the
> means, but, honestly...).  Further research revealed that I could find
> the PID by using PSTAT.  So now I'm trying to figure out how the hell
> to read whatever it is that PSTAT gives me.

The easy way to do that, is to add th line: "SET 
KILLFEATUREENABLED=ON" (no quotes) to your CONFIG.SYS. Then if you 
hold down Ctrl and click on the second icon from the left on the 
WarpCenter (looks like three pices of paper), it will give you a list 
of the running processes, and if you click on a process, it will ask 
if you want to kill it (there is another entry that will bypass the 
confirmation, but I suggest that you do not use that, until you become
a little more familiar with what happens).

Be aware that some of those kill programs will cause more problems 
than they fix.
 
> I *know* that these tools are all very powerful and useful in a lot of
> ways, but the learning curve on this stuff is *incredibly* frustrating.

Not only "frustrating", the learning curve is very steep. It takes 
time to figure all of this stuff out. I started working with OS/2 in 
about 1989, and I am still learning new things.
 
> ALL I wanted to do was close a window that was hung up.  It was a
> delete confirmation window for the deletion of some print jobs that
> were sitting in a printer device window.  The confirmation window hung
> and I wanted to close it.  The online help is only useful if you
> already KNOW what everything means and how it works.  The online
> tutorial doesn't cover this level of effort, and there are no classes
> for me to attend to learn this stuff in a useful way.

The newsgroups are, probably, the place to learn about these things. 
Sometimes, OS/2 will not let you do certain things (like close 
windows), if doing so might compromise the integrity of the system. 
The KILL programs were created to overcome his reluctance to 
compromise the system, but when you use one, it could mean a system 
crash will result.
 
> So I'm stuck with half-assed documents that don't provide sufficient
> cross referencing; an 800 page reference book that's great, except the
> index is like three pages long and so I can never FIND anything in it;
> and newsgroups that give good answers occasionally, but never enough to
> actually let me *complete* anything, and snide half answers from people
> like Roland the rest of the time (Oh, BTW, thank you Roland for
> confirming my initial impression of you, I won't bother you with
> responses to your rantings any more, you get the last word).

The user's guides, and tutorials, are only meant to be a beginners 
introduction to OS/2. The newsgroups are the best source of 
information (unless you want to buy an expensive service contract from
IBM), unfortunately, a lot of posters assume that you have been using 
OS/2, and understand, at least, how the basics work. Other posters, 
seem to have a problem with understanding how computers work, and post
a lot of garbage. The trick is to indicate that you are new at OS/2, 
and need some advice, then ignore the posts that don't answer your 
questions, and ask for more information, if the information seems to 
be incomplete. You did come across, as being an experienced OS/2 user 
(probably because you understand the proper terms, and your signature 
indicates, at least, a familiarity with computers). I suspect that you
will  pick up a lot of good information about OS/2 in these 
newsgroups, but you are a NEWBIE when it comes to OS/2, and it would 
be beneficial to indicate that when you ask questions (say "new to 
OS/2, but familiar with other operating systems").
 
> I've got a program that looks great and useful, CAD Commander, but I
> can't figure out how to get it to close the delete confirmation window
> for the deletion of a print job that's sitting in a printer device.  I
> got it to terminate a variety of applications, but none what it
> terminated was what I needed to terminate.  WHY is this so HARD to
> find?!
> 
> --
> Siobhan Perricone
> PC Technician
> Alltel Information Services
> (I only speak for myself, not for Alltel)
> 
> 
> Sent via Deja.com http://www.deja.com/
> Before you buy.

The problem is, that the delete confirmation window, is not a program.
It is part of the PMShell, which is the whole GUI (Graphical User 
Interface). If you want to get rid of that, you need to kill the 
PMShell (there are, usually, two of these running, and you need to get
the right one), which should blow away the desktop, and restart it 
(doesn't always work, and some running programs will survive, while 
others will also be terminated). There are a couple of other things to
consider, like whether you will restart programs, when you do this. 

I suggest another thing to look for, is ConfigMaint/2 (look for 
CFGMT100.ZIP, and the latest update CFGUPD3.ZIP, in the usual places 
-> meaning HOBBES, or the OS/2 supersite). The dat file is readable in
a text editor (the OS/2 system editor), and contains a lot of good 
information. The program itself, helps you understand, and edit, your 
CONFIG.SYS file. Specifically, look up the "SET RESTARTOBJECTS=" line.
(which is not in the default CONFIG.SYS).

By the way, NEVER attempt to edit the OS/2 CONFIG.SYS with any text 
editor, other than the OS/2 system editor, or the TEDIT program. Most 
of them will not handle lines long enough to accomodate some of the 
lines that OS/2 stuffs into the file, and you will have problems. (The
ConfigMaint/2 program can handle long lines).

The proper way to close that window, is to reply to it. If it does not
close, there is something else wrong, that should be fixed. Give us a 
little more information, about what your hardware configuration is, 
what fix pack level you are at, how you got into the problem, and 
about what you were trying to do, and somebody may be able to suggest 
a possible fix.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: applicon@otenet.gr                                10-Oct-99 00:33:03
  To: All                                               09-Oct-99 19:56:25
Subj: Control systems applications

From: Papaparaskevas Paris <applicon@otenet.gr>

Hello OS/2 community,
I am looking for SCADA (supervisory control and data acquisition)
applications for OS/2.
Does anyone have a clue?
I am currently using such applications under WinNT and paying the price.

Thanks in advance.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: An OTEnet S.A. customer (1:109/42)

+----------------------------------------------------------------------------+

From: mtillema@nospam.hobby.nl                          08-Oct-99 22:28:28
  To: All                                               09-Oct-99 19:56:25
Subj: Re: trouble with DeScribe and PS printer driver

From: "Menno Tillema" <mtillema@nospam.hobby.nl>

On Thu, 07 Oct 1999 20:34:41 GMT, Jack Roberts wrote:

>i've been trying to get DeScribe to work with the PostScript printer
>driver so i can try out some of the PDF creation programs that i've seen
> lately.  unfortunately, when i have the PS printer set up, DeScribe
>freezes my computer when i start it.  i thought that maybe it was a

I use it with the PDF Port driver which was announced in Warpcast a few day's
ago (can't remember the URL though).  Works like a charm and is really too
simple.

Tot mails, <Menno>

------------------------------------------------------------
Menno Tillema       
mtillema@nospam.hobby.nl                
vervang nospam door belgarath voor een reply

kijk ook eens op http://www.heemschut.nl
------------------------------------------------------------
Read more ... QUOTE LESS




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET-NL (http://www.nl.uu.net) (1:109/42)

+----------------------------------------------------------------------------+

From: jvarela@mind-spring.com                           09-Oct-99 21:48:15
  To: All                                               09-Oct-99 19:56:25
Subj: Re: Fp12 and default fonts

From: jvarela@mind-spring.com (John Varela)

On Sat, 9 Oct 1999 02:54:40, dariusz@mnsi.net (Dariusz Piatkowski) 
wrote:

> I've got exactly the same problem here...on top of this there are some
> other weird graphic related things going on...stuff like missing dialogue
> buttons, etc....hmm, will give FP12 a try for a few days...but I just might
> uninstall if this keeps up.

Me too.  The PMMail internal editor font was changed.  I changed it 
back with the font palette but that didn't stick.  The settings page 
showed the same font (System VIO 12) that I have been using but I just
now for this message re-entered it; we'll see if it sticks this time. 
The tabs in Lotus Organizer have lost everything but their initials.  
That is, "Calendar" displays as just a "C", "Addresses" as just "A" 
and so forth.  No idea how to go about trying to correct that.

--
John Varela
to e-mail, remove - between mind and spring

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            09-Oct-99 22:46:11
  To: All                                               09-Oct-99 21:21:27
Subj: Re: Backing up and Restoring with Back Again/2

From: mike.luther@ziplog.com

In <SKfw30zmCGmZ-pn2-Lp48KH9G7Ig6@localhost>, doug.bissett"at"attglobal.net
(Doug Bissett) writes:
>On Sat, 9 Oct 1999 04:27:19, mike.luther@ziplog.com wrote:


   Chomp:)

>> device setup?  I still have no documentation for it at all; have no idea
>> what it presents as a user interface, other than what pops up in the
>> Award BIOS that drives the ASUS boards!
>
>Personally, I would EXPECT to get some documentation with the card (or
>the motherboard, or the PC). Is there something available from the 
>Adaptec web site (sorry, I don't have a web address)?

You see, we both have enough experience to know what['s good for us!
Grin... That doesn't mean, in the middle of nowhere, that we either have
it, or .. maybe ..  even have access to the web!!

>> At near full-time in this game since 1974, I'm still at a loss if I have
>> no data on the device and implementation .. :)
>
>You should not need to guess at these things. You should have got 
>documentation with the adapter.

Yep .. But should oughta ain't did!

>> At that point, you may pop on a passive or active 68 pin terminator.
>> The error message will go away.  That's three terminations on one cable
>> channel.
>
>It sounds to me like the termination on the drive is one of those 
>things that does not work correctly.

Yep.

>> You may then disable the WD termination, power or not pin, as you like,
>> it makes no difference.
>
>Probably, because it doesn't work at all. If you have a real 
>terminator installed, I would jumper it for no termination, just to 
>make sure you don't have a partial termination.

Dun dun it. :)

>I don't know if there is a problem with WD, or there could be some 
>"automatic" termination thing that is kicking in when it shouldn't. In
>any case, it seems that the built in drive termination is either 
>broken, or incompatible with your setup. The fix seems to be to use an
>external terminator, and turn off the drive termination (just to make 
>sure).
>
>Hope this helps...

Yes E=IR ain't necessarily so for RF.. is it?  Grin ..

Like the old Pennzoil sound byte ... you've got to sound your Zzzzzz!

>******************************
>From the PC of Doug Bissett

Every day at this game I get to learn something new...  Amazing! I think
some of this stuff is like being able to break an anvil.  It gets broke!


--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            09-Oct-99 22:49:07
  To: All                                               09-Oct-99 21:21:27
Subj: Re: FP12:  A Piece Of Cake!

From: mike.luther@ziplog.com

In <7tns70$gb$1@news.panix.com>, rcpj@panix.com (Pierre Jelenc) writes:
>Trevor Hemsley <Trevor-Hemsley@dial.pipex.com> writes:

>I had FP11 before my ill-fated attempt at 12 and I did not see any problem
>then, but maybe I was lucky? I am now at FP6, so perhaps I should not
>tempt fate? There was something I needed from one of the later FPs but I
>don't remember what it was.

  A Y2K morsel, perhaps?  AFAIKR, some of the secondary fixes were
  beyond FP6 ..

--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: pcoen@drunivac.drew.edu                           09-Oct-99 18:54:14
  To: All                                               09-Oct-99 21:21:27
Subj: Re: DECTalk - Pathworks

From: Paul Coen <pcoen@drunivac.drew.edu>

hamei@pacbell.net wrote:
> 
> Anyone have a need for an OS/2 client for a DECTalk network ?
> Grabbed this at a computer sale, Pathworks for OS/2 v5, if someone
> could actually *use* it that'd be better than sitting on my shelf
> looking pretty. Afraid of the consequences if it doesn't leave here  -
> nothing like having an excuse to install a VAX 750 in the laundry room.

Would that be with or without the Unibus expansion cabinet? :)

(Laundry room would be funny -- we had a hardware incident in our
system guide that our service rep put there that said "air flow
sensor blocked by dust bunny like size of Texas" -- I can
just imagine what lint would do :)

Seriously, though, while I don't have any use for it, this
would give someone DECnet support, I believe it came with
support for the LAT transport as well. Finally, Pathworks v5 was
the version that went "whole hog" lan manager (on the server
side it split the Pathworks user info from the VMS user information 
into a differnet database). You might want to post this to
comp.os.vms as well -- there may be someone looking for some
sort of DECnet support on a microcomputer to hook to VMS
box.

I'm a little nostalgic -- although the fact that going to
Pathworks 5 was going to be as much work for us as going to
a different NOS made us switch to Netware 4.x. In the long
run, I'm glad we did.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@nospam.net                               09-Oct-99 19:01:13
  To: All                                               09-Oct-99 21:21:27
Subj: Re: cdwriter support

From: letoured@nospam.net

In <qpheeravozarg.fjc0290.pminews@news-s01.ny.us.ibm.net>, on 10/09/99 
   at 06:34 AM, "Dale Curren" <dcurren@ibm.net> said:

>On Sat, 09 Oct 1999 05:01:44 -0800, Alex Smariga wrote:

>But it costs nearly 200 dollars!!!


And its worth every penny!

_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: wcs@dumbguy.earthling.net                         09-Oct-99 23:33:28
  To: All                                               09-Oct-99 21:21:27
Subj: Re: cdwriter support

From: wcs@dumbguy.earthling.net (Will Smith)

On Sat, 9 Oct 1999 12:34:57, "Dale Curren" <dcurren@ibm.net> wrote:

> On Sat, 09 Oct 1999 05:01:44 -0800, Alex Smariga wrote:
> 
> >
> 
> But it costs nearly 200 dollars!!!
> 
> 

  And well worth every penny. GREAT support and
dedicated to continued os/2 developement.

  Bill

^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^

Education does not equal intelligence.
Intelligence is common sense.
There is very little intelligent life on Earth.
Microsoft would not rule the desktop, if there was!

^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: lafaix@ibm.net                                    10-Oct-99 01:49:19
  To: All                                               09-Oct-99 21:21:27
Subj: Re: Java install failure

From: lafaix@ibm.net (Martin Lafaix)

In article <37FE4424.7EBDA662@nospam.com>,
John Mandeville <nospam@nospam.com> wrote:
>I've tried installing Java 1.1.8, but the installation fails after all
>the files are copied.  It tells be to check
>x:\os2\install\wpinstal.log.  After adding x:\Java11\rmi-iiope to the
>path, it gives the message "**NULLID"" :: Exception -1073741819 returned
>to instthrd.c 7301".  Not knowing what exception -1073741819 is, I'm
>don't know what to do next.  It got far enough that some of my Java apps
>run OK, but others do not.  Ideas?

Be sure you are using the latest Feature Install (v1.2.5).
--
Martin Lafaix <lafaix@ibm.net>
Team OS/2
http://www.multimania.com/lafaix

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Cityboy@Spam-No-More.Net                          09-Oct-99 17:59:12
  To: All                                               10-Oct-99 03:23:18
Subj: Re: FYI <--SPAM

From: Cityboy@Spam-No-More.Net

S P A M !

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Concentric Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: Cityboy@Spam-No-More.Net                          09-Oct-99 18:11:09
  To: All                                               10-Oct-99 03:23:18
Subj: Re: Word6 CBT trick 

From: Cityboy@Spam-No-More.Net

>Anybody know how to get the Word 6 tutorials to install and run in
>Win-OS2? I heard there was a trick, but I can't find it, and they won't
>go now.

Ah Yes! The trick is run WinOS/2 in a specific DOS version, ie. some
version of MS-DOS. Read up on VMDISK in the OS/2 command reference to
find out how to do it.  When the Word install runs it will then think
it is being run in "real" DOS/Windows and install the tutorials and
the CBT. Microsnot has something in there to detect OS/2 and prevent
the help and training from being installed. With the specific DOS VDM
it can't tell.

--
-----------------------------------------------------------
cityboy@concentric.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Concentric Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             09-Oct-99 21:14:11
  To: All                                               10-Oct-99 03:23:18
Subj: Re: Backing up and Restoring with Back Again/2

From: Alan Beagley <abeagley@datatone.com>

What documentation did you get with the motherboard? If you didn't get much,
then look at
ftp.asuscom.de for documenttion in .PDF format (in English). What BIOS
revision do you have on the
motherboard? Some of the later ones update the SCSI BIOS too: mine started out 
at ver. 2.01; it is now
at 2.11.

Alan


mike.luther@ziplog.com wrote:

> In <SKfw30zmCGmZ-pn2-Lp48KH9G7Ig6@localhost>, doug.bissett"at"attglobal.net
(Doug Bissett) writes:
> >On Sat, 9 Oct 1999 04:27:19, mike.luther@ziplog.com wrote:
>
>    Chomp:)
>
> >> device setup?  I still have no documentation for it at all; have no idea
> >> what it presents as a user interface, other than what pops up in the
> >> Award BIOS that drives the ASUS boards!
> >
> >Personally, I would EXPECT to get some documentation with the card (or
> >the motherboard, or the PC). Is there something available from the
> >Adaptec web site (sorry, I don't have a web address)?
>
> You see, we both have enough experience to know what['s good for us!
> Grin... That doesn't mean, in the middle of nowhere, that we either have
> it, or .. maybe ..  even have access to the web!!
>
> >> At near full-time in this game since 1974, I'm still at a loss if I have
> >> no data on the device and implementation .. :)
> >
> >You should not need to guess at these things. You should have got
> >documentation with the adapter.
>
> Yep .. But should oughta ain't did!
>
> >> At that point, you may pop on a passive or active 68 pin terminator.
> >> The error message will go away.  That's three terminations on one cable
> >> channel.
> >
> >It sounds to me like the termination on the drive is one of those
> >things that does not work correctly.
>
> Yep.
>
> >> You may then disable the WD termination, power or not pin, as you like,
> >> it makes no difference.
> >
> >Probably, because it doesn't work at all. If you have a real
> >terminator installed, I would jumper it for no termination, just to
> >make sure you don't have a partial termination.
>
> Dun dun it. :)
>
> >I don't know if there is a problem with WD, or there could be some
> >"automatic" termination thing that is kicking in when it shouldn't. In
> >any case, it seems that the built in drive termination is either
> >broken, or incompatible with your setup. The fix seems to be to use an
> >external terminator, and turn off the drive termination (just to make
> >sure).
> >
> >Hope this helps...
>
> Yes E=IR ain't necessarily so for RF.. is it?  Grin ..
>
> Like the old Pennzoil sound byte ... you've got to sound your Zzzzzz!
>
> >******************************
> >From the PC of Doug Bissett
>
> Every day at this game I get to learn something new...  Amazing! I think
> some of this stuff is like being able to break an anvil.  It gets broke!
>
> --> Sleep well; OS2's still awake! ;)
>
> Mike.Luther@ziplog.com
> Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           09-Oct-99 23:43:16
  To: All                                               10-Oct-99 03:23:18
Subj: Junkbuster for OS/2??  was: Re: SmartCache

From: "RichS" <worlock@frontiernet.net>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

Junkbuster... for OS/2??? Please excuse my ignorance but where would one find
this version? It's certainly something I would love to be running here!

Thanks for any info...

Rich...


On Sat, 09 Oct 1999 05:13:46 GMT, Robert Mahoney wrote:

>On Tue, 5 Oct 1999 15:54:19, Anssi Saari <as@sci.fi> wrote:
>
>> rmahoney@_REMOVE_THIS_netusa.net (Robert Mahoney) writes:
>> 
>> > On Thu, 23 Sep 1999 00:01:13, jdc0014@InfoNET.st-johns.nf.ca (John 
>> > Hong) wrote:
>> >  
>> > > 	Is it possible to have both SmartCache and Internet Junkbuster 
>> > > running at the same time for a browser?  There is only room there for
one 
>> > > http proxy...
>> > 
>> >   Sure, I have them chained.   Netscape has a localhost proxy to port 
>> > 8080 which is the Smart Cache port.  In the Smart Cache config file 
>> > have a line...
>> 
>> But what's the point? I haven't used Junkbuster any more after
>> starting Smart Cache. Smart Cache seems to block what I want it to
>> block pretty good.
>
>  I've found excellent block files for junkbuster.  Junkbuster seems 
>to have a 
>far more flexible block format and I didn't feel like translating the 
>block file to Smart Cache.
>
>  Plus Junkbuster replaces the annoying gifs with 1x1 transparent 
>images so you don't even see the ads.
>
>Bob
>--
>Robert Mahoney
>2Rud Software and Consulting
>http://www.netusa.net/~rmahoney

******************************************************************************
Practice Random Acts of Kindness and Senseless...Umm...Uhh....
Oh - Heck...I never could remember all that "nice" stuff.
-
-----------------------------{worlock@frontiernet/net}-------------------------
-------
******************************************************************************



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: noconv

wj8DBQE3//1/JUo5KMjfuWMRApEPAKDETp6MMdjRAl0noq9xe6+Fzuq3xgCfXWw2
KvCDrNdZ0b+N6jvV1jT8h3c=
=JhIA
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: egermain@mediaone.net                             10-Oct-99 03:57:18
  To: All                                               10-Oct-99 03:23:18
Subj: Re: Java 1.1.8 ~ What the f*@#k?: SUCCESS!

From: egermain@mediaone.net (Edward Germain)

Thank you EVERYONE!

For those who are still stuck:  

In C:\os2\install\ delete Fi.Ini, Fi.Bak, FiSetup.Log and while you're
at it: Exit.Fi.

Delete all references to Java in your Config.sys, including all paths 
to it.

[I ended up deleting the directories containing Java 1.1.4 and Java 
1.1.7, but I'm not sure this was necessary.)

Then set up Feature Install 1.25 as it recommends: 
<drive>:\feature\fisetup, decompressing it in the fisetup directory.  
Run "Fisetup" from that directory.  Reboot your computer.  Check 
c:\os2\install\ for the Fi.Ini and FiSetup.Log files.  You'll find 
that FiSetup.Log tells you that the installation is complete (and that
you should reboot,but you've already done that).  

Check to make sure that the files install.dll in c:\os2\dll and 
<drive>:\feature\fisetup are the same size and date.  If not, there's 
a problem with the installation.  Reread FiSetup.Log carefully to see 
if something misfired.  Try copying the one from c:\os2\dll to the 
fisetup subdirectory.  Then continue.

Unpack the Java 1.1.8. *.exe file into a temporary directory using the
-di and -ov arguments: "JAVAINUF -di -ov"  

Close down all programs except an OS/2 window and from the temporary 
Java directory, type "Install".  

Tha should do it.  

___________________________

Why did we all have so much trouble?  There are different reasons.  I 
made the mistake of decompressing Java 1.1.8 into the same directory 
Feature Install would try to install it in.

Another person says he had Java 1.1.4 installed and only after he 
deleted that would 1.1.8 install.

A third person said he deleted c:\os2java.  I'm not sure what was in 
it.  But then 1.1.8 installed, and apparently not before.

Several of us were are some (me included) remain confused about what 
the instruction to Feature Install really means when it says to group 
the things to be installed in subdirectories below FiSetup.  Does that
mean something like this: 

	I:\feature\fisetup
		\java118
		\swing
		\comapi.

and why?  Well, it doesn't seem to be crucial.  But it looks as though
that's what it wants.

Thank you to everyone who has helped.  It seems to simple in 
retrospect.  Thank you all!

--ed germain

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Road Runner (1:109/42)

+----------------------------------------------------------------------------+

From: as@sci.fi                                         09-Oct-99 21:41:08
  To: All                                               10-Oct-99 05:08:22
Subj: Re: SmartCache

From: Anssi Saari <as@sci.fi>

rmahoney@_REMOVE_THIS_netusa.net (Robert Mahoney) writes:

> > But what's the point? I haven't used Junkbuster any more after
> > starting Smart Cache. Smart Cache seems to block what I want it to
> > block pretty good.
> 
>   I've found excellent block files for junkbuster.  Junkbuster seems 
> to have a 
> far more flexible block format and I didn't feel like translating the 
> block file to Smart Cache.

I guess I haven't, since even though I downloaded some block file I
had to add my own even for common sites like Hotbot. Anyway,
converting what I had in IJB took maybe 30 seconds or so.
 
>   Plus Junkbuster replaces the annoying gifs with 1x1 transparent 
> images so you don't even see the ads.

Smartcache can do that too, no plus.

-- 
Anssi Saari - as@sci.fi

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tampere University of Technology (1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     10-Oct-99 01:44:29
  To: All                                               10-Oct-99 05:08:22
Subj: Re: FP12:  A Piece Of Cake!

From: yyyc186.illegaltospam@ibm.net

In <rfxbxnhccvaravozarg.fjbgc40.pminews@news3.ibm.net>, on 10/08/99 
   at 11:28 PM, "Esko Kauppinen" <esko.kauppinen@ibm.net> said:

>On Thu, 07 Oct 1999 23:03:00 -0400, J. R. Fox wrote:

>>yyyc186.illegaltospam@ibm.net wrote:
>>> 
>>> In <7tc5ub$e8i$1@panix2.panix.com>, on 10/05/99
>>>    at 02:30 AM, rcpj@panix.com (Pierre Jelenc) said:
>>> 
>>> IBM kissed off over 60% of the OS/2 user base with FP 12.  You can't get
>>> your soundcard back and they have no intention of fixing it.  Unless you
>>> can read the chip numbers and find the manufacturer you are screwed.
>>> Actually, you are still screwed.  ESS has moved on to greater sound chips
>>> and hasn't updated the OS/2 driver for the 1869 since 1997.  They have no
>>> plans to.  They have moved onto chips with higher margins and greater
>>> capabilities.
>>> 
>>> Give IBM a big round of applause for finally killing OS/2.
>>> 
>>> Roland
>>> 
>>
>>I don't follow your logic here (or it is imprecisely written, 
>>or I'm not reading it correctly): if this only applies to the
>>ESS based cards, how does that account for 60 % of OS/2 users ?
>>I doubt that many are using ESS.  At the moment, I've got 4 
>>soundcards here (trying to line up the best one for Warp), and 
>>*none* of them are ESS-based.  If you're saying that FP-12 
>>breaks *any* installed soundcard -- and this turned out to be
>>true -- that would indeed be serious.  But, to date, I haven't 
>>heard this assertion anywhere else.
>>
>><jf>

>And of the ESS cards it applies only to some if any.

>I have a 1688 with a driver dated 23-OCT-98 and have no 
>problems with FP 12.

>ek


and this is a chipset which has been shipping for just over a year.  The
bulk of their line is older than that and used in MANY notebooks...not to
mention low cost generic sound cards.

Roland





-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     10-Oct-99 01:47:08
  To: All                                               10-Oct-99 05:08:22
Subj: Re: Backing up and Restoring with Back Again/2

From: yyyc186.illegaltospam@ibm.net

In <SKfw30zmCGmZ-pn2-7FRbZkOT6dmr@localhost>, on 10/09/99 
   at 09:19 PM, doug.bissett"at"attglobal.net (Doug Bissett) said:

>On Fri, 8 Oct 1999 23:55:18, yyyc186.illegaltospam@ibm.net wrote:

>>  
>> In theory this is correct.  However, crummy vendors like Adaptec don't let
>> themselves be bothered with "specifications".  The bulk of their cards
>> which I have had the misfortune to utilize in the past impliment the
>> internal and external interfaces as two seperate PHYSICAL SCSI chains but
>> use the driver to make it LOGICALLY a single chain.
>>   

>If there are two physical chains, then you need FOUR terminations, and I
>would expect the two chains to have built in termination at the card end.
>If the card doesn't work acording to the SCSI specification, then don't
>use it. In any case, you should NEVER need three terminators on  a SCSI
>bus. If you do, there is something else wrong, and it should be fixed.

And the thing that is wrong is that a substandard vendor doens't allow you
to set termination on the card independantly.  Hence 3 termination sets.

Roland
-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: stephen@turboweb.splat.spam.net.au                10-Oct-99 20:04:25
  To: All                                               10-Oct-99 10:22:27
Subj: Re: Junkbuster for OS/2??  was: Re: SmartCache

From: stephen@turboweb.splat.spam.net.au (stephen)

If I'm not mistaken the following should get you along the path:

http://www.junkbusters.com



On Sun, 10 Oct 1999 03:43:33, "RichS" <worlock@frontiernet.net> wrote:

> Hash: SHA1
>  
> Junkbuster... for OS/2??? Please excuse my ignorance but where would one
find
> this version? It's certainly something I would love to be running here!
>  
> Thanks for any info...
>  
> Rich...
>  

Regards,

Stephen

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Customer of Connect.com.au Pty. Ltd. (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           10-Oct-99 07:45:17
  To: All                                               10-Oct-99 10:22:27
Subj: Re: FP12:  A Piece Of Cake!

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <38002809$1$lllp186.vyyrtnygbfcnz$mr2ice@news-s01.ny.us.ibm.net>, on
10/10/99 at 01:44 AM,
   yyyc186.illegaltospam@ibm.net said:

> >>> In <7tc5ub$e8i$1@panix2.panix.com>, on 10/05/99
> >>>    at 02:30 AM, rcpj@panix.com (Pierre Jelenc) said:
> >>> 
> >>> IBM kissed off over 60% of the OS/2 user base with FP 12.  You can't get
> >>> your soundcard back and they have no intention of fixing it.  Unless you
> >>> can read the chip numbers and find the manufacturer you are screwed.
> >>> Actually, you are still screwed.  ESS has moved on to greater sound
chips
> >>> and hasn't updated the OS/2 driver for the 1869 since 1997.  They have
no
> >>> plans to.  They have moved onto chips with higher margins and greater
> >>> capabilities.

I am afraid this is pure, unadulterated bovine scatology. I have five
machines with five different sound cards including my Thinkpad with an ESS
sound system. It didn't kill any of them. 

Perhaps the person who posted the above doesn't know what he is talking
about? Moreover, having been building machines since 1983, having attended
hundreds of computer shows, having serviced thousands of clients' machines
I fail to believe that ESS based sound cards represent 5% of the market
much less the 50-60% claimed. Far and away, the most ubiquitous sound card
chipset is one or another version of the SoundBlaster family. 

> >>> Give IBM a big round of applause for finally killing OS/2.

...............................................................(the sound
of one hand clapping)

Of course he won't be able to hear it.

> >>> 
> >>> Roland
> >>> 
> >>
> >>I don't follow your logic here (or it is imprecisely written, 
> >>or I'm not reading it correctly): if this only applies to the
> >>ESS based cards, how does that account for 60 % of OS/2 users ?
> >>I doubt that many are using ESS.  At the moment, I've got 4 
> >>soundcards here (trying to line up the best one for Warp), and 
> >>*none* of them are ESS-based.  If you're saying that FP-12 
> >>breaks *any* installed soundcard -- and this turned out to be
> >>true -- that would indeed be serious.  But, to date, I haven't 
> >>heard this assertion anywhere else.
> >>
> >><jf>

If I've told him once not to exaggerate, I've told him a million times.

> >And of the ESS cards it applies only to some if any.

> >I have a 1688 with a driver dated 23-OCT-98 and have no 
> >problems with FP 12.

> >ek

My ThinkPad has an ESS based Solo sound chip. It works just fine after FP
12.

> and this is a chipset which has been shipping for just over a year.  The
> bulk of their line is older than that and used in MANY notebooks...not
> to mention low cost generic sound cards.

My drivers were dated in March of this year. The ThinkPad 390E line is
less than a year old right now.



--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 9
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jspringf@pro-ns.net                               10-Oct-99 13:05:05
  To: All                                               10-Oct-99 14:35:09
Subj: Java 118 and NS 4.6 Encrypted

From: jspringf@pro-ns.net

All works fine here.

Thanks IBM.

-----------------------------------------------------------
Fred Springfield                       for e-mail remove 'xxx'
Plymouth, MN
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Professional Network Services (pro-ns.net) (1:109/42)

+----------------------------------------------------------------------------+

From: engs0011@sable.ox.ac.uk                           10-Oct-99 13:29:06
  To: All                                               10-Oct-99 14:35:09
Subj: PMmail under W4 & NT

From: engs0011@sable.ox.ac.uk (Ian Johnston)

I have just installed NT on my machine (as well as Warp 4) as I need to use
some NT software for a while. It would be nice to be able to read my mail
while booted to NT - does anyone know if it's possible to install PMmail/2
and PMMail98 to the same directory, so that by using the appropriate
executable
for each OS I can look at the same set of messages, use the same settings
and so on?

Ian

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Oxford University, England (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  10-Oct-99 14:25:00
  To: All                                               10-Oct-99 14:35:09
Subj: Re: FP12:  A Piece Of Cake!

From: l_luciano@da.mob (Stan Goodman)

On Sun, 10 Oct 1999 11:45:35, Bob Germer <bobg.REMOVEME.@pics.com> wrote:

------------------snip----------------

> If I've told him once not to exaggerate, I've told him a million times.

------------------snip----------------

=:-)8

That goes into my tagline file!

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      10-Oct-99 14:20:27
  To: All                                               10-Oct-99 14:35:09
Subj: Re: Junkbuster for OS/2?? was: Re: SmartCache

From: nospam@savebandwidth.invalid       (John Thompson)

In <jbeybpxsebagvreargarg.fjdbol0.pminews@news.frontiernet.net>, "RichS"
<worlock@frontiernet.net> writes:

>Junkbuster... for OS/2??? Please excuse my ignorance but where would one find
>this version? It's certainly something I would love to be running here!

ftp://hobbes.nmsu.edu/pub/os2/apps/internet/www/util/ijb201os2.zip

-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: tim.timmins@bcs.org.uk                            10-Oct-99 16:53:06
  To: All                                               10-Oct-99 14:35:09
Subj: Re: PMmail under W4 & NT

From: Tim Timmins <tim.timmins@bcs.org.uk>

Don't know about PMmail, but Netscape works correctly across multiple
operating
systems.

Ian Johnston wrote:

> I have just installed NT on my machine (as well as Warp 4) as I need to use
> some NT software for a while. It would be nice to be able to read my mail
> while booted to NT - does anyone know if it's possible to install PMmail/2
> and PMMail98 to the same directory, so that by using the appropriate
executable
> for each OS I can look at the same set of messages, use the same settings
> and so on?
>
> Ian

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          10-Oct-99 15:48:12
  To: All                                               10-Oct-99 14:35:09
Subj: Re: Junkbuster for OS/2??  was: Re: SmartCache

From: piquant00@uswestmail.net (Annie K.)

On Sun, 10 Oct 1999 03:43:33, "RichS" <worlock@frontiernet.net> wrote:

:Junkbuster... for OS/2??? 

 http://hobbes.nmsu.edu/pub/os2/apps/internet/www/util/ijb201os2.zip

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: rsteiner@visi.com                                 10-Oct-99 10:38:27
  To: All                                               10-Oct-99 16:28:09
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: rsteiner@visi.com (Richard Steiner)

Here in comp.os.os2.apps, Siobhan Perricone <morgannalefey@my-deja.com>
spake unto us, saying:

>Here are the words I understood from the above paragraph:
>
>"If you're new to maintaining OS/2 systems...lkj;afo weina;kdjf
>laljskdfj"
>
>You lost me, really.  I'm starting to feel like OS/2 is similar to
>Amiga, in that you need to know a hell of a lot about how the system
>operates in order to keep it stable and get things to run.

Yes, that tends to follow when one is using a relatively complex piece
of software (in this case OS/2).  BTW, it's just as true of the modern
flavors of Microsoft Windows -- it's just that most Microsoft types are
too busy trying to ignore or deny that fact instead of dealing with it
effectively (and proactively).

It'll take a little time to learn some of the concepts and terms used
around here, but the end result will be worth it (IMhO).

>What pisses me off about this is I AM NOT AN IDIOT.  I have been a
>computer hobbyist and technical support person for years.  I STARTED
>on a VIC20, moved to a Commodore 64 and until four years ago I was
>operating only Amiga 3000s at my house.  I ran a BBS on an Amiga for
>crying out loud.  I'M NO NEWBIE.

Yes, you are (apparently), at least in an OS/2 context.  :-)

Nothing wrong with that at all, but the Amiga really has very little to
do with the workings of IBM's OS/2 operating system.  You'll need to get
used to the fact that most technical details simply won't be the same.

For every new operating system or platform that one becomes involved
with, one has to become a newbie again.

As one possible example, my OS/2 knowledge has very little to do with
my BeOS knowledge or my Linux knowledge.  Those systems are all complex
operating systems, and each has some basic elements in common with the
others, but the specifics of those systems are ALL different.  At times
they can be *VERY* different.  Yet all of those are running on the same
hardware, and you're apparently moving between hardware platforms.

>I just spent the morning researching utilities that help me terminate
>applications that are hung up.  I dl'd a bunch of things from hobbes
>and installed them to see what they did only to find that many of them
>need me to give a PID in order to "kill a process" (I know what the
>means, but, honestly...).  Further research revealed that I could find
>the PID by using PSTAT.  So now I'm trying to figure out how the hell
>to read whatever it is that PSTAT gives me.

I think it'd be a lot easier to use something like WatchCat:

  ftp://hobbes.nmsu.edu/pub/os2/util/system/wcat21.zip

I use Stardock's Process Commander here (the direct [but commercial]
decendant of WatchCat) as well as a little freeware utility called GO:

  ftp://hobbes.nmsu.edu/pub/os2/util/process/go_15.zip

The concept of a PID (process ID) is pretty basic to many OSes, mainly
Unix flavors, and it's just a unique number assigned to each discrete
task in the system.

>I *know* that these tools are all very powerful and useful in a lot of
>ways, but the learning curve on this stuff is *incredibly* frustrating.

I don't mean to joke at your expense (please don't take this the wrong
way), but wait until you start playing with something like Linux.  ;-)

Many of us have been playing with OS/2 for several years (or longer),
and we can help you learn about things, but it'll take patience on your
part as well as on ours.  The concepts aren't difficult, but the fact
remains that OS/2 will have some things (both technical features and
common problems) which your past experience with other platforms will
probably not have prepared you for.  You'll need to get used to it.

If you have questions, please don't hesitate to ask.  Most of us read
these newsgroups to find chances to help folks solve their problems
(if we can), and we're more than willing to help if given a chance.

Feel free to e-mail me as well if you have questions.

-- 
   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
                              Lemon curry?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: kimwaicSpamGoToGarbage@deltanet.com               10-Oct-99 10:42:14
  To: All                                               10-Oct-99 16:28:09
Subj: Re: Control systems applications

From: "Kim Cheung" <kimwaicSpamGoToGarbage@deltanet.com>

On Sun, 10 Oct 1999 00:33:07 +0300, Papaparaskevas Paris wrote:

>Hello OS/2 community,
>I am looking for SCADA (supervisory control and data acquisition)
>applications for OS/2.
>Does anyone have a clue?
>I am currently using such applications under WinNT and paying the price.
>
>Thanks in advance.
>

Send a note to the author of House/2 for some tip.   (Not suggesting House/2
is for that but the author is very knowledgeble in this area).


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TouchVoice Corporation (1:109/42)

+----------------------------------------------------------------------------+

From: rsstan@ibm.net                                    10-Oct-99 13:55:15
  To: All                                               10-Oct-99 16:28:09
Subj: Re: PMmail under W4 & NT

From: "Bob Stan" <rsstan@ibm.net>

On 10 Oct 1999 13:29:12 GMT, Ian Johnston wrote:

>I have just installed NT on my machine (as well as Warp 4) as I need to use
>some NT software for a while. It would be nice to be able to read my mail
>while booted to NT - does anyone know if it's possible to install PMmail/2
>and PMMail98 to the same directory, so that by using the appropriate
executable
>for each OS I can look at the same set of messages, use the same settings
>and so on?
>
Yes it is possible.  The account file is the same in both systems, so as long
as you have it on a partition read by both os's it should work.  You will
probably have to reenter the authorization code for the program if you change
the location of the working directory.  I use this setup with Win98 and OS2


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: li_9_thop@plantlife73.com.na                      10-Oct-99 17:49:28
  To: All                                               10-Oct-99 16:28:09
Subj: Pronews - Error 501 from host

From: li_9_thop@plantlife73.com.na (Jim Backus)

When I post messages to Demon I get an Error 501 message - presumably 
this is part of the RFC message set - stating that there is a 
malformed or missing local part.

Any ideas what could cause this?  The news client is Pronews/2 version
1.50 beta 1.

Jim Backus  OS/2 user because it's better
bona fide replies to jimb(at)jita(dot)demon(dot)co(dot)uk

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Fourmyle (1:109/42)

+----------------------------------------------------------------------------+

From: scalisi@tin.it                                    10-Oct-99 17:54:11
  To: All                                               10-Oct-99 16:28:09
Subj: Re: Fp12 and default fonts

From: scalisi@tin.it

In <z3F1sghqDj8g-pn2-nckEQ6fdRZhI@cnq57-73.cablevision.qc.ca>, on 10/06/99
   at 05:55 PM, racette@cablevision.qc.ca (Martin Racette) said:

>Hi guys,

>I installed FP12 yesterday (Tuesday), 
>and since then the default fonts for the
>message and dialog box are all bigger 
>than they were before, is it a bug with 
>this FP?

>BTW. My video card is a Matrox Mullenium
>G200, with the 2.31.100 drivers, and I 
>had no problem of this kind before

Look at readme.1st of fixpack12 and replace DSPRES.DLL as sugested. --
-----------------------------------------------------------
Antonio(Nino) Scalisi           scalisi@tin.it
at 17:54(+0200, relative to GMT) on Sunday, 10 Oct 1999
Using MR/2 ICE v1.66  Reg: #20729.
Under ---> OS/2 WARP 4 rev.9.036 (fixpack 12)
Java ver.  1.1.8  build 19990910
ObjREXX 6.00   TCPIP 4.2 - MPTN 6.2007 (TCPIP 4.1 + W08620)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TIN (1:109/42)

+----------------------------------------------------------------------------+

From: bvermo@powertech.no                               10-Oct-99 19:20:27
  To: All                                               10-Oct-99 16:28:09
Subj: Re: FP12: A Piece Of Cake!

From: =?iso-8859-1?Q?Bj=F8rn?= Vermo <bvermo@powertech.no>

yyyc186.illegaltospam@ibm.net wrote:

>
> I did get FP12 to seemingly function with the SB-16 card in my workstation
> at home, but that is the only box FP-12 seems to function on.  Everything
> else is a serious kludge of work arounds and do withouts.
>

What kind of problem on two different computers was it you tried to fix by
applying the FP?

This may be a reminder to many that you are not supposed to install fixpacks
unless there is something you need fixed which is noted as fixed on the
APAR-list
of the fixpack.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Norbionics (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  10-Oct-99 14:01:09
  To: All                                               10-Oct-99 19:56:29
Subj: Re: Java install failure

From: mchasson@ibm.net

>>>>snipped all<<<

Well I have the correct version of FI properly installed because syslevel
confirms.  I can start to install javainru.exe and javainsr.exe because
they were both loaded into a subdirectory under the Feature Install
directory.  Well and good...

I open a window and type install.  After a little rummaging Netscape 4.6
opens and then the whirling globe appears with the arrow.  After coffee,
the choice of methods screen appears and I click on guided install...and
then the features screen appears and all the features known to man appear; 
all checked and not able to be unchecked and if I continue, the drive
selection appears on the wrong drive and refuses to change...

At this point I close Netscape and quit ... again.  

So how much of the previous java stuff in the OS2\INSTALL\  directory do I
have to remove???

It is surprising that the developers did not realize that almost all the
machines would have prior installations, which by the way are not
removeable as "installed features" since I guess they were installed by
prior Netscapes and not by Warp.  

I am waiting for Henk Kelder's material to appear for downloading. -- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: pit@iohk.SPAM-NOT.com                             11-Oct-99 02:35:00
  To: All                                               10-Oct-99 19:56:29
Subj: Re: NS461: Drag 'n Drop/To and Fro

From: pit@iohk.SPAM-NOT.com (taiQ)

On Fri, 1 Oct 1999 18:01:18, "Jeffrey S. Kobal" 
<jkobal@NOSPAMus.ibm.com> thought aloud:

> 
> "Thomas A. Heller" wrote:
> 
[shave]
> > Shouldn't that read "You can drag any link or image
> > to the desktop -- and _then_ from the desktop to any
> > folder"?
> 
> No, it shouldn't.  You can drag any link or image
> to any folder.

Unless the folder is set in Details mode, unfortunately.

> >  And similarly, you can only drag to the
> > desktop --but not to a folder-- the little icon to
> > the left of the location/netsite text field box.
> > That's the behavior I encounter.
> 
> Then it's broken on your machine, for some
> reason.  Make sure NS46DRAG.DLL exists in
> your Netscape\Program directory, and that it
> has a 9/16 date.

Seems it's broken.

> > I appreciate the future commitment re: Ctrl-drag for
> > the page (which would simply add another --or
> > restore a previous-- way of capturing web pages),
> > but I personally would attach greater utility to
> > efforts to enable dragging directly into folders.
> 
> Already done.  Hopefully, you'll be able to
> sort out why it isn't working on your machine.

I'm also looking forward to seeing ctrl-drag re-enabled for dragging 
html pages directly into folders, incl. folders in Details mode.


Brgds,
-- 
 taiQ

		[this space is intentionally blank]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Urban Primates Unlimited (1:109/42)

+----------------------------------------------------------------------------+

From: as@sci.fi                                         10-Oct-99 09:53:10
  To: All                                               10-Oct-99 19:56:29
Subj: Re: Junkbuster for OS/2??  was: Re: SmartCache

From: Anssi Saari <as@sci.fi>

"RichS" <worlock@frontiernet.net> writes:

> Junkbuster... for OS/2??? Please excuse my ignorance but where would one
find
> this version?

Hobbes, of course. As I recall, there at least used to be a link in
the Junkbuster homepage too?

-- 
Anssi Saari - as@sci.fi

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tampere University of Technology (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            10-Oct-99 21:16:19
  To: All                                               10-Oct-99 19:56:29
Subj: Re: FP12:  A Piece Of Cake!

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Sun, 10 Oct 1999 01:44:59 -0400, yyyc186.illegaltospam@ibm.net wrote:

>In <rfxbxnhccvaravozarg.fjbgc40.pminews@news3.ibm.net>, on 10/08/99 
>   at 11:28 PM, "Esko Kauppinen" <esko.kauppinen@ibm.net> said:
>
>>On Thu, 07 Oct 1999 23:03:00 -0400, J. R. Fox wrote:
>
>>>yyyc186.illegaltospam@ibm.net wrote:
>>>> 
>>>> In <7tc5ub$e8i$1@panix2.panix.com>, on 10/05/99
>>>>    at 02:30 AM, rcpj@panix.com (Pierre Jelenc) said:
>>>> 
>>>> IBM kissed off over 60% of the OS/2 user base with FP 12.  You can't get
>>>> your soundcard back and they have no intention of fixing it.  Unless you
>>>> can read the chip numbers and find the manufacturer you are screwed.
>>>> Actually, you are still screwed.  ESS has moved on to greater sound chips
>>>> and hasn't updated the OS/2 driver for the 1869 since 1997.  They have no
>>>> plans to.  They have moved onto chips with higher margins and greater
>>>> capabilities.
>>>> 
>>>> Give IBM a big round of applause for finally killing OS/2.
>>>> 
>>>> Roland
>>>> 
>>>
>>>I don't follow your logic here (or it is imprecisely written, 
>>>or I'm not reading it correctly): if this only applies to the
>>>ESS based cards, how does that account for 60 % of OS/2 users ?
>>>I doubt that many are using ESS.  At the moment, I've got 4 
>>>soundcards here (trying to line up the best one for Warp), and 
>>>*none* of them are ESS-based.  If you're saying that FP-12 
>>>breaks *any* installed soundcard -- and this turned out to be
>>>true -- that would indeed be serious.  But, to date, I haven't 
>>>heard this assertion anywhere else.
>>>
>>><jf>
>
>>And of the ESS cards it applies only to some if any.
>
>>I have a 1688 with a driver dated 23-OCT-98 and have no 
>>problems with FP 12.
>
>>ek
>
>
>and this is a chipset which has been shipping for just over a year.  The
>bulk of their line is older than that and used in MANY notebooks...not to
>mention low cost generic sound cards.
>
>Roland

The 1688? My laptop is at least 3 years old and has it.

Esko


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Thomas.Billert@rz.uni-jena.de                     10-Oct-99 19:16:26
  To: All                                               10-Oct-99 19:56:29
Subj: Smack! and Seiko Smart Label Printer

From: Thomas.Billert@rz.uni-jena.de (Thomas Billert)

Hi all,

I need to buy a labelling solution for my company. It must be capable
to print graphics as well as text on labels of about 10-15 mm width and
25-35 mm length. Since I'm a registered user of Smack! I thought of
buying a Seiko Smart Label Printer (SLP), which is supported by IBM's
Omni printer driver and by Smack!. So I looked around in the catalogues
of several hardware suppliers, but the model names of the SLPs there do
not match the models on IBM's device driver pak. IBM only speaks about
a SLP Plus and SLP Pro, but I found SLP EZ30, SLP 100, 120, 200 and SLP
220 in the hardware catalogues, and no Plus or Pro models. Which of
these will work under OS/2 together with Smack!? Does anyone here have
experiences with these devices under OS/2? How is the printing quality
on these SLPs with Smack! and IBM's Omni driver?

Thanks for all your help,

best regards, Billy.
-- 
Thomas Billert using OS/2 Warp 4   *   Thomas.Billert@rz.uni-jena.de
http://www.uni-jena.de/~c5thbi     *   Thomas.Billert@t-online.de
                                   *   PGP public keys available on my
OS/2-Usergroup Jena und Umgebung:  *               website
http://www.uni-jena.de/~c5thbi/os2jena.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     10-Oct-99 20:15:05
  To: All                                               10-Oct-99 19:57:00
Subj: Re: Fp12 and default fonts

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Sat, 9 Oct 1999 21:48:31, jvarela@mind-spring.com (John Varela) 
wrote:

> Me too.  The PMMail internal editor font was changed.  I changed it 
> back with the font palette but that didn't stick.  The settings page 
> showed the same font (System VIO 12) that I have been using but I just
> now for this message re-entered it; we'll see if it sticks this time. 
> The tabs in Lotus Organizer have lost everything but their initials.  
> That is, "Calendar" displays as just a "C", "Addresses" as just "A" 
> and so forth.  No idea how to go about trying to correct that.
>  
> --
> John Varela
> to e-mail, remove - between mind and spring
>  

The only places that I have seen (so far) that got changed were in the
IBM Clobal Network dialer (now AT&T Global network), and the editor in
Pronews/2. I didn't have any problems changing either one (drag and 
drop from the font pallet for the dialer, and changed the settings in 
Pronews/2). PMMail, and Organizer were unaffected (in my case).

There is a font setting in Organizer-> Section-> Customize (it only 
allows changing font size). Perhaps that will help.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            10-Oct-99 22:23:03
  To: All                                               10-Oct-99 19:57:00
Subj: Re: trouble with DeScribe and PS printer driver

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Fri, 08 Oct 1999 22:28:57 +0100 (CET), Menno Tillema wrote:

>On Thu, 07 Oct 1999 20:34:41 GMT, Jack Roberts wrote:
>
>>i've been trying to get DeScribe to work with the PostScript printer
>>driver so i can try out some of the PDF creation programs that i've seen
>> lately.  unfortunately, when i have the PS printer set up, DeScribe
>>freezes my computer when i start it.  i thought that maybe it was a
>
>I use it with the PDF Port driver which was announced in Warpcast a few day's
>ago (can't remember the URL though).  Works like a charm and is really too
>simple.

Too simple..hmm ?  I tried to use this pdfwrite.pdr but no luck.

- I installed a postscript driver ( Apple laser one ).  OK
- installed the pdfwrite.pdr as a new port. It reports that all 
   selected ports were successfully installed but it does not show 
   anywhere. Have tried MANY times but always the same.

- How do you select the printer object to use the new port?
   How do you change the settings of the port?
   Should it be visible with all the other port icons?

- Do you have to select "print to file"?

I have GhostScript 5.50, GSView, EMX installed.

Esko.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jan.eri@protector-group.no                        10-Oct-99 21:13:16
  To: All                                               10-Oct-99 19:57:00
Subj: Database for webpage?

From: jan.eri@protector-group.no (Jan Eri)

I have a dBase database that I would like to present on a web page.

It would be possible to present it as just a giant table, but not very elegant
of course.

Does anyone know an OS/2 friendly application I can use to do this without to 
much work?

regards,
Jan

----------------------------------
Jan Eri -- Protector AS -- Norway
Work: http://www.protector-group.no
Priv: http://home.eunet.no/~jeri/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Protector AS (1:109/42)

+----------------------------------------------------------------------------+

From: cbrace@lim.nl                                     10-Oct-99 23:23:05
  To: All                                               10-Oct-99 19:57:00
Subj: Re: SmartCache "adbuster" config. How?

From: Colin Brace <cbrace@lim.nl>

hello all,

I've got the following daisy-chained:

  Netscape -> smartcache -> Junkbuster -> remote ISP proxy 

and this setup works fine. The only problem I sometimes have is with
SmartCache's (v0.40) site blocking, what the author calls Adbuster. I
can't figure out how it works. For example, the site
  
  http://www.motherjones.com/mustreads/

gets blocked ("403 Forbidden by rule"), because motherjones does some
fancy redirection in its URL. The URL that actually gets blocked by
SmartCache is:

 
http://ads.premiumnetwork.com/RealMedia/ads/adstream_jx.ads/www.motherjones.com
/@Top

On the scache.cnf file, the author states 

 "NOTE: Adbusters support was removed, so ignore it or see sources for
more info."

so why is it blocking the above site?

Since Junkbuster works fine, I'd actually prefer just to totally disable
SmartCache site block and just use if for caching. Anyone know how to do
this?


-- 
  Colin Brace 
  Amsterdam
  http://www.lim.nl


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A2000 Kabeltelevisie en Telecommunicatie (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                10-Oct-99 21:34:24
  To: All                                               10-Oct-99 19:57:00
Subj: Re: Control systems applications

From: baden@unixg.ubc.ca    (Baden Kudrenecky)

In <37FFB493.790B7368@hotmail.com>, Papaparaskevas Paris <applicon@otenet.gr>
writes:
>Hello OS/2 community,
>I am looking for SCADA (supervisory control and data acquisition)
>applications for OS/2.
>Does anyone have a clue?
>I am currently using such applications under WinNT and paying the price.
>
>Thanks in advance.

   A few years ago, ISA "Intech" had a whole review of SCADA
applications, which included a few OS/2 ones.  Also, I did an
advanced search in English on Altavista for "SCADA NEAR OS/2",
and came up with 43 hits:

http://www.altavista.digital.com/cgi-bin/query?pg=aq&text=yes&kl=en&r=&search=S
earch&q=SCADA+NEAR+OS%2F2&d0=&d1=

baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: cfellows@execpc.com                               10-Oct-99 17:15:10
  To: All                                               10-Oct-99 21:15:25
Subj: Beta vs GA

From: Cliff Fellows <cfellows@execpc.com>

I have 4.61 Beta installed and working rather well. Is there a benefit
to installing the GA?
Warp4, FP-11, AMD 233 w/32M-o-ram..
Thanks!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ExecPC Internet - Milwaukee, WI (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                10-Oct-99 19:14:02
  To: All                                               10-Oct-99 21:15:25
Subj: Re: Beta vs GA

From: lifedata@xxvol.com

Cliff Fellows <cfellows@execpc.com> said:

>I have 4.61 Beta installed and working rather well. Is there a benefit to
>installing the GA?
>Warp4, FP-11, AMD 233 w/32M-o-ram..

Several bugs have been removed.  Many have found the GA to be somewhat
superior
to the GA.  Better than the 4.04 GA was over the 4.04 betas.

Warp 4, FP12.

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: cbrace@lim.nl                                     11-Oct-99 01:17:15
  To: All                                               10-Oct-99 21:15:25
Subj: PM PDF 

From: Colin Brace <cbrace@lim.nl>

You have to be sure to click on the new output port icon (it will have a
PDF icon) on the output port page of the properties notebook of the new
PDF printer, and enter valid paths:

 GhostScript path:

 Output path:

Note: do NOT use trailing backslashes, otherwise your printjob will pass
through the print queue but vanish into thin air...

You do not have to select "print to file".

A very big THANKS to Bart for writing this very useful program.


In <rfxbxnhccvaravozarg.fjf2mi2.pminews@news3.ibm.net>, on 10/10/99 
   at 10:23 PM, "Esko Kauppinen" <esko.kauppinen@ibm.net> said:

> Too simple..hmm ?  I tried to use this pdfwrite.pdr but no luck.

> - I installed a postscript driver ( Apple laser one ).  OK
> - installed the pdfwrite.pdr as a new port. It reports that all 
>    selected ports were successfully installed but it does not show 
>    anywhere. Have tried MANY times but always the same.

> - How do you select the printer object to use the new port?
>    How do you change the settings of the port?
>    Should it be visible with all the other port icons?

> - Do you have to select "print to file"?


-- 
  Colin Brace 
  Amsterdam
  http://www.lim.nl


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A2000 Kabeltelevisie en Telecommunicatie (1:109/42)

+----------------------------------------------------------------------------+

From: Cityboy@Spam-No-More.Net                          10-Oct-99 16:25:13
  To: All                                               10-Oct-99 21:15:25
Subj: Re: Word6 CBT trick <- afterthought

From: Cityboy@Spam-No-More.Net

Afterthought.... you only need to do the vmdisk thing for the Word
installation. After that everything will run in a regular winos/2
session.

--
-----------------------------------------------------------
cityboy@concentric.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Concentric Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: dcurren@ibm.net                                   10-Oct-99 17:12:20
  To: All                                               10-Oct-99 21:15:25
Subj: Re: cdwriter support

From: "Dale Curren" <dcurren@ibm.net>

On Sat, 09 Oct 1999 15:23:24 -0400 (EDT), dinkmeister wrote:
>:But it costs nearly 200 dollars!!!
>
>Try CDRecord/2, its free & I wouldn't use anything else =)
>Heres the url:
>http://www.geocities.com/SiliconValley/Sector/5785/cdrecord/cdrecordmain.
htm
>
>Theres a nice gui front end for it at hobbes, do a search for "cdwrit"

That is what I'm using. And it does everything that rsj can do.  Now if rsj
can 
ever match what the adaptec software can do on the win platform (like 
appending to a fixed cd), I'll be very tempted to buy it.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: steeltoe@kickass.com                              11-Oct-99 00:07:23
  To: All                                               10-Oct-99 21:15:25
Subj: Re: FP12:  A Piece Of Cake!

From: steeltoe@kickass.com

On Sat, 9 Oct 1999 22:49:15, mike.luther@ziplog.com wrote:

> In <7tns70$gb$1@news.panix.com>, rcpj@panix.com (Pierre Jelenc) writes:
> >Trevor Hemsley <Trevor-Hemsley@dial.pipex.com> writes:
> 
> >I had FP11 before my ill-fated attempt at 12 and I did not see any problem
> >then, but maybe I was lucky? I am now at FP6, so perhaps I should not
> >tempt fate? There was something I needed from one of the later FPs but I
> >don't remember what it was.
> 
>   A Y2K morsel, perhaps?  AFAIKR, some of the secondary fixes were
>   beyond FP6 ..
> 
> --> Sleep well; OS2's still awake! ;)
> 
> Mike.Luther@ziplog.com
> Mike.Luther@f3000.n117.z1.fidonet.org
> 

Back in June I changed bios date to 12/31/99 and fp6 operated fine for
a week or
two until I changed back to 'real time'.  That was my idea of a Y2K 
test for Warp.
Did I miss something? Is fp6 not ready for Y2K??

Vacuo

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Robert.Nowell@USA.Net                             11-Oct-99 00:26:20
  To: All                                               11-Oct-99 03:59:11
Subj: Graphics file viewers

From: Robert.Nowell@USA.Net (Robert Nowell)

Hello,

I've picked up a few image files on the web which I haven't been able
to look at (edit/crop) outside of Netscape Navigator (v2.02 for OS2
Warp3).  Whenever I open the files with PMJPEG or PMVIEW, I get an
error  message about an unrecognized SOF marker TYPE 0xc2.  

The images (JPG) usually chew up a lot of system time while loading in
Navigator (slow response from the keyboard and a lot of disk activity)
and behave like a GIF -- that is, progressively show finer resolution.

Are these files deliberately encoded to prevent distribution or is
there some other program along the lines (inexpensive) of the two
cited above that will allow me to edit/crop the files.

Thanks

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Spartan System (1:109/42)

+----------------------------------------------------------------------------+

From: rwinte7@attglobal.net                             11-Oct-99 01:12:21
  To: All                                               11-Oct-99 03:59:11
Subj: window sizeing

From: rwinte7@attglobal.net

I have had to resize word pro, and psp windows, but when I do I loose the
scroll bar on the right side, Any ideas to solve this.  I have a 17" monitor
8mges video ram, so I don't thinks its my system
thanks.
Rexx1@netzero.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: madodel@ptdprolog.net                             11-Oct-99 01:39:27
  To: All                                               11-Oct-99 03:59:11
Subj: Re: Beta vs GA

From: madodel@ptdprolog.net (Mark Dodel)

On Sun, 10 Oct 1999 21:15:21, Cliff Fellows <cfellows@execpc.com> 
wrote:

-)I have 4.61 Beta installed and working rather well. Is there a benefit
-)to installing the GA?
-)Warp4, FP-11, AMD 233 w/32M-o-ram..
-)Thanks!
-)

Yes the GA finally restores the OS/2 DragNDrop support, and fixes a 
bunch of bugs.  it is much more stable then any version since the last
2.02.  

Mark

//---------------------------------------------------------
// From the Desk of: Mark Dodel, RN, BSN, MBA
//             Healthcare Computer Consultant
//                   madodel@ptdprolog.net
//    http://home.ptd.net/~madodel
//
//  For a VOICE in the future of OS/2
//             http://www.os2voice.org/index.html
//---------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PenTeleData http://www.ptd.net (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  10-Oct-99 22:09:14
  To: All                                               11-Oct-99 03:59:11
Subj: Re: FP12:  A Piece Of Cake!

From: mchasson@ibm.net

In <7tr9oj$9pl$0@198.69.29.144>, on 10/11/99 at 12:07 AM,
   steeltoe@kickass.com said:

>On Sat, 9 Oct 1999 22:49:15, mike.luther@ziplog.com wrote:

>> In <7tns70$gb$1@news.panix.com>, rcpj@panix.com (Pierre Jelenc) writes:
>> >Trevor Hemsley <Trevor-Hemsley@dial.pipex.com> writes:
>> 
>> >I had FP11 before my ill-fated attempt at 12 and I did not see any problem
>> >then, but maybe I was lucky? I am now at FP6, so perhaps I should not
>> >tempt fate? There was something I needed from one of the later FPs but I
>> >don't remember what it was.
>> 
>>   A Y2K morsel, perhaps?  AFAIKR, some of the secondary fixes were
>>   beyond FP6 ..
>> 
>> --> Sleep well; OS2's still awake! ;)
>> 
>> Mike.Luther@ziplog.com
>> Mike.Luther@f3000.n117.z1.fidonet.org
>> 

>Back in June I changed bios date to 12/31/99 and fp6 operated fine for a
>week or
>two until I changed back to 'real time'.  That was my idea of a Y2K  test
>for Warp.
>Did I miss something? Is fp6 not ready for Y2K??

>Vacuo

No

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     11-Oct-99 04:15:16
  To: All                                               11-Oct-99 03:59:11
Subj: Re: Beta vs GA

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

Cliff Fellows wrote:

> I have 4.61 Beta installed and working rather well. Is there a benefit
> to installing the GA?

(1) Several bug fixes
(2) Having a level of code that would be supported

It is NEVER a good idea to continue running beta-level
code once you can get the GA release.

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     11-Oct-99 04:12:25
  To: All                                               11-Oct-99 03:59:11
Subj: Re: NS461: Drag 'n Drop/To and Fro

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

taiQ wrote:

> > No, it shouldn't.  You can drag any link or image
> > to any folder.
>
> Unless the folder is set in Details mode, unfortunately.

Already been fixed for a future fixpack.

> > Then it's broken on your machine, for some
> > reason.  Make sure NS46DRAG.DLL exists in
> > your Netscape\Program directory, and that it
> > has a 9/16 date.
>
> Seems it's broken.

Here's something you can try: When you boot up
your machine, do not run Communicator.... open a
command prompt and go to the directory where
you installed Communicator (\NETSCAPE\PROGRAM)
and try to rename the NS46DRAG.DLL file to any
other name.  If it allows it, then rename it back; if
it DOESN'T allow it, then your problem may be that
the Workplace Shell is loading that DLL incorrectly.
To fix this, you need to delete the NS46Drag object
and class that was created on your machine by the
Beta level of the product.  I believe another post on
this thread (or in comp.os.os2.bugs or .beta) had a
REXX CMD that would do this; if you can't find it or
work it out for yourself, let me know and I'll repost
the REXX source.

> I'm also looking forward to seeing ctrl-drag re-enabled for dragging
> html pages directly into folders, incl. folders in Details mode.

I'm not sure what the schedule will be for shipping a
fixpack, but those issues have already been resolved
for whenever a fixpack does go out.

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dana@randomc.com                                  11-Oct-99 02:46:24
  To: All                                               11-Oct-99 10:31:03
Subj: Re: Warpstock '99 Atlanta, GA USA

From: dana <dana@randomc.com>

we use os2 all the time, and unix also.





***** **************************************************
"Contrary to popular belief, Unix is user friendly. It's 
just very particular about who it makes friends with."

On 6 Oct 1999 tholenAntiSpam@ifa.hawaii.edu wrote:

> Date: 6 Oct 1999 02:57:53 GMT
> From: tholenAntiSpam@ifa.hawaii.edu
> Newsgroups: atl.forsale, comp.os.os2.advocacy, comp.os.os2.apps,
>     comp.os.os2.beta, comp.os.os2.bugs
> Subject: Re: Warpstock '99 Atlanta, GA USA
> 
> Sam Brown writes:
> 
> > shit wake up nobody uses os/2 any more??
> 
> Why are you using question marks at the end of a declarative sentence?
> 
> By the way, somebody does use OS/2.  Looks like the readers here are
> not the ones who need to wake up.
> 
> 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Comstar Communications (comstar.net) (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@nospam.net                               10-Oct-99 21:56:24
  To: All                                               11-Oct-99 10:31:03
Subj: Re: cdwriter support

From: letoured@nospam.net

In <qpheeravozarg.fjeo940.pminews@news-s01.ny.us.ibm.net>, on 10/10/99 
   at 05:12 PM, "Dale Curren" <dcurren@ibm.net> said:
>>Theres a nice gui front end for it at hobbes, do a search for "cdwrit"

>That is what I'm using. And it does everything that rsj can do.  Now if
>rsj can  ever match what the adaptec software can do on the win platform
>(like  appending to a fixed cd), I'll be very tempted to buy it.

If you write protected; Format x: /Unseal  will do it.

And you have to waste an hour formating a CD before using it either.


_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: ilya@math.ohio-state.edu                          11-Oct-99 03:12:14
  To: All                                               11-Oct-99 10:31:03
Subj: Re: I have the Photo>Graphics key --- Now what?

From: ilya@math.ohio-state.edu (Ilya Zakharevich)

[A complimentary Cc of this posting was sent to Christian Hennecke 
<christian.hennecke@ruhr-uni-bochum.de>],
who wrote in article <37F0CABF.F2463C05@ruhr-uni-bochum.de>:
> > When the program loads, it comes up with a list of tutorial files that I
> > might load, but it is not possible to load them, because the files are not
> > present; the Tutorial subdirectory is empty, which is a surprise. 
> 
> The download package is not the full package that was delivered on CD
> when you ordered PGPro but a special version for demo CDs. Providing the
> tutorial would increase the packages size a LOT.

"A lot" is how much?  What is your position on sharing the tutorial?
I mean what if somebody with a CD puts tutorials for public access?

How useful are tutorials?  I looked into info file, and its table of
contents is only 8.5 screenfuls long.  Not that much for a complicated
package.  3/4 ;-)

Ilya

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Department of Mathematics, The Ohio State Univers
(1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           10-Oct-99 23:48:22
  To: All                                               11-Oct-99 10:31:03
Subj: Re: Junkbuster for OS/2??  was: Re: SmartCache

From: "RichS" <worlock@frontiernet.net>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

Thanks to all those that replied... It's being downloaded and will hopefully
be setup ASAP...

Rich...


On 10 Oct 1999 15:48:25 GMT, Annie K. wrote:

>On Sun, 10 Oct 1999 03:43:33, "RichS" <worlock@frontiernet.net> wrote:
>
>:Junkbuster... for OS/2??? 
>
> http://hobbes.nmsu.edu/pub/os2/apps/internet/www/util/ijb201os2.zip
>
>-- 
>Klaatu barada nikto

******************************************************************************
Practice Random Acts of Kindness and Senseless...Umm...Uhh....
Oh - Heck...I never could remember all that "nice" stuff.
-
-----------------------------{worlock@frontiernet/net}-------------------------
-------
******************************************************************************



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: noconv

wj8DBQE4AVA1JUo5KMjfuWMRAl4QAJ4mfDvYsnHA9PYx0zAbXYoFX/AnmwCgn2aW
G3w9NdxOr9Rq2LXt23pGyJ0=
=0p3f
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@nospam.net                               11-Oct-99 02:51:18
  To: All                                               11-Oct-99 10:31:03
Subj: Re: cdwriter support

From: letoured@nospam.net

In <380143e1$1$yrgbherq$mr2ice@news.sover.net>, on 10/10/99 
   at 09:56 PM, letoured@nospam.net said:
>>That is what I'm using. And it does everything that rsj can do.  Now if
>>rsj can  ever match what the adaptec software can do on the win platform
>>(like  appending to a fixed cd), I'll be very tempted to buy it.

That should have been:

>If you mean write protected; Format x: /Unseal  will do it.

>And you don't have to waste an hour formating a CD before using it either
(with RSJ under OS2)


>_____________
>Ed Letourneau <letoured@sover.net>

_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: rIiHqArToEll@tShPeA-wMord.net                     11-Oct-99 04:40:22
  To: All                                               11-Oct-99 10:31:03
Subj: Lost DOS support after mobo upgrade...help!

From: rIiHqArToEll@tShPeA-wMord.net (Zephyr Q)

	Just upgraded my mobo and processor (from a 486 to a PI-166
on a VIA chipset) and I lost my ability to run DOS apps.  
I've tried to restore from backups, and have played with 
re-installing elements from the maintanence desktop...but I 
still can't get DOS to run (during boot-up, I get an error 
to this effect).

	I am also dealing with other minor annoyances, such as 
losing my ability to use Xit (I lost the ability to use my 
middle mouse button) and not being able to get any mouse 
settings to recognize it.

	Now, in all honesty, I did upgrade to a mobo that had a 
PS/2 port for my mouse; but no matter how I reinstall my 
mouse (as a PS/2 or other), it won't read my middle button.

	Anyway to get DOS running again (so I can play my silly 
little games) and my middle mouse button working W/O having 
to reinstall from scratch??

	Thank you.






~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~  Finding his place in   ~
~   Cosmos,               ~
~  Directed only by Him   ~
~   who created the       ~
~    Kosmos               ~ 
~               Zephyr Q  ~
~~~~~~~~~~~~~~~~~~~~~~~~~~~
Please remove "I HATE SPAM" to
 reply to e-mail address.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: uliw@erdw.ethz.ch                                 11-Oct-99 12:25:26
  To: All                                               11-Oct-99 10:31:03
Subj: Re: FP12 unknown failure -11 ??????

From: Uli Wortmann <uliw@erdw.ethz.ch>

James Stotz <jstotz@canoemail.com> writes:

> 
> I got that too, so I had to use SimplyFix to do it.  I got that with the
> last fixpak, fp11.  Other people had trouble on that one, no?

what is SimplyFix???

BTW, turning off verbose doesn't help

	uli

-- 
	Uli Wortmann           Fax (Switzerland) (1) 632  1080
	Dept. of Geology       Fon                        3694
	ETH-Zuerich    http://www.erdw.ethz.ch/~bonk/bonk.html
	Visit the SPOC-team at http://www.spoc.ethz.ch

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Dept. of Geology, ETH-Zuerich (1:109/42)

+----------------------------------------------------------------------------+

From: david@ameissnet.com                               11-Oct-99 05:02:10
  To: All                                               11-Oct-99 10:31:03
Subj: Re: DECTalk - Pathworks

From: david@ameissnet.com (David Ameiss)

I could use it. Contact me via email.

On Sat, 9 Oct 1999 19:27:54, hamei@pacbell.net wrote:

> Anyone have a need for an OS/2 client for a DECTalk network ? 
> Grabbed this at a computer sale, Pathworks for OS/2 v5, if someone
> could actually *use* it that'd be better than sitting on my shelf
> looking pretty. Afraid of the consequences if it doesn't leave here  - 
> nothing like having an excuse to install a VAX 750 in the laundry room.
> 
> --
> Hrad ngravvrd
> 
> 

---------------------------------------------
David Ameiss (david@ameissnet.com)
---------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    11-Oct-99 05:09:07
  To: All                                               11-Oct-99 10:31:03
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

dinkmeister <dink@dont.spam.me> writes:
> 
> Try CDRecord/2, its free & I wouldn't use anything else =)
> Heres the url:
> http://www.geocities.com/SiliconValley/Sector/5785/cdrecord/cdrecordmain.htm

This is less than obvious! 

CDWriter, using pre-existing WAV files as a test, gives the the following
error:

Cdrecord release 1.8a24 Copyright (C) 1995-1999 Jrg Schilling
TOC Type: 0 = CD-DA
scsidev: '3'
devname: '3'
scsibus: -2 target: -2 lun: -2
D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe: No such file or directory.
Cannot open SCSI driver.

Audio-CD-Creator, for its part, has no drive letters in the "Drive letter"
drop-down list, and refuses whatever I write in the box, while in Data-
CD-Creator the "Source drive" is grayed out.

Not a very encouraging beginning with the medium.

(The CDRW is a Yamaha 6416 internal, and it works perfectly to read data
and music.)

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: pandpATattglobal.net                              11-Oct-99 09:43:29
  To: All                                               11-Oct-99 10:31:03
Subj: Trap E when installing DB2 UDB PDE

From: "Philip Nelson" <pandpATattglobal.net>

I'm experiencing a Trap E when installing DB2 UDB PDE on one of my machines.

The distinguishing symptom seems to be that the installation is not taking
place to the C drive, but to another drive which is a logical partition on a
3.8 Gbyte hard disk.  I can do the install to C quite happily - however this
leaves me extremely short of space below to 1000 cylinder mark, which causes
a problem with booting OS/2.

Has anyone experienced a similar problem.

TIA

Phil Nelson
(teamdba@ibm.net)

Senior DBA
Scottish Widows


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            11-Oct-99 07:44:11
  To: All                                               11-Oct-99 10:31:03
Subj: Re: PM PDF 

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Mon, 11 Oct 1999 01:17:30 +0200, Colin Brace wrote:

>You have to be sure to click on the new output port icon (it will have a
>PDF icon) on the output port page of the properties notebook of the new
>PDF printer, and enter valid paths:
>
> GhostScript path:
>
> Output path:
>
>Note: do NOT use trailing backslashes, otherwise your printjob will pass
>through the print queue but vanish into thin air...
>
>You do not have to select "print to file".
>
>A very big THANKS to Bart for writing this very useful program.

	All right, thanks. So it seems that I have a problem with the
	installation of the port as it does not appear in the printer
	properties notebook. During installation I see the icon
	( if it is the Acrobat icon) and it seems to install ok but
	then it "vanishes into thin air" :-)

Esko


>In <rfxbxnhccvaravozarg.fjf2mi2.pminews@news3.ibm.net>, on 10/10/99 
>   at 10:23 PM, "Esko Kauppinen" <esko.kauppinen@ibm.net> said:
>
>> Too simple..hmm ?  I tried to use this pdfwrite.pdr but no luck.
>
>> - I installed a postscript driver ( Apple laser one ).  OK
>> - installed the pdfwrite.pdr as a new port. It reports that all 
>>    selected ports were successfully installed but it does not show 
>>    anywhere. Have tried MANY times but always the same.
>
>> - How do you select the printer object to use the new port?
>>    How do you change the settings of the port?
>>    Should it be visible with all the other port icons?
>
>> - Do you have to select "print to file"?
>
>
>-- 
>  Colin Brace 
>  Amsterdam
>  http://www.lim.nl
>
>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   11-Oct-99 03:08:22
  To: All                                               11-Oct-99 10:31:03
Subj: Re: Graphics file viewers

From: Kris Kadela <kris@dgraph.com>

There are 2 types of JPEG images, standard and progressive encoding. I
bet those are progressive jpegs. Newer viewers deal with them just fine.

Robert Nowell wrote:
> 
> Hello,
> 
> I've picked up a few image files on the web which I haven't been able
> to look at (edit/crop) outside of Netscape Navigator (v2.02 for OS2
> Warp3).  Whenever I open the files with PMJPEG or PMVIEW, I get an
> error  message about an unrecognized SOF marker TYPE 0xc2.
> 
> The images (JPG) usually chew up a lot of system time while loading in
> Navigator (slow response from the keyboard and a lot of disk activity)
> and behave like a GIF -- that is, progressively show finer resolution.
> 
> Are these files deliberately encoded to prevent distribution or is
> there some other program along the lines (inexpensive) of the two
> cited above that will allow me to edit/crop the files.
> 
> Thanks

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          11-Oct-99 10:54:19
  To: All                                               11-Oct-99 10:31:03
Subj: Re: Pronews - Error 501 from host

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Sun, 10 Oct 1999 17:49:56, li_9_thop@plantlife73.com.na (Jim Backus) a 
crit dans un message:

> When I post messages to Demon I get an Error 501 message - presumably 
> this is part of the RFC message set - stating that there is a 
> malformed or missing local part.
> 
> Any ideas what could cause this?  The news client is Pronews/2 version
> 1.50 beta 1.

This isn't meant as a technically-enlightened response, but when I've had 
that error message, my ISP's news server was using some very stupid filters
on file length, quoted vs. new material, etc. One of the reasons I've 
switched ISPs fairly often, actually.

The best way to test this would be to subscribe to some stuff on an 
additional server.

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          11-Oct-99 11:11:09
  To: All                                               11-Oct-99 10:31:03
Subj: Re: Describe: A Blast from the Past

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Fri, 8 Oct 1999 10:00:44, News@The-Net-4U.com (M.P. van Dobben de 
Bruijn) a crit dans un message:
snipt
> 
> Ho, wait. AmiPro was really a good alternative (at that time). The
> rest of your post really makes it clear: Describe is by far the best
> wordprocessor. We should be ashamed it is not sold anymore.

No, I'd say *we* did all we could, and I for one bought multiple copies.

The problem was idiosyncratic company management. One of their 
idiosyncracies was they wanted to make a lot of money, but without doing 
intelligent and heavy marketing.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: raphaelt@netnews.worldnet.att.net                 11-Oct-99 07:57:05
  To: All                                               11-Oct-99 10:31:03
Subj: Re: FP12 repairs the DUX Dictionary!

From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum)

raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum) wrote:

>But I just re-downloaded the patches, and I may take another
>whack at it.  This time even if it doesn't work, I'll leave
>it on, and then try out FP12 (once I get the new HD from
>IBM).

Alas, I installed FP12 but DUX is still busted.  I will say,
the POPUPLOG dump seems to have changed in the interim, from 
 
10-09-1999  10:20:54  SYS3175  PID 0042  TID 0001  Slot 0095
N:\DUXSHELF\DUX.EXE
c0000005
00021f00
P1=00000002  P2=007851e8  P3=XXXXXXXX  P4=XXXXXXXX  
EAX=007851d8  EBX=00004e30  ECX=00780300  EDX=00004e30
ESI=00630000  EDI=00000000  
DS=0053  DSACC=d0f3  DSLIM=1fffffff  
ES=0053  ESACC=d0f3  ESLIM=1fffffff  
FS=150b  FSACC=00f3  FSLIM=00000030
GS=099b  GSACC=10f3  GSLIM=00003fff
CS:EIP=005b:00021f00  CSACC=d0df  CSLIM=1fffffff
STEW:ESPECIALLY=0053:00049318  SSACC=d0f3  SSLIM=1fffffff
EBP=00049358  FLG=00012206
 
DUX.EXE 0001:00011f0
 
to 
 
10-10-1999  19:58:38  SYS3175  PID 0033  TID 0001  Slot 0077
N:\DUXSHELF\DUX.EXE
c0000005
00021162
P1=00000001  P2=00000000  P3=XXXXXXXX  P4=XXXXXXXX  
EAX=00610000  EBX=041081fc  ECX=00000000  EDX=00000e80
ESI=00610000  EDI=003c003c  
DS=0053  DSACC=d0f3  DSLIM=1fffffff  
ES=0053  ESACC=d0f3  ESLIM=1fffffff  
FS=150b  FSACC=00f3  FSLIM=00000030
GS=0973  GSACC=10f3  GSLIM=00003fff
CS:EIP=005b:00021162  CSACC=d0df  CSLIM=1fffffff
STEW:ESPECIALLY=0053:00048658  SSACC=d0f3  SSLIM=1fffffff
EBP=00048660  FLG=00012202
 
DUX.EXE 0001:00011162
 
Still works fine on all my Warp3 partitions, not much
consolation.


-- 
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          11-Oct-99 11:56:22
  To: All                                               11-Oct-99 14:43:19
Subj: Re: Describe: A Blast from the Past

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Fri, 8 Oct 1999 03:25:51, jdc0014@InfoNET.st-johns.nf.ca (John Hong) a 
crit dans un message:

> 
>                  DESCRIBE: A BLAST FROM THE PAST
> 

A nicely done review, all in all. Good to refresh everybody's memory with 
new enthusiasm from time to time.

Two minor corrections/adjustments. You say:

snipt
> 	In importing graphics into the documents, it does have good
> modern graphic support.  It can support JPEG's, but not GIF's

It will import just about anything in a graphic format (bitmap or vector) 
you can display in any other program. Open your GIF in, say, PMVIEW, and 
just copy it to clipboard, then paste it in a DeScribe image frame.

Tip: As with any bitmap format, make sure your image frame is sized the way
you want it before importing, 'cause if you stretch the bitmap after it's 
in place you'll get the jaggles. Or paste one in, stretch it all you want 
to get the right layout, then paste another copy right on top of it, which 
should come in at the right size.


snip

> No, it won't do HTML

Not out of the box, but there's an extensive and nifty package of DeScribe 
Macros written by Mike Sosteric that will provide basic HTML (v.0.9) 
functions on your menubar. I don't see it at Hobbes right now, but I'll dig
out the archive and upload it when I get a moment. Anybody who needs it in 
the meantime can write me.

There's also an exporter that I haven't used beyond a single test some time
ago, but it appears to work okay to allow you to create documents then 
output them in headlined and organized HTML formatting.

	ftp://hobbes.nmsu.edu/pub/os2/apps/wp/dsc2html.zip


[By the way, I've found a website that uses a very nice package of 
JavaScript1.2 and CSS to generate good viewable HTML3.2 text as well as 
perfect printing out of any browser (that supports CSS), and I'm probably 
shifting my attitude to use this approach myself. I believe the Sosteric 
macros can provide a basis for managing this style of composition within 
DeScribe, or I'll say at least "I hope" because I'm going to be spending 
some time trying to get it working. Take a look at this IBM site with 
NS4.61 to see what I mean: 
	http://www.ibmlink.ibm.com/usalets&parms=H_299-276 ]


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: cm@warphouse.de                                   11-Oct-99 11:24:08
  To: All                                               11-Oct-99 14:43:19
Subj: Re: Staroffice5.1 Starbase not included?

From: Carsten Mueller <cm@warphouse.de>

John, Peter,

> >just tried to create an new document of type database.
> >The "Type" listbox lists DBase, DB2, JDBC, text, but not Starbase.
> >This is different in the WindowsVersion of StarOffice.
> >Is there really no Starbase included?
>
> I was wondering the same thing.  But with a little poking around I
> discovered File -> New -> Database -- which allows you to create
> databases -- so Starbase must be in there somewhere, even though there
> is no icon for new databases on the StarOffice desktop.  It appears
> that native Starbase format is simply dBase, although you are also
> given the option of DB2, JDBC, ODBC, and Text.

StarOffice 5.1 for OS/2 *does* include the database module "StarOffice 
Base" (formerly known as "StarBase").

But you're right, there's no StarBase entry in the "Type" listbox. 
This is because of the fact, that the database file format "StarBase" 
only exists in the Windows version of StarOffice.

This means: Under OS/2, Linux and Solaris you can use StarOffice Base, 
but only with databases in dBase, DB2, text formats or via JDBC/ODBC, 
but *not* in the StarOffice for Windows own StarBase format. This 
StarBase format is quiet similiar to dBase, but also features some 
enhancements, like binary fields. This StarBase format is only 
existing in the Windows version of StarOffice, because it's licensed 
from a 3rd party.

Hope this helps.

Kind regards,

Carsten Mueller




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Star Division GmbH, Hamburg, Germany (1:109/42)

+----------------------------------------------------------------------------+

From: dljone9@ibm.net                                   11-Oct-99 05:33:07
  To: All                                               11-Oct-99 14:43:19
Subj: Re: 1999 tax preparation software for OS/2???

From: Daniel Jones <dljone9@ibm.net>

Last year I ran Kiplinger's Tax Cut in a Win-OS/2 session, and it
worked just fine. I just got a mailing from them, and it appears
that they will offer a Win 3.1 version again this year...



"Alfred H. Cole, Jr." wrote:
> 
> Does anyone know of any 1999 tax preparation software that would run
> under OS/2.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            11-Oct-99 14:55:29
  To: All                                               11-Oct-99 14:43:19
Subj: Re: Describe: A Blast from the Past

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Mon, 11 Oct 1999 11:11:18 GMT, Buddy Donnelly wrote:

>On Fri, 8 Oct 1999 10:00:44, News@The-Net-4U.com (M.P. van Dobben de 
>Bruijn) a  crit dans un message:
>snipt
>> 
>> Ho, wait. AmiPro was really a good alternative (at that time). The
>> rest of your post really makes it clear: Describe is by far the best
>> wordprocessor. We should be ashamed it is not sold anymore.
>
>No, I'd say *we* did all we could, and I for one bought multiple copies.
>
>The problem was idiosyncratic company management. One of their 
>idiosyncracies was they wanted to make a lot of money, but without doing 
>intelligent and heavy marketing.

Is it only me but my first impression of Describe was negative when I saw it.
The icons looked  "home made" and it was just after using it for some time
that I realized how good it was.

Like so many OS/2 program, it would have needed a brush up by somebody
with eye to graphical layout.

Esko


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                11-Oct-99 09:39:19
  To: All                                               11-Oct-99 14:43:19
Subj: Re: Junkbuster for OS/2??  was: Re: SmartCache

From: lifedata@xxvol.com

Note that in some situations it can be more trouble dealing with popup
junkbuster screens than with the stuff you want to be rid of.

>Thanks to all those that replied... It's being downloaded and will hopefully
be
>setup ASAP...

>>:Junkbuster... for OS/2??? 
>>
>> http://hobbes.nmsu.edu/pub/os2/apps/internet/www/util/ijb201os2.zip
>>

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: Robert.Nowell@USA.Net                             11-Oct-99 14:02:25
  To: All                                               11-Oct-99 14:43:19
Subj: Re: Graphics file viewers

From: Robert.Nowell@USA.Net (Robert Nowell)

On Mon, 11 Oct 1999 03:08:44 -0600, Kris Kadela <kris@dgraph.com>
wrote:

>There are 2 types of JPEG images, standard and progressive encoding. I
>bet those are progressive jpegs. Newer viewers deal with them just fine.
>

< snip >

That's what I figured.  Any OS2 recommendations?

Robert.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Spartan System (1:109/42)

+----------------------------------------------------------------------------+

From: afjbell@onlink.net                                11-Oct-99 10:23:29
  To: All                                               11-Oct-99 14:43:20
Subj: Mesa/2 and layers

From: "Alex Bell" <afjbell@onlink.net>

I have developed several spreadsheets to help our Assertive Community
Treatment Team  track our patients and the effectiveness of our work,
and would like to consolidate them into one large spreadsheet with many
pages or layers.  

One of the current spreadsheets (an 'overall' spreadsheet) contains some data
about all patients, including date of birth and their admission and
discharge dates for their last admission.  There are other individual
spreadsheets, one to each patient, which contain amongst other things
the patient's date of birth and the admission and discharge dates for
each of that patient's admissions.  The consolidated spreadsheet I am
trying to design would have the 'overall' spreadsheet as its first
layer, with other layers one for each patient.  The individual patient
layers would read the date of birth from the first layer, and the first
layer would read the last admission and discharge dates from the
individual layers.

The first question is :What is the difference between a page and a
layer?  Is a page a layer which is used for scripts?  or is there some
other difference?  Or are these terms synonyms?

Secondly, can one order layers?  If a patient called Smith is the first
individual patient I enter and a patient called Bloggs is the second
can I get the spreadsheet to put the Bloggs layer before the Smith
layer?  Or can I conjure up a layer for Bloggs between the first
'overall' layer and the layer for Smith?  I would like to have template
layers set up so I can use one for each new patient we can take on, and
then put the layers in alphabetical order.

Similarly, if I change the order of the rows on the first 'overall'
layer will the references to and from the individual layers be
retained?  

Regards, Alex









--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ontario Northland--ONLink (1:109/42)

+----------------------------------------------------------------------------+

From: afjbell@onlink.net                                11-Oct-99 10:31:26
  To: All                                               11-Oct-99 14:43:20
Subj: DBExpert and Dates

From: "Alex Bell" <afjbell@onlink.net>

I am trying to design a database to help me keep track of the patients of our
Assertive Community Treatment Team, and help me to measure the effectiveness
of our work.  One of the things I want to do is to track all previous
admissions and discharges, and to calculate the time spent in hospital and
the time out of hospital - ie between admissions.  For reasons I need not go
into it is necessary to enter the dates in yyyy/mm/dd format.

So, how can I get DBExpert to accept dates in yyyy/mm/dd format, and treat
them as dates?

How can I get DBExpert to do date arithmetic?  There is mention in the manual
of a dbeDateToNumber function which converts a date to a Julian number, but I
am afraid that I cannot work out how to use it.

Regards, Alex


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ontario Northland--ONLink (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          11-Oct-99 14:52:13
  To: All                                               11-Oct-99 14:43:20
Subj: Re: Describe: A Blast from the Past

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 11 Oct 1999 11:55:59, "Esko Kauppinen" <esko.kauppinen@ibm.net> a 
crit dans un message:

snp
> 
> Is it only me but my first impression of Describe was negative when I saw
it.
> The icons looked  "home made" and it was just after using it for some time
> that I realized how good it was.
> 
You're correct about the issue, but in this case there are far worse 
transgressors than DeScribe. DeScribe offers you the power to control 
customization of the Toolbar icons, even to the extent of replacing all the
built-ins with your own. Use the Tool Manager for that.



> Like so many OS/2 program, it would have needed a brush up by somebody
> with eye to graphical layout.

You're especially right if you go back and talk about SPG's "ColorWorks". I
could never understand how a company who was trying to pitch itself to 
working commercial artists was using such klutzy artwork in its own stuff. 
(And strangely enough when I mentioned it, trying to be helpful of course, 
to the head of the company he became quite offended. He liked his 
"Terminator" poster.)


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: rjf@yyycomasia.com                                11-Oct-99 15:37:08
  To: All                                               11-Oct-99 14:43:20
Subj: Re: cdwriter support

From: rjf@yyycomasia.com (rj friedman)

On Sat, 9 Oct 1999 23:01:27, letoured@nospam.net wrote:

>But it costs nearly 200 dollars!!!


And its worth every penny!

You said it! After you install it, it works exactly like a 
`regular' drive. Completely WPS integrated - it was made 
with OS/2 in mind.. You can drag and drop to it; delete; 
etc. Plus, you can also use it to make music CDs. It is one 
piece of software that I am extremely happy to have bought.


________________________________________________________

[RJ]                 OS/2 - Live it, or live with it. 
rj friedman          Team ABW              
Taipei, Taiwan       rjf@yyycomasia.com 

To send email - remove the `yyy'
________________________________________________________

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SEEDNet News Service (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@nospam.com                                 11-Oct-99 08:26:07
  To: hkelder@capgemini.nl                              11-Oct-99 17:05:23
Subj: Re: Java install failure

To: hkelder@capgemini.nl
From: John Mandeville <nospam@nospam.com>

Thanks for the help below.  I now have Java successfully installed.  My
FI.INI file seemed sufficiently screwed up that I renamed it (also
FI.BAK and FISETUP.LOG but *not* FIBASE.RSP).  Note that the URL's for
your files were wrong.  Because I recognized your name, I was able to
guess the correct URL's.  They are

http://www.os2ss.com/information/kelder/readfi.exe
http://www.os2ss.com/information/kelder/WPTOOLS.NEW

readfi.exe kept crashing on me.  From your description, together with
the WPTOOLS documentation from your standard distribution archive, I
could take a pretty good guess as to what it does an experimented with a
REXX script.  It appears that readfi.exe crashed for unresolvable
ObjectHandles, i.e., those for which my REXX script's call to
WPToolsQueryObject return 0.  It would appear that you need to check
return values for NULLs.

Thanks again for your help

John Mandeville
jemandy at earthlink dot net

Henk kelder wrote:
> 
> Just found the cause of the problems and solved it (at least for myself)
> 
> The problem is in x:\OS2\INSTALL\FI.INI (where x is your boot drive)
> 
> This file appearantly keeps a list of all installed features.
> Per installed feature it keeps the WPS internal objecthandle of the
> directory where the feature installer has stored it's install
> information (note: not the installed feature, but just the info about
> it).
> 
> On my PC two entries pointed to incorrect directories. I manually
> changed the entries to the correct values and bingo: JAVA 1.1.8 suddenly
> installs without a problem.
> 
> To scan FI.INI for which locations it contains please download:
> 
> http://www.os2ss.com/information/readfi.exe
> http://www.os2ss.com/information/WPTOOLS.NEW
> 
> and place this in \OS2\INSTALL
> 
> And rename WPTOOLS.NEW on your machine to WPTOOLS.DLL. (Note: this is a
> newer version as in WPTOOLxx.ZIP and is NOT compatible with the one in
> that archive. So make sure you keep the one from the archive)
> 
> The run READFI. This will read all entries in FI.INI and show to what
> paths it points.
> 
> They should all be in \OS2\INSTALL or a subdirectory from it.
> 
> Henk
> 
> Henk kelder wrote:
> >
> > John,
> >
> > Don't know the cause, but I have exactly the same problem.
> >
> > Also, After this failed installation, my \OS2\BOOK directory suddenly is
> > called:
> > '7 OS/2 Java Internationalization - Inventory'
> >
> > Henk
> >
> > John Mandeville wrote:
> > >
> > > I've tried installing Java 1.1.8, but the installation fails after all
> > > the files are copied.  It tells be to check
> > > x:\os2\install\wpinstal.log.  After adding x:\Java11\rmi-iiope to the
> > > path, it gives the message "**NULLID"" :: Exception -1073741819 returned
> > > to instthrd.c 7301".  Not knowing what exception -1073741819 is, I'm
> > > don't know what to do next.  It got far enough that some of my Java apps
> > > run OK, but others do not.  Ideas?
> > >
> > > --
> > > John Mandeville
> >
> > > jemandy at earthlink dot net
> >
> > --
> > Remove nospam when replying..
> 
> --
> Remove nospam when replying..

--
John Mandeville
jemandy at earthlink dot net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: Tim Stephen@CIOS.ORG                              11-Oct-99 16:25:07
  To: All                                               11-Oct-99 17:05:23
Subj: hardward compatabilty list for WSeB??

From: Tim Stephen@CIOS.ORG (Tim Stephen)

    Does IBM supply a hardward compatability list showing systems that
are known to work with the SMP Warp Server for E Business?  I need to
buy a new box and would like to reduce the problem of screwing around
replacing components and scrounging for drivers.

Thanks!

Tim Stephen
CIOS

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Monmouth Internet (1:109/42)

+----------------------------------------------------------------------------+

From: as@sci.fi                                         11-Oct-99 07:05:09
  To: All                                               11-Oct-99 17:05:23
Subj: Re: SmartCache

From: Anssi Saari <as@sci.fi>

rmahoney@_REMOVE_THIS_netusa.net (Robert Mahoney) writes:

> On Sat, 9 Oct 1999 18:41:16, Anssi Saari <as@sci.fi> wrote:
> 
> > >   Plus Junkbuster replaces the annoying gifs with 1x1 transparent 
> > > images so you don't even see the ads.
> > 
> > Smartcache can do that too, no plus.
> 
>    Really?  How do you do that and what version was that added?  I 
> think I'm still running 0.37.

I don't know when it was added, but the scache.cnf for 0.40 has an
ErrorDocument directive which seems to that.

-- 
Anssi Saari - as@sci.fi

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tampere University of Technology (1:109/42)

+----------------------------------------------------------------------------+

From: andrie@attglobal.net                              10-Oct-99 19:33:13
  To: All                                               11-Oct-99 17:05:23
Subj: Re: cdwriter support

From: "Hans Andrieen" <andrie@attglobal.net>

letoured@nospam.net schrieb:
 
> 
> >But it costs nearly 200 dollars!!!
> 
> And its worth every penny!

It is!

Have a look to www.joshua-com.de
There is possible to participate on order-collection
and trial versions.

Bye/2
Hans

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jvarela@mind-spring.com                           11-Oct-99 20:13:22
  To: All                                               11-Oct-99 19:55:28
Subj: Re: Fp12 and default fonts

From: jvarela@mind-spring.com (John Varela)

On Sun, 10 Oct 1999 20:15:11, doug.bissett"at"attglobal.net (Doug 
Bissett) wrote:

> On Sat, 9 Oct 1999 21:48:31, jvarela@mind-spring.com (John Varela) 
> wrote:

> > The tabs in Lotus Organizer have lost everything but their initials.  
> > That is, "Calendar" displays as just a "C", "Addresses" as just "A" 
> > and so forth.  No idea how to go about trying to correct that.

> There is a font setting in Organizer-> Section-> Customize (it only 
> allows changing font size). Perhaps that will help.

Hmm.  Fooling with that brought back the writing on the tabs.  
However, the tabs only display correctly if I check the "Scale with 
window size" box.  But when I do that the text in the appointment 
entries is too big.  When I uncheck that box, the entries are all 
visible, but now the tabs are illegible.  It appears that perhaps the 
tabs are printed in all caps with spacing for lower case (when 
legible, they are in lower case).

--
John Varela
to e-mail, remove - between mind and spring

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    11-Oct-99 20:28:23
  To: All                                               11-Oct-99 19:55:28
Subj: Re: Junkbuster for OS/2??  was: Re: SmartCache

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

RichS (worlock@frontiernet.net) wrote:

: Thanks to all those that replied... It's being downloaded and will hopefully
: be setup ASAP...

	Anyone running Junkbuster, be sure to check out 
http://www.waldherr.org, the guy has compiled a really big blocklist for 
Junkbuster.  It's about 29,000+ bytes now, it has been updated as of Oct. 
7, 1999.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    11-Oct-99 20:30:02
  To: All                                               11-Oct-99 19:55:28
Subj: Squid?

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

	Anyone tried Squid yet?  I was just wondering how it performs 
against SmartCache since Squid is OS/2 native.  The latest release is on 
Hobbes.  It's a proxy for http in order to provide better web caching.  


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: ariek3.14159265358979323846@attg...               11-Oct-99 20:36:08
  To: All                                               11-Oct-99 19:55:28
Subj: CPUMETER: how to reach author?

Message sender: ariek3.14159265358979323846@attglobal.net

From: ariek3.14159265358979323846@attglobal.net (Arie Kazachin)

Hello!

Few days ago I attempted to register through BMT Micro a rather old
program CPUMETER (the one I downloaded is dated 1996). I know it's old
but other, newer CPU-measuring apps. don't suit me: they don't display
exactly what I want or they display many other things I don't want.
The CPUMETER wasn't on the "all programs" list at BMT Micro site
and an e-mail to them resulted in answer "we don't sell it" (although
the README.TXT suggests registering through BMT Micro).
An attempt to e-mail the author using the address from the README.TXT
resulted in "user unknown". Can anyone help me reaching the author,
Christof Pastors?

THANKS IN ADVANCE FOR ANY HELP ! ! !
******************************************************************************
*   Arie Kazachin, Israel, e-mail: ariek3.14159265358979323846@attglobal.net *
******************************************************************************
NOTE: before replying, leave only letters in my userID. Sorry, SPAM trap.
         ___ 
     .__/   |
     |    O /
    _/     / 
   |       | I HAVE NOWHERE ELSE TO GO !!!
   |       |
   |       |              |
   |       |             /O\
   |       _   \_______[|(.)|]_______/
   |    * / \    o   ++   O   ++   o
  |       | |
  |       |< 
  \       \_)
   \        |
    \       |
     \      |
      \     |
       \    |
        \   |
         \  |
          \_|

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Unspecified Organization (1:109/42)

+----------------------------------------------------------------------------+

From: jvarela@mind-spring.com                           11-Oct-99 20:36:03
  To: All                                               11-Oct-99 19:55:28
Subj: Re: Staroffice5.1 Starbase not included?

From: jvarela@mind-spring.com (John Varela)

On Fri, 8 Oct 1999 02:51:13, jbrock@panix.com (John Brock) wrote:

> I have to say that the StarOffice on-line documentation truly *SUX*!
> Am I missing something, or is there really no searchable help?!?

I'll agree with that and the only thing I've fooled with so far is the
Events calendar.  When entering an event, it can be given a 
classification -- Holiday, for example, or Job, or Personal.  I've 
figured out how to create new categories, but I have searched the Help
on every key I can think of and no way can I figure out how to DELETE 
or rename categories.

--
John Varela
to e-mail, remove - between mind and spring

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    11-Oct-99 21:39:18
  To: All                                               11-Oct-99 19:55:28
Subj: Re: Describe: A Blast from the Past

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Esko Kauppinen (esko.kauppinen@ibm.net) wrote:

: Is it only me but my first impression of Describe was negative when I saw
it.
: The icons looked  "home made" and it was just after using it for some time
: that I realized how good it was.

: Like so many OS/2 program, it would have needed a brush up by somebody
: with eye to graphical layout.

	I don't know, I don't really mind it at all.  I mean its just a 
button that serves a purpose, right?  I myself was never really into 
aesthetics of a computer program.  Even now I don't see why people here 
would be that into stuff like CandyBarz or Styler/2, sure it does buff up 
the look of OS/2 but you are also wasting a little bit of RAM, too.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    11-Oct-99 21:37:16
  To: All                                               11-Oct-99 19:55:28
Subj: Re: Describe: A Blast from the Past

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Buddy Donnelly (donnelly@tampabay.rr.com) wrote:

: The problem was idiosyncratic company management. One of their 
: idiosyncracies was they wanted to make a lot of money, but without doing 
: intelligent and heavy marketing.

	True.  With that PC Magazine review on it for example, the listed 
price was...$495.  While it was also the same pricetag for the Microsoft, 
WordPefect, and Lotus offerings, I don't think too many people at that time 
were willing to part with that kind of money on a relatively unknown company.
	What might have worked was agressive pricing like what Corel has 
been doing with their WordPerfect Suite lately in comparision with 
Microsoft Office.  A good example is in the academic pricing, my 
God...WordPerfect Suite 8 was going like $33 CDN whereas Microsoft Office 
97 academic was like a little over $120 CDN.  This is also why I'm 
surprised Lotus has not done the same with their SmartSuite given that 
they are in the same price area as Microsoft Office.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    11-Oct-99 21:32:24
  To: All                                               11-Oct-99 19:55:28
Subj: Re: Describe: A Blast from the Past

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

M.P. van Dobben de Bruijn (News@The-Net-4U.com) wrote:

: Ho, wait. AmiPro was really a good alternative (at that time). The

	AmiPro for Windows, yes.  That was a definate good one.  AmiPro 
for OS/2?  Er, could've used more work, even in spite of the patch Lotus 
released for it.

: rest of your post really makes it clear: Describe is by far the best
: wordprocessor. We should be ashamed it is not sold anymore. But
: it may show again: technical excellence does not warrant a commer-
: cial success. On the contrary, it may often be opposing qualities.

	What I am surprised at is why they haven't resurrected themselves 
as some other group or make it a shareware release.  A good example would 
be the former employee's of WordPerfect Corporation, they released a 
shareware word processor called "Yeah Write" for Windows 3.1 & Windows 95.

(http://www.wordplace.com)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    11-Oct-99 21:41:06
  To: All                                               11-Oct-99 21:17:00
Subj: Re: Describe: A Blast from the Past

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Buddy Donnelly (donnelly@tampabay.rr.com) wrote:

: It will import just about anything in a graphic format (bitmap or vector) 
: you can display in any other program. Open your GIF in, say, PMVIEW, and 
: just copy it to clipboard, then paste it in a DeScribe image frame.

	I know, I can't believe I forgot to put that in...

: Tip: As with any bitmap format, make sure your image frame is sized the way
: you want it before importing, 'cause if you stretch the bitmap after it's 
: in place you'll get the jaggles. Or paste one in, stretch it all you want 
: to get the right layout, then paste another copy right on top of it, which 
: should come in at the right size.

	Thanks for the tips.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               12-Oct-99 00:10:20
  To: All                                               11-Oct-99 21:17:00
Subj: Re: Graphics file viewers

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Robert Nowell schrieb:
> >There are 2 types of JPEG images, standard and progressive encoding. I
> >bet those are progressive jpegs. Newer viewers deal with them just fine.
> >
> 
> < snip >
> 
> That's what I figured.  Any OS2 recommendations?
> 
> Robert.

Try PMView 2.0! It will be released around Warpstock Atlanta dates.
BTW, I've never come across a JPEG file PMView couldn't read. Maybe
there is illegal information in there and Netscape just doesn't care
about that.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          11-Oct-99 22:13:04
  To: All                                               11-Oct-99 21:17:00
Subj: Re: Describe: A Blast from the Past

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 11 Oct 1999 21:32:48, jdc0014@InfoNET.st-johns.nf.ca (John Hong) a 
crit dans un message:

snip
> 
> 	What I am surprised at is why they haven't resurrected themselves 
> as some other group or make it a shareware release.  A good example would 
> be the former employee's of WordPerfect Corporation, they released a 
> shareware word processor called "Yeah Write" for Windows 3.1 & Windows 95.
> 
> (http://www.wordplace.com)

Interestingly enough, I see that this site also has a link to the online 
publication of "Almost Perfect", a book about the WordPerfect Corporation 
by the mastermind of their marketing. (They guy IBM should have hired to 
run the OS/2 Warp campaign, probably, given how things turned out.) I read 
part of this standing in a bookstore several years ago, and will enjoy 
being able to go through the whole thing.

	http://www.fitnesoft.com/AlmostPerfect/


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: drowelf@nospamvnet.net                            11-Oct-99 17:57:25
  To: All                                               11-Oct-99 21:17:00
Subj: Re: WinOs/2 Printing now has Blobs

From: "Eric A. Erickson" <drowelf@nospamvnet.net>

On Sat, 02 Oct 1999 14:59:13 +0100, Tony Wright wrote:

A load of crap, that I do not appreciate. 

BTW, smart xss I solved the problem. 
Elvish Software Foundry, Inc.    		- Internet:  drowelf@vnet.net
IBM Certified OS/2 Warp Engineer 	- IBMLink:   HONE81(ESFISA1)
IBM Certified OS2/ Warp Developer & Associate Visual Age C++ Developer
'Already where I want to be Today 	- Voice/Fax: (281)-398-2625 <-Newe'


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Elvish Software Foundry, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: bumby@lagrange.rutgers.edu                        11-Oct-99 18:50:09
  To: All                                               11-Oct-99 21:17:00
Subj: Re: Mesa/2 and layers

From: bumby@lagrange.rutgers.edu (Richard Bumby)

"Alex Bell" <afjbell@onlink.net> writes:

>...

>One of the current spreadsheets (an 'overall' spreadsheet) contains some data
>about all patients, including date of birth and their admission and
>discharge dates for their last admission....
>                      ....  The consolidated spreadsheet I am
>trying to design would have the 'overall' spreadsheet as its first
>layer, with other layers one for each patient.

>The first question is :What is the difference between a page and a
>layer?  Is a page a layer which is used for scripts?  or is there some
>other difference?  Or are these terms synonyms?

>Secondly, can one order layers?  ...

>Similarly, if I change the order of the rows on the first 'overall'
>layer will the references to and from the individual layers be
>retained?  

You can certainly add new layers for individual patients.  There may
be a limit.  Layers are still treated like additional sheets bound
into a workbook, rather than a true third dimension, so they are more
awkward to use.  References between pages also behave more like DDE
links than references within a single sheet.

Mesa2 separates scripts from worksheets; whichever type of page you
want, you ask for.  The scripts are always at the end of the workbook.

The only way I have been able to rearrange worksheets has been to copy
the old one to a new location.  This sounds painful for the
application you have in mind.

Before committing yourself to a definite way of using the workbook,
you should do experiments with toy data.  As long as you are referring
to a sheet by name, you should be able to move the reference around in
the index sheet without hurting the reference.  I think I have done
such things, but I usually check that references have not been broken
when I make major changes.  

It might be better to have the sheets appear in the order in which
they are created, but maintain an alphabetical index on the cover sheet.

-- 
R. T. Bumby **  Rutgers Math || Amer. Math. Monthly Problems Editor 1992--1996
bumby@math.rutgers.edu       ||   
Telephone:    [USA] 732-445-0277 (full-time message line) FAX 732-445-5530

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Rutgers University LCSR (1:109/42)

+----------------------------------------------------------------------------+

From: falbof@theref.aquascape.com                       11-Oct-99 23:35:16
  To: All                                               11-Oct-99 21:17:00
Subj: Re: Database for webpage?

From: F. Robert Falbo <falbof@theref.aquascape.com>

jan.eri@protector-group.no (Jan Eri) :

> I have a dBase database that I would like to present on a web page. 
>   
> It would be possible to present it as just a giant table, but not very 
> elegant 
> of course. 
>   
> Does anyone know an OS/2 friendly application I can use to do this without 
> too  much work? 

r:WEB was just the ticket, but r:base quit making it a few
years ago.  I wanted to do just that... use a webpage
as a front-end to an extensive database.  The problem
was that they had the w'95 version at $99, but the OS/2
version was around $500. (That's back when I ran my own
server on OS/2.)  You might be able to find someone that
wants to get rid of a copy cheap. 
                     -bob-
-- 
__________________________________________
F.R.Falbo   | TheRef(tm) Website
BeOS & OS/2 | http://theref.aquascape.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TheRef(tm) Website (1:109/42)

+----------------------------------------------------------------------------+

From: dink@dont.spam.me                                 11-Oct-99 19:26:13
  To: All                                               11-Oct-99 21:17:00
Subj: Re: cdwriter support

From: "dinkmeister" <dink@dont.spam.me>

On 11 Oct 1999 05:09:14 GMT, Pierre Jelenc wrote:

:dinkmeister <dink@dont.spam.me> writes:
:> 
:> Try CDRecord/2, its free & I wouldn't use anything else =)
:> Heres the url:
:>
http://www.geocities.com/SiliconValley/Sector/5785/cdrecord/cdrecordmain.htm
:
:This is less than obvious! 
:
:CDWriter, using pre-existing WAV files as a test, gives the the following
:error:
:
:Cdrecord release 1.8a24 Copyright (C) 1995-1999 Jrg Schilling
:TOC Type: 0 = CD-DA
:scsidev: '3'
:devname: '3'
:scsibus: -2 target: -2 lun: -2
:D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe: No such file or directory.
:Cannot open SCSI driver.

put cdrecord.exe/mkisofs.exe and readcd.exe in your path
and try again..


- dink ( http://dink.org )





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none (1:109/42)

+----------------------------------------------------------------------------+

From: rmahoney@_REMOVE_THIS_netusa.net                  12-Oct-99 00:02:25
  To: All                                               11-Oct-99 21:17:00
Subj: Re: SmartCache "adbuster" config. How?

From: rmahoney@_REMOVE_THIS_netusa.net (Robert Mahoney)

On Sun, 10 Oct 1999 21:23:11, Colin Brace <cbrace@lim.nl> wrote:

 
> Since Junkbuster works fine, I'd actually prefer just to totally disable
> SmartCache site block and just use if for caching. Anyone know how to do
> this?

  Just comment out all the FAIL parameters in the config file.

#Forbidden URLs

#past na generic reklamni URL
#Fail http://ads.*
#Fail http://ad.*
#Fail http://adserver.*
#Fail http://*adserver*.*
#Fail http://nsads.*
#Fail */ads/*
#Fail */advs/*
#Fail */adverts/*

  Make sure the # is there and SmartCache will not doing any blocking.

Bob
--
Robert Mahoney
2Rud Software and Consulting
http://www.netusa.net/~rmahoney

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: 2Rud Software (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             11-Oct-99 17:32:22
  To: All                                               12-Oct-99 05:53:23
Subj: Re: Describe: A Blast from the Past

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On 11 Oct 1999 21:37:33 GMT, John Hong wrote:

>	What might have worked was agressive pricing like what Corel has 
>been doing with their WordPerfect Suite lately in comparision with 
>Microsoft Office.  A good example is in the academic pricing, my 
>God...WordPerfect Suite 8 was going like $33 CDN whereas Microsoft Office 
>97 academic was like a little over $120 CDN.  This is also why I'm 
>surprised Lotus has not done the same with their SmartSuite given that 
>they are in the same price area as Microsoft Office.

Oh, they were actually quite good at the "competitive pricing" game. I
bought Describe 3.5 for $189US in '92. They accepted an old DOS version
of M$ Works as the WP upgrade. I don't know about "educational" pricing
as I've not been attached to any educational institution since Johnson
was President. About six months after I bought it, they dropped the
price to $139US (just before the release of v.4.0, the first 32-bit
release) but by then the upgrade price was just $49US to current
owners. Then, in late '96, in the swiftest move Jim Linnane ever made,
they released v.5.0 with a special "quarterly update" time-bomb. If you
didn't apply the (free) update every 3 months, Describe would quit
working. That went over like a fart in the choir loft. So they then
released the non-time-bombed version then started the 'Voyager'
marketing scheme where Describe was sold through book stores bundled
with the Que manual. That might have worked out for them if M$ and IBM
hadn't already managed to get OS/2 books scrubbed from the bookstores.
Just imagine a cross-platform WP with the power of Describe, including
an excellent manual, selling for only $49US! No, _pricing_ wasn't the
downfall of Describe. _Marketing_ was.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: fjones@onlink.net                                 11-Oct-99 20:34:22
  To: All                                               12-Oct-99 05:53:23
Subj: Re: WinOs/2 Printing now has Blobs

From: "Frank Jones" <fjones@onlink.net>

In <qebjrysiargarg.fjgl0f1.pminews@news.swbell.net>, on 10/11/99 
   at 05:57 PM, "Eric A. Erickson" <drowelf@nospamvnet.net> said:

>On Sat, 02 Oct 1999 14:59:13 +0100, Tony Wright wrote:

>A load of crap, that I do not appreciate. 

><snip>

Which just proves that old saying: "Beauty is in the eye of the beholder"
!-)

I would have really appreciated a 'cartload' from Tony about my "System
Freeze" problem,  [now posted as: ||Q: PCI Video and INTA?||  in the
comp.os.os2.setup.video Newsgroup] - 'cause there is usually at least one
rose growing from the dung... eh hemh, artfully wicked prose..


Grace and peace to you,
Frank.
-- 
-----------------------------------------------------------
"Frank Jones" <fjones@onlink.net>
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ontario Northland--ONLink (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  11-Oct-99 21:08:08
  To: All                                               12-Oct-99 05:53:23
Subj: Re: Java install failure

From: mchasson@ibm.net

In <38020197.211078E6@nospam.com>, on 10/11/99 at 08:26 AM,
   John Mandeville <nospam@nospam.com> said:

>Thanks for the help below.  I now have Java successfully installed.  My
>FI.INI file seemed sufficiently screwed up that I renamed it (also FI.BAK
>and FISETUP.LOG but *not* FIBASE.RSP).  Note that the URL's for your
>files were wrong.  Because I recognized your name, I was able to guess
>the correct URL's.  They are

>http://www.os2ss.com/information/kelder/readfi.exe
>http://www.os2ss.com/information/kelder/WPTOOLS.NEW

I had previously posted to this thread and could not install or more
accurately I could not get past the select components page.

I hate to admit this, but renaming the main directory to "Features"  just
like the example, cleared everything up and Java 118 went in without
effort.  They need not have been quite so diffident in writing the readme. 
Doing the directory structure exactly as they illustrated it made all the
difference for me.

Now to get it working with NS...

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: rhb@accessv.com                                   12-Oct-99 01:22:22
  To: All                                               12-Oct-99 05:53:23
Subj: Re: Mesa/2 and layers

From: "Rob Burton" <rhb@accessv.com>

There's no difference between a "page" and a "layer". It's just sloppy
terminology. You Add or Insert a "Layer" and you Delete a "Page". Go on, try
it now with a dummy workbook. Put a label in Cell A1 of each of 3 sheets and
start Adding and Inserting and Deleting. See? The difference between "Add"
and "Insert" is that "Add" puts another "Page/Layer" at the end of the sheets
and "Insert" puts one before the current sheet.

You can't sort the pages. Cheer up, you can't sort them in Excel, either.
Alas, in Mesa, you can't move them, either, and at least Excel lets you do
that.

Mesa, as I think I said in my review of it, has all of the power and none of
the ease of use that we need. At least you can always insert your patient's
sheet in alphabetical order as you go.

On Mon, 11 Oct 1999 10:23:59 -0400 (EDT), Alex Bell wrote:

|I have developed several spreadsheets to help our Assertive Community
|Treatment Team  track our patients and the effectiveness of our work,
|and would like to consolidate them into one large spreadsheet with many
|pages or layers.  
|
|One of the current spreadsheets (an 'overall' spreadsheet) contains some data
|about all patients, including date of birth and their admission and
|discharge dates for their last admission.  There are other individual
|spreadsheets, one to each patient, which contain amongst other things
|the patient's date of birth and the admission and discharge dates for
|each of that patient's admissions.  The consolidated spreadsheet I am
|trying to design would have the 'overall' spreadsheet as its first
|layer, with other layers one for each patient.  The individual patient
|layers would read the date of birth from the first layer, and the first
|layer would read the last admission and discharge dates from the
|individual layers.
|
|The first question is :What is the difference between a page and a
|layer?  Is a page a layer which is used for scripts?  or is there some
|other difference?  Or are these terms synonyms?
|
|Secondly, can one order layers?  If a patient called Smith is the first
|individual patient I enter and a patient called Bloggs is the second
|can I get the spreadsheet to put the Bloggs layer before the Smith
|layer?  Or can I conjure up a layer for Bloggs between the first
|'overall' layer and the layer for Smith?  I would like to have template
|layers set up so I can use one for each new patient we can take on, and
|then put the layers in alphabetical order.
|
|Similarly, if I change the order of the rows on the first 'overall'
|layer will the references to and from the individual layers be
|retained?  
|
|Regards, Alex
|
|
|
|
|
|
|
|
|



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Robert.Nowell@USA.Net                             12-Oct-99 01:55:11
  To: All                                               12-Oct-99 05:53:23
Subj: Re: Graphics file viewers

From: Robert.Nowell@USA.Net (Robert Nowell)

On Tue, 12 Oct 1999 00:10:40 +0200, Christian Hennecke
<christian.hennecke@ruhr-uni-bochum.de> wrote:

>> >There are 2 types of JPEG images, standard and progressive encoding. I
>> >bet those are progressive jpegs. Newer viewers deal with them just fine.
>> 
>> < snip >
>> 
>> That's what I figured.  Any OS2 recommendations?
>> 
>
>Try PMView 2.0! It will be released around Warpstock Atlanta dates.
>BTW, I've never come across a JPEG file PMView couldn't read. Maybe
>there is illegal information in there and Netscape just doesn't care
>about that.
>

I'll look forward for PMView 2.0.  Thanks again,

Robert

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Spartan System (1:109/42)

+----------------------------------------------------------------------------+

From: gordon.nospam@gadsnet.com                         12-Oct-99 02:28:05
  To: All                                               12-Oct-99 05:53:24
Subj: Re: Beta vs GA

From: "Gordon A. Stripling" <gordon.nospam@gadsnet.com>

On Sun, 10 Oct 1999 19:14:05 -0400, lifedata@xxvol.com wrote:

> Many have found the GA to be somewhat superior
>to the GA. 

I presume you meant "GA to be somewhat superior to the BETA".


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: dstg0001@aol.com                                  12-Oct-99 04:37:24
  To: All                                               12-Oct-99 05:53:24
Subj: AOL under winos2

From: dstg0001@aol.com (Dstg0001)

Is there any version of the 16-bit AOL software that runs in Warp 4 under
WinOS2?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AOL http://www.aol.com (1:109/42)

+----------------------------------------------------------------------------+

From: eusebio@beamlab.ps.uci.edu                        11-Oct-99 22:57:24
  To: All                                               12-Oct-99 05:53:24
Subj: Font Size in Staroffice 5.1 Toolbars

From: Eusebio Garate <eusebio@beamlab.ps.uci.edu>

Hello,

I am having difficulty figuring out how to change the font size in the
toolbar (File Edit View Tools Window Help) in Staroffice 5.1. It doesn't
seem to be aware of the font palette, when I drag a new font to the
toolbar nothing happens. I have looked through the help files and usenet
but I haven't managed to find anything that helps me out.  Can anyone
help?

Thanks,

Eusebio


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of California, Irvine (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            12-Oct-99 08:14:21
  To: All                                               12-Oct-99 05:53:24
Subj: Re: Describe: A Blast from the Past

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On 11 Oct 1999 21:39:37 GMT, John Hong wrote:

>Esko Kauppinen (esko.kauppinen@ibm.net) wrote:
>
>: Is it only me but my first impression of Describe was negative when I saw
it.
>: The icons looked  "home made" and it was just after using it for some time
>: that I realized how good it was.
>
>: Like so many OS/2 program, it would have needed a brush up by somebody
>: with eye to graphical layout.
>
>	I don't know, I don't really mind it at all.  I mean its just a 
>button that serves a purpose, right?  I myself was never really into 
>aesthetics of a computer program.  Even now I don't see why people here 
>would be that into stuff like CandyBarz or Styler/2, sure it does buff up 
>the look of OS/2 but you are also wasting a little bit of RAM, too.

I see your point but to me it is important. It is much nicer to work with
a program which looks nice. You can see this with all the major office
suits. They have artists to make them look good and icons to be
informative.

Maybe we come here to the same questions why is it fun to drive in a
good looking car, wear stylish clothes etc. 

Needless to say that I have Candybar, Dialog Enhancer, OD2, X-folder
etc. installed :-)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            12-Oct-99 08:40:16
  To: All                                               12-Oct-99 05:53:24
Subj: Re: Describe: A Blast from the Past

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Mon, 11 Oct 1999 14:52:27 GMT, Buddy Donnelly wrote:

>On Mon, 11 Oct 1999 11:55:59, "Esko Kauppinen" <esko.kauppinen@ibm.net> a 
> crit dans un message:
>
>snp
>> 
>> Is it only me but my first impression of Describe was negative when I saw
it.
>> The icons looked  "home made" and it was just after using it for some time
>> that I realized how good it was.
>> 
>You're correct about the issue, but in this case there are far worse 
>transgressors than DeScribe. DeScribe offers you the power to control 
>customization of the Toolbar icons, even to the extent of replacing all the
>built-ins with your own. Use the Tool Manager for that.

Yeah, I know. I have used it but now I seem to have problems with the
colors. If I make a new icon it looks ok in Tool Manager but when it is
installed on tool bar the colors are inverted or changed.
I tried to save the icon with colors inverted but they are still wrong.

Looks like a display driver problem but the choices are few as I am
using a laptop. I remember that it has been working in my home 
computer.

I don't remember ever seeing replacement icons for Describe in any
web page. Given the amount of ordinary icons available one would
think that there are some for D also.

>> Like so many OS/2 program, it would have needed a brush up by somebody
>> with eye to graphical layout.
>
>You're especially right if you go back and talk about SPG's "ColorWorks". I
>could never understand how a company who was trying to pitch itself to 
>working commercial artists was using such klutzy artwork in its own stuff. 
>(And strangely enough when I mentioned it, trying to be helpful of course, 
>to the head of the company he became quite offended. He liked his 
>"Terminator" poster.)

Heh, I don't remember that one but but it is true that something that looks 
good in my eyes doesn't necessarily do the same in other people eyes.
( I had a Pontiac Transsport which I thought was cool but my friend
   said that it must be the ugliest car he has ever seen :-)

Esko  



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: billko@postoffice.worldnet.att.net                12-Oct-99 02:52:15
  To: All                                               12-Oct-99 05:53:24
Subj: Re: AOL under winos2

From: "Billy Ko" <billko@postoffice.worldnet.att.net>

On 12 Oct 1999 04:37:49 GMT, Dstg0001 wrote:

:>Is there any version of the 16-bit AOL software that runs in Warp 4 under
:>WinOS2?

Sure... all of them.  I forget what you have to do to AOL 4.0 to make it work
over your ISP, though...

Bill
Team OS/2

-----

OS/2 - If you want "productivity" to be more than a few
four-letter words.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: nospam_hkelder@capgemini.nl                       12-Oct-99 09:16:08
  To: All                                               12-Oct-99 05:53:24
Subj: Re: Java install failure

From: Henk kelder <nospam_hkelder@capgemini.nl>

John Mandeville wrote:
 
> Note that the URL's for
> your files were wrong.  Because I recognized your name, I was able to
> guess the correct URL's.  They are
> 
> http://www.os2ss.com/information/kelder/readfi.exe
> http://www.os2ss.com/information/kelder/WPTOOLS.NEW

Sorry about that. I thought I did it okay.

> readfi.exe kept crashing on me.  

That's what you get if you add some code before checking it.
I added an %s in the prinft that is used when the objecthandle could not
be translated without supplying an argument for it. I have already
modified it and uploaded it.

Anyhow, good to see your problems are solved.

Henk

John Mandeville wrote:
> 
> Thanks for the help below.  I now have Java successfully installed.  My
> FI.INI file seemed sufficiently screwed up that I renamed it (also
> FI.BAK and FISETUP.LOG but *not* FIBASE.RSP).  Note that the URL's for
> your files were wrong.  Because I recognized your name, I was able to
> guess the correct URL's.  They are
> 
> http://www.os2ss.com/information/kelder/readfi.exe
> http://www.os2ss.com/information/kelder/WPTOOLS.NEW
> 
> readfi.exe kept crashing on me.  From your description, together with
> the WPTOOLS documentation from your standard distribution archive, I
> could take a pretty good guess as to what it does an experimented with a
> REXX script.  It appears that readfi.exe crashed for unresolvable
> ObjectHandles, i.e., those for which my REXX script's call to
> WPToolsQueryObject return 0.  It would appear that you need to check
> return values for NULLs.
> 
> Thanks again for your help
> 
> John Mandeville
> jemandy at earthlink dot net
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: capgemini.nl (1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          12-Oct-99 16:26:08
  To: All                                               12-Oct-99 05:53:24
Subj: Re: Beta vs GA

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

On Sun, 10 Oct 1999 19:14:05 -0400, lifedata@xxvol.com wrote:

:>Several bugs have been removed.  Many have found the GA to be somewhat
superior
:>to the GA.  

Now Jim, put down that bottle of whatever you're drinking and type that again
:-)

Cheers

Wayne

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
  Running on OS/2 Warp 4 (UK)  + FixPak 9
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          12-Oct-99 09:51:04
  To: All                                               12-Oct-99 10:16:26
Subj: Re: WinOs/2 Printing now has Blobs

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 11 Oct 1999 22:57:51, "Eric A. Erickson" <drowelf@nospamvnet.net> a
crit dans un message:

> On Sat, 02 Oct 1999 14:59:13 +0100, Tony Wright wrote:
> 
> A load of crap, that I do not appreciate. 
> 
> BTW, smart xss I solved the problem. 
> Elvish Software Foundry, Inc.    		- Internet:  drowelf@vnet.net
> IBM Certified OS/2 Warp Engineer 	- IBMLink:   HONE81(ESFISA1)
> IBM Certified OS2/ Warp Developer & Associate Visual Age C++ Developer
> 'Already where I want to be Today 	- Voice/Fax: (281)-398-2625 <-Newe'
> 
> 

That's the entire article I see. Nothing there that indicates why this 
wasn't sent by email, instead of posted to USENET.

And if the problem got solved, after being posted here, it's only polite to
explain something about the solution that was found.

This is an OS/2 group, by the way, not over there in the mass-market morass
of windows groups.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         12-Oct-99 12:56:13
  To: All                                               12-Oct-99 16:57:24
Subj: Strange hang up and how I can figure out why

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <SKfw30zmCGmZ-pn2-DbBUXSdjviVt@localhost>,
  doug.bissett"at"attglobal.net (Doug Bissett) wrote:

> > I'M NO NEWBIE.
>
> Well, actually, you are.

What I really meant by this is that I'm damn good at learning new
systems and software.  It's a knack I have.  Something I'm used to
being able to pick up rather quickly.  Part of the reason I'm good at
picking this stuff up is because I am good at finding the references I
need, using the help, and applying concepts and theories learned
previously to my current situations.  I have good pattern recognition
skills.  It is in that context that I protest I'm no newbie. :)

However, you're correct, I *am* an OS/2 newbie.

> OS/2 is a very complicated operating system,
> once you get below the surface. I suggest that you may find a lot of
> good information at the OS/2 supersite (http://www.os2ss.com). There
> is a link there for new users, with a LOT of good information (even
> for experienced users).

I've been wandering around the supersite and I've found an awful lot of
links that don't go anywhere.  It's also not very well laid out.
There's a lot of distracting noise on it.  But I'll suck it up and try
going through there again.

> The user's guides, and tutorials, are only meant to be a beginners
> introduction to OS/2. The newsgroups are the best source of
> information (unless you want to buy an expensive service contract from
> IBM)

Well, actually, I *am* able to call tech support, but I have to limit
that 'cos the company doesn't want me running up a huge bill.  :)

> You did come across, as being an experienced OS/2 user
> (probably because you understand the proper terms, and your signature
> indicates, at least, a familiarity with computers).

*heh*  A little knowledge can be a terrible thing. ;D

> > I've got a program that looks great and useful, CAD Commander, but I
> > can't figure out how to get it to close the delete confirmation
window
> > for the deletion of a print job that's sitting in a printer
device.  I
> > got it to terminate a variety of applications, but none what it
> > terminated was what I needed to terminate.  WHY is this so HARD to
> > find?!
>
> The problem is, that the delete confirmation window, is not a program.
> It is part of the PMShell, which is the whole GUI (Graphical User
> Interface). If you want to get rid of that, you need to kill the
> PMShell (there are, usually, two of these running, and you need to get
> the right one), which should blow away the desktop, and restart it
> (doesn't always work, and some running programs will survive, while
> others will also be terminated). There are a couple of other things to
> consider, like whether you will restart programs, when you do this.

[snip]

> The proper way to close that window, is to reply to it. If it does not
> close, there is something else wrong, that should be fixed. Give us a
> little more information, about what your hardware configuration is,
> what fix pack level you are at, how you got into the problem, and
> about what you were trying to do, and somebody may be able to suggest
> a possible fix.

I truly appreciate your patience with me.  My rant came at the end of a
LOOOOONG week of the print server crashing and me not being able to
identify why.  Let me explain a few things so that it's a little
clearer.

It's an HP Vectra PC with OS/2 Warp 4, FP10 on it.  There are two
network cards.  One card is connected to an image server (on one
network), the other is connected to three IBM 3160 high speed printers
(on a different network).  The *only* software actually running on this
computer is PSF/2.  It is not used for ANYTHING else, period.  It will
NEVER be used for anything other than running PSF/2.  Everything else
in the system set up is supposed to support the running of PSF/2.

This system was set up by a person who is no longer working here.  He
did not leave a single piece of documentation when he left.  The
documents that were supposed to be here with the PSF/2 software aren't
here (well, they are now, thanks to you wonderful people ;).  I started
on this system on August 18th (my first day here) when it was totally
crashed and would NOT run at ALL.  I and a coworker spent five days on
the phone with IBM resetting up OS/2 (fixing .ini files, and stuff)
because there was *no* backup of the system we could use.  We finally
got PSF/2 and OS/2 running on that system, and saved the .ini files on
our file server on yet another network.

After that my coworker worked on tracking how the jobs were hitting the
print server, and worked closely with the people sending the jobs to
control how much they sent over at a time (this is a large bank and the
print server exists to print bank statements, some jobs have as many as
30,000 pages in them, many with images of checks).

I spent my time building a new, faster machine (management is convinced
the stability problems are because the hardware is "too slow") with
scsi network cards, bigger hard drives and more RAM.  Since no one here
knows anything about OS/2 and PSF/2, it's been my job to learn the OS
and the software, get the hardware set up, OS and software installed,
and everythign configured so it "mirrors" the other system (IE, can do
the same things, but "better").

Actually, that's not all I do here, I also have to maintain everyone's
PCs (running windows).

So to give you the details of the latest problem that led to my rant of
Friday. :)

A job gets created on the image server (using software written by
Wausau on a Unix box) and shipped over the network via TCP/IP as an LPD
command that drops into what we call an "intermediate queue".
The "intermediate queue" is a printer device that has been set up using
PSF/2.  The operator then uses the PSF/2 control panel to "transform"
the print job over to one of the three printers so it will be printed
properly.  PSF/2 takes the job and applies things like overlays, fonts,
and other formatting to it, so there's a lot going on in the
background, then it goes to the printer and the printer spews it onto
statement paper.  The job gets dumped into another printer device that
was created using PSF/2 and sits there until it gets released to the
printer by the operator.

The problem I'm about to describe has happened twice in the last two
weeks, but under somewhat different circumstances.  I'll describe the
first time it happened.

After we did the system rebuild, two files started coming over in
addition to every print job.  This is the banner and control files
created by the LPD command.  The funky thing is that this never
happened before the rebuild, and the jobs don't need these files to be
printed (we're trying to figure out how to stop them, but that's
ancillary to the problem I'm describing now).  So for every print job
that comes over, the operator has to manually delete the banner and
control files from the intermediate queue before sie transforms the job
to the printer.

Two weeks ago the second shift operator (who is known for her
impatience with the OS/2 machine) had selected two of these files,
right clicked, and selected delete.  A window opens up and asks if you
want to delete the files.  She clicked delete and nothing happened.
She then spent, probably, around 10 minutes clicking, hammering the ESC
key, and whatever else she felt like hammering, before calling me.  I
arrived to see her hammering and clicking away.  I told her to stop and
then I let it sit for about 10 minutes before doing anything with it.
It was still printing some jobs that were in one of the printers, and
we could click on other things with no problem.  We could transform
jobs from queues other than the queue we were trying to delete from
(there are a total of 7 queues), so the system was operational, but the
delete window would not go away.

I told her to let the jobs she had printing finish, and then we'd shut
down the system.  The jobs finished, and when I went to shut down the
system it wouldn't finish the shut down sequence, but it *did* make the
window go away.  Stupidly I tried deleting those jobs again and got the
same result, only this time when I went to shut down (right click on
desktop, then click shutdown), the window wouldn't close and I had to
ctrl-alt-del to get it to shut down.  After we powered back up,
everything worked fine until a week or so later.

What happened then was a larger hang up on the system that caused some
print jobs to be incomplete.  The image server operator was going to
resend the jobs, so all the jobs in the queue had to be deleted (it was
a LOT of jobs).  The print server operator (first shift) selected the
jobs and did the same thing the previous operator had done.  She
selected delete, the first confirmation window came up, but it wouldn't
go anywhere.  The rest of the system still functioned like before.
Only this operator didn't hammer at the system, she just waited until I
got in and left it for me to deal with.

I tried shutting it down with the right click on the desktop (after it
was done printing what was in the print queue) and that wouldn't close
the window.  Again I had to ctrl-alt-del to restart.

I need to either prevent this situation from happening, or I need a
more graceful way of stopping it when it happens because I can't always
keep the operators from trashing the system if it doesn't work exactly
the way their instructions tell them it should.  Better yet, I'd like
to understand what it's doing, and why it's hanging up like that.

It might be as simple as "well, you just need to reboot the system more
often".  But I don't think that's the case.

Anyway, there's the details, any clues?

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: w.h.m.wauters.1998@cranfield.ac.uk                12-Oct-99 14:29:21
  To: All                                               12-Oct-99 16:57:24
Subj: Re: FP12 unknown failure -11 ??????

From: Wim Wauters <w.h.m.wauters.1998@cranfield.ac.uk>

> what is SimplyFix???

The best damn Fixpack utility on the face of the planet,
and it's European too ;-)

Unfortunately it is a bitch to find on the internet: hang on !
I'll be back !
Yippee, I have it now (from a log file of my FTP-leecher aWget):

http://delenda.biella.alpcom.it/zamprogno/ftp/SFix41US.zip

Recently, version 4.1 was released. Unfortunately it hasn't got the cool
folder-background anymore (find it in version 4.0).

I'm sure you will enjoy this program:
### just make sure it has it's own temp directory ###

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sirius Cybernetics Corporation (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    12-Oct-99 13:33:29
  To: All                                               12-Oct-99 16:57:24
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

dinkmeister <dink@dont.spam.me> writes:
> 
> put cdrecord.exe/mkisofs.exe and readcd.exe in your path
> and try again..

cdrecord.exe/mkisofs.exe were already on the path. I added readcd.exe but
it makes no difference:

Cdrecord release 1.8a24 Copyright (C) 1995-1999 Jrg Schilling
TOC Type: 0 = CD-DA
scsidev: '3'
devname: '3'
scsibus: -2 target: -2 lun: -2
D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe: No such file or directory.
Cannot open SCSI driver.

What "SCSI driver" is it looking for?

Pierre



-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          12-Oct-99 14:06:25
  To: All                                               12-Oct-99 16:57:25
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Tue, 12 Oct 1999 12:02:45, Siobhan Perricone <morgannalefey@my-deja.com>
a crit dans un message:

> In article <c1.01.2ST1zd$0B6@hamei.pacbell.net>,
>   hamei@nospam.pacbell.net wrote:
> 
> > for simple hangs PSTATPM (pspm/2 ?) works very well and doesn't need
> > a manual. I believe it's at Hobbes, if you had a real address I'd
> mail it to you.
> 
> There's absolutely nothing wrong with my address.  Just e-mail it to me
> then.  I can handle files with this account.  *sheesh*
> 
> --
> Siobhan Perricone
> PC Technician
> Alltel Information Services
> (I only speak for myself, not for Alltel)
> 
> 
> Sent via Deja.com http://www.deja.com/
> Before you buy.

I'm just a nosy bystander but I can't identify an address I'd send a file 
to, either. 


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: as@sci.fi                                         12-Oct-99 17:16:23
  To: All                                               12-Oct-99 16:57:25
Subj: Re: cdwriter support

From: Anssi Saari <as@sci.fi>

rcpj@panix.com (Pierre Jelenc) writes:

> dinkmeister <dink@dont.spam.me> writes:
> > 
> > Try CDRecord/2, its free & I wouldn't use anything else =)
> > Heres the url:
> >
http://www.geocities.com/SiliconValley/Sector/5785/cdrecord/cdrecordmain.htm
> 
> This is less than obvious! 

Of course.
 
> CDWriter, using pre-existing WAV files as a test, gives the the following
> error:

Using what command?

-- 
Anssi Saari - as@sci.fi

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tampere University of Technology (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            12-Oct-99 16:06:13
  To: All                                               12-Oct-99 16:57:25
Subj: Re: Describe: A Blast from the Past

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Tue, 12 Oct 1999 10:12:15 GMT, Buddy Donnelly wrote:

>On Tue, 12 Oct 1999 05:40:33, "Esko Kauppinen" <esko.kauppinen@ibm.net> a 
> crit dans un message:
>snip
>> >You're correct about the issue, but in this case there are far worse 
>> >transgressors than DeScribe. DeScribe offers you the power to control 
>> >customization of the Toolbar icons, even to the extent of replacing all
the
>> >built-ins with your own. Use the Tool Manager for that.
>> 
>> Yeah, I know. I have used it but now I seem to have problems with the
>> colors. If I make a new icon it looks ok in Tool Manager but when it is
>> installed on tool bar the colors are inverted or changed.
>> I tried to save the icon with colors inverted but they are still wrong.
>
>You're saying "icon" but DeScribe wants .BMP format, preferably the OS/2 
>v.1.2 flavor.

	Yes I know, but as they are stored in Describe directory under
	TOOLS/ICONS I mistakenly used word icon.
	I have made bmp's with icon editor and with embellish. When
	I view them with PMVIEW they look ok but after I have put
	them with tool manager to the toolbar, the colors are messed.


>> I don't remember ever seeing replacement icons for Describe in any
>> web page. Given the amount of ordinary icons available one would
>> think that there are some for D also.
>
>A good reason to download and try (and register after you've seen how 
>powerful and nifty it is) the MED (formerly "Mister ED") programmer's text 
>editor demo, which also has an editable toolbar and comes with some 24x24 
>buttons that work just fine with DeScribe. The URL is:
>
>	http://www.utopia-planitia.de/

Hey, I didn't know that and I am a registered user of MED! I'll check those
buttons right away.


Ciao / Esko


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            12-Oct-99 16:36:25
  To: All                                               12-Oct-99 16:57:25
Subj: Re: Describe: A Blast from the Past

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Tue, 12 Oct 1999 16:06:27 +0300 (EES), Esko Kauppinen wrote:

>On Tue, 12 Oct 1999 10:12:15 GMT, Buddy Donnelly wrote:

>>A good reason to download and try (and register after you've seen how 
>>powerful and nifty it is) the MED (formerly "Mister ED") programmer's text 
>>editor demo, which also has an editable toolbar and comes with some 24x24 
>>buttons that work just fine with DeScribe. The URL is:
>>
>>	http://www.utopia-planitia.de/
>
>Hey, I didn't know that and I am a registered user of MED! I'll check those
>buttons right away.

Aargh..same problem with those bmp's. Grey color turns into dark magenta,
black is black, white is white but all other colors are wrong.

Esko


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                12-Oct-99 11:20:14
  To: All                                               12-Oct-99 16:57:25
Subj: Re: Beta vs GA

From: lifedata@xxvol.com

"Gordon A. Stripling" <gordon.nospam@gadsnet.com> said:
>> Many have found the GA to be somewhat superior
>>to the GA. 

>I presume you meant "GA to be somewhat superior to the BETA".

Arrrrrrrrrrrrrgh.  Yep.  I've seen lots of comments to this effect.  They
really
removed a bunch of junk in the GA release.  Of course that doesn't guarantee
anything on a given machine. 


Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                12-Oct-99 11:22:09
  To: All                                               12-Oct-99 16:57:25
Subj: Re: Beta vs GA

From: lifedata@xxvol.com

"Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp> said:

>Now Jim, put down that bottle of whatever you're drinking and type that again
>:-)

When I first saw that I thought, "What kind of nut wrote this?" <G>

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: bts@iaehv.nl                                      13-Oct-99 00:04:19
  To: All                                               12-Oct-99 21:21:12
Subj: Netscape 4.61 animations

From: "Martin Bartelds" <bts@iaehv.nl>

A lot of sites do contain animations. Loading such a site
with Netscape 4.61 gives a 100% CPU load and a stalled 
Netscape.

Giving a "Stop animations" solves this problem, however
the page loading also stops.

How can I stop the animations or lower the priority of
the animation thread ?

Offending sites (for example): 

www.altavista.com 
www.zonnet.nl
www.telegraaf.nl


This problem is very anoying !

It doesn't happen with a W95/98 browser.


/Martin.





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: BTSoftware (1:109/42)

+----------------------------------------------------------------------------+

From: helle05@ibm.net                                   12-Oct-99 16:08:12
  To: All                                               12-Oct-99 21:21:12
Subj: Re: NS461: Drag 'n Drop/To and Fro

From: "Thomas A. Heller" <helle05@ibm.net>


"Jeffrey S. Kobal" wrote:
> > > You can drag any link or image to any folder.
> >
> > Unless the folder is set in Details mode, unfortunately.
> 
> Already been fixed for a future fixpack.
> 
> > > Then it's broken on your machine, for some
> > > reason.  Make sure NS46DRAG.DLL exists in
> > > your Netscape\Program directory, and that it
> > > has a 9/16 date.


My NS46DRAG.DLL shows a date of 08-12-99(!) -- as do
*all* the .DLL files in this directory beginning
with "NS"

Does this indicate I got a "not ready for
prime-time" download of 461 on Sept 24th?  Should I
grab another Netscape 4.61 download?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: mcbrides@erols.com                                12-Oct-99 19:40:21
  To: All                                               12-Oct-99 21:21:12
Subj: Re: Netscape 4.61 animations

From: mcbrides@erols.com (Jerry McBride)

In article <ogfvnruiay.fjiwnq0.pminews@martin>,
"Martin Bartelds" <bts@iaehv.nl> wrote:
>A lot of sites do contain animations. Loading such a site
>with Netscape 4.61 gives a 100% CPU load and a stalled
>Netscape.
>
>Giving a "Stop animations" solves this problem, however
>the page loading also stops.
>
>How can I stop the animations or lower the priority of
>the animation thread ?
>
>Offending sites (for example):
>
>www.altavista.com
>www.zonnet.nl
>www.telegraaf.nl
>
>
>This problem is very anoying !
>
>It doesn't happen with a W95/98 browser.
>
>

I JUST READ THIS TIP in comp.os2.beta and it WORKS! On my netscape 4.61ga,
strong encryption, I used a binary editor (HEXED/2 from Hobbes) and searched
for the string "NETSCAPE2.0" (minus the quotes) I changed the "." to a "," and
then next to that string there's a "ANIMEXTS1." and I changed the "1" to a
"2".

Now when I'm browsing online and one of those PESKY animated graphics pops up,
it run's once though then stops DEAD! No more wasted cpu on a crummy graphic I
didn't want in the first place! YAHHHoooo!!!

Your listed URL's now only display pictures! Not the cpu hogging movies they
call advertizment!

Here's the entire posted message I read on comp.os2.beta...


--- quote ---


> Now there's something I'd very much like to see in Netscape
> preferences.  The ability to turn off wiggle graphics and NOT get
> piles of error messages!!!!!!!

To make gif animations stop after one cycle, read this page:
http://simmons.starkville.ms.us/tips/081097/

In short, search for NETSCAPE2.0 and for ANIMEXTS1.0 and change them to be
something else - I just changed the . to a , (in netscape.exe).

        -Ariel

PS. Use a binary safe editor.

--- end quote ---

That URL at simmons.starkville.ms.us points to a document describing the
origins of animated gifs and how to disable them...

Yeoooo, is it just me or is anyone else excited about this? :')


--

*******************************************************************************

*            Sometimes, the BEST things in life really ARE free...           
*
*       Get a FREE copy of NetRexx 1.151 for your next java project at:      
*
*                                                                            
*
*                      GET IT NOW! WHILE IT'S STILL FREE!                    
*
*                                                                            
*
*                     http://www2.hursley.ibm.com/netrexx                    
*
*******************************************************************************


/----------------------------------------\
| From the desktop of: Jerome D. McBride |
|         mcbrides@erols.com             |
\----------------------------------------/

--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TEAM-NETREXX (1:109/42)

+----------------------------------------------------------------------------+

From: will@premier.net                                  12-Oct-99 11:21:26
  To: All                                               12-Oct-99 23:18:16
Subj: Aurora beta & desktop objects

From: "Will Luikart" <will@premier.net>

Since installing Aurora beta a while back I have hoticed that most (if not
all) of the *cmd files I used with Warp 4 for creating desktop objects do not
work with the Aurora desktop. Does anyone know why this is and what can be
done to remedy it? Thanks in advance....

Will


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Giganews.Com - Premium News Outsourcing (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         12-Oct-99 16:26:06
  To: All                                               12-Oct-99 23:18:16
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <Z8vLRdP7nz3N-pn2-
3tEEd7gjCG31@sphericalburn.tampabay.rr.com>,
  donnelly@tampabay.rr.com (Buddy Donnelly) wrote:

> On Tue, 12 ... Siobhan Perricone <morgannalefey@my-deja.com>
                                    ^^^^^^^^^^^^^^^^^^^^^^^^^

> I'm just a nosy bystander but I can't identify an address I'd send a
file
> to, either.

Yet your software quotes it.  It's morgannalefey@my-deja.com.  That's
an actual e-mail address that people can reply-to.  It's set as that in
the reply-to field in the post header.  Don't mean to sound snippy,
I've just never had anyone complain about this before, and I've had
many people respond to me privately about things I've posted with this
address.  I've even had people send me files there.

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@nospam.net                               12-Oct-99 12:39:00
  To: All                                               12-Oct-99 23:18:16
Subj: Re: Describe: A Blast from the Past

From: letoured@nospam.net

>Suite 8 was going like $33 CDN whereas Microsoft Office  97 academic was
>like a little over $120 CDN.  This is also why I'm  surprised Lotus has
>not done the same with their SmartSuite given that  they are in the same
>price area as Microsoft Office.

I bought SS97 Academic for $95 a year ago.  

I looked over Describe once around version 2 or something, and spent a lot
of time on the phone with their developers. It was a single user-type
program that didn't do anything that made it a real stand out. It didn't
have the long document capabilities of the old Lotus Manuscript, and it
didn't have the DTP capabilities of FrameMaker, and it pretty much flopped
making WordPerfect files that you could take to another machine and run in
WP -- which was the standard at the time for word processor. 

_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 12-Oct-99 17:42:19
  To: All                                               12-Oct-99 23:18:16
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: hamei@pacbell.net

In <7tvneg$vtm$1@nnrp1.deja.com>, Siobhan Perricone
<morgannalefey@my-deja.com> writes:
>In article <Z8vLRdP7nz3N-pn2-
>3tEEd7gjCG31@sphericalburn.tampabay.rr.com>,
>  donnelly@tampabay.rr.com (Buddy Donnelly) wrote:
>
>> On Tue, 12 ... Siobhan Perricone <morgannalefey@my-deja.com>
>                                    ^^^^^^^^^^^^^^^^^^^^^^^^^
>
>> I'm just a nosy bystander but I can't identify an address I'd send a
>file
>> to, either.
>
>Yet your software quotes it.  It's morgannalefey@my-deja.com.  That's
>an actual e-mail address that people can reply-to.  It's set as that in
>the reply-to field in the post header.  Don't mean to sound snippy,
>I've just never had anyone complain about this before, and I've had
>many people respond to me privately about things I've posted with this
>address.  I've even had people send me files there.
>
>--
>Siobhan Perricone
>PC Technician
>Alltel Information Services
>(I only speak for myself, not for Alltel)
>

you are right, mea culpa, mea maxima culpa. I just see 'deja' and 
immediately translate 'useless.' Sorry to the max . . . and pstat 
wings its way to morgan le fay even as we commune.

morgan was not a nice lady, by the way . . . 

--
Hrad ngravvrd

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: rogprov@aol.com                                   12-Oct-99 18:06:15
  To: All                                               12-Oct-99 23:18:16
Subj: Re: AOL under winos2

From: rogprov@aol.com (Rogprov)

In article <19991012003749.16294.00000496@ng-fb1.aol.com>, dstg0001@aol.com
(Dstg0001) writes:

>Is there any version of the 16-bit AOL software that runs in Warp 4 under
>WinOS2?

I'm using 3.01 without any problems

Roger Provins

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AOL, http://www.aol.co.uk (1:109/42)

+----------------------------------------------------------------------------+

From: kim@haverblad.com                                 12-Oct-99 20:16:13
  To: All                                               12-Oct-99 23:18:16
Subj: Process Commander and WSFeB

From: "Kim Haverblad" <kim@haverblad.com>

I don't know if mentioned subject has been posted already. Guess I then
missed it. But sent an e-mail to Stardock System asking if there is any fix
or update to get PC to work on WSFeB. Well here is the answer:

>Hello Kim,
>PC was written for warp 4, and does not work with WSFeB.
>Best Regards,
>Ian Hanschen
>Stardock Systems

Well, I'm going to miss PC on my WSFeB installation. It's a piece of great
software. Anyone that have a idea of workaround or something?

//Kim


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A Customer of Tele2 (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    12-Oct-99 18:34:15
  To: All                                               12-Oct-99 23:18:16
Subj: Re: Describe: A Blast from the Past

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Doug Darrow (d.s.darrow@nvinet.com) wrote:

: Oh, they were actually quite good at the "competitive pricing" game. I
: bought Describe 3.5 for $189US in '92. They accepted an old DOS version
: of M$ Works as the WP upgrade. I don't know about "educational" pricing
: as I've not been attached to any educational institution since Johnson
: was President. About six months after I bought it, they dropped the
: price to $139US (just before the release of v.4.0, the first 32-bit
: release) but by then the upgrade price was just $49US to current
: owners. Then, in late '96, in the swiftest move Jim Linnane ever made,
: they released v.5.0 with a special "quarterly update" time-bomb. If you
: didn't apply the (free) update every 3 months, Describe would quit
: working. That went over like a fart in the choir loft. So they then
: released the non-time-bombed version then started the 'Voyager'
: marketing scheme where Describe was sold through book stores bundled
: with the Que manual. That might have worked out for them if M$ and IBM
: hadn't already managed to get OS/2 books scrubbed from the bookstores.
: Just imagine a cross-platform WP with the power of Describe, including
: an excellent manual, selling for only $49US! No, _pricing_ wasn't the
: downfall of Describe. _Marketing_ was.

	Really?  It's too bad they didn't just do what Stardock did with 
their Entrepreneur and say, oh yeah, its a Windows game.  If they just 
said it was a Windows word processor, man, you really gotta wonder how it 
would've played out in the end.  Especially nowadays with a small part of 
Linux's success doing the same thing, selling the CDROM with a nice fat 
book on how to use it.  The bookstores are just clustered with that sort 
of stuff.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: ariek3.14159265358979323846@attg...               12-Oct-99 18:47:21
  To: All                                               12-Oct-99 23:18:16
Subj: IBM dialer 1.69: truncates modem init. string?

Message sender: ariek3.14159265358979323846@attglobal.net

From: ariek3.14159265358979323846@attglobal.net (Arie Kazachin)

Hello!

I recently installed IBM Global Network dialer 1.69
(without removing the 1.67 version which I use for VERY long time).
Comparing connections with each of the versions when the line carrier
sound is preceeded by few seconds of "you have new message in your
voice-box" beeps I discovered that the new version of the dialer
doesn't wait 5 seconds before deciding that the carrier signal doesn't
exists. My modem is USR Sportster 28.8K and its init. string contains
the string "S6=5", which is the command that causes the 5 seconds delay.
The second init. string in the previous dialer version is:

AT&H1&I0&K1&M4&N0&R2&S1S0=2S6=5M1L0


and the second init. string in the later version is:

&H1&I0&K1&M4&N0&R2&S1S0=2S6=5

together with the following speaker enable/volume settings:

Off: M1
Low: L0
Med: L2.
High: L3.
(It seems the 1.69 automatically pepends the "AT" before the atring
I write).

The command "S6=5" is present in both init. strings but it works
in the previous version and doesn't work in the later version.
Can it be that there is a bug in a dialer so that it truncates
few characters at the end of init. string?
I also noticed that in the later version, I can't type more than 3
characters past the end of the init string shown above while in the
previous version I can type and type and type...

Did anyone else noticed this behaviour?

I'm running WARP 3 Hebrew NLV at FP40 level.

THANKS IN ADVANCE FOR ANY HELP ! ! !
******************************************************************************
*   Arie Kazachin, Israel, e-mail: ariek3.14159265358979323846@attglobal.net *
******************************************************************************
NOTE: before replying, leave only letters in my userID. Sorry, SPAM trap.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Unspecified Organization (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    12-Oct-99 18:44:24
  To: All                                               12-Oct-99 23:18:16
Subj: Re: Describe: A Blast from the Past

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

letoured@nospam.net wrote:
: >Suite 8 was going like $33 CDN whereas Microsoft Office  97 academic was
: >like a little over $120 CDN.  This is also why I'm  surprised Lotus has
: >not done the same with their SmartSuite given that  they are in the same
: >price area as Microsoft Office.

: I bought SS97 Academic for $95 a year ago.  

	Not anymore, it's going for about $119 at my university computer 
purchasing centre, the Millenium edition.

: I looked over Describe once around version 2 or something, and spent a lot
: of time on the phone with their developers. It was a single user-type
: program that didn't do anything that made it a real stand out.

	Version three wasn't that much different from what the PC Mag 
review said back in 1992...but was better than the WordStar 1.0 or Legacy 
2.0 mid-range alternatives were going for.

: It didn't have the long document capabilities of the old Lotus 
: Manuscript, and it didn't have the DTP capabilities of FrameMaker, and 
: it pretty much flopped making WordPerfect files that you could take to 
: another machine and run in WP -- which was the standard at the time for 
: word processor. 

	Unfortunately, you are comparing apples and oranges as Describe 5 
is a *very* different beast than what Describe 2 must have been.  
Describe 5 is essentially WordPerfect 5.1 for Windows 3.1 only without the 
bugs and coming in Windows 95 and OS/2 flavors as well as Windows 3.1 all 
on the one CDROM.
	It provides basic DTP abilities which is all that a word 
processor is supposed to do, IMO, since if you wanted real DTP done you'd 
want a real DTP application like what you had given as an example in 
FrameMaker.  The long document part for Describe 5 shouldn't be an issue; 
someone emailed me their experience with it, the guy did his thesis and 
dissertation with Describe 5 on a Gateway 486/33Mhz machine, the thesis 
was 35 pages in length but had 19 equations and the dissertation was over 
100 pages in length.  So I don't think Describe 5 should do that badly in 
the long document range...in fact, probably better since it doesn't sport 
the *heavy* requirements like WordPerfect 8-9, Word 97-2000, Word Pro 96-97.
	As for document exportation, well...duh. ;-)  I have never seen a 
word processor lately that exports as well as it imports.  The race to 
keep up is simply a lost cause because you'll end up doing what IBM was 
doing with Win32s support since all Microsoft had to do was add an extra 
something there, an extra something there that will break it causing IBM 
to go through the experience again, and again until finally IBM said, 
enough was enough WIn32s 1.25 is where we are leaving it. 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: ulvb@online.no                                    12-Oct-99 18:52:02
  To: All                                               12-Oct-99 23:18:16
Subj: Re: Squid?

From: ulvb@online.no (Ulv Bjerkan)

On Mon, 11 Oct 1999 20:30:05, jdc0014@InfoNET.st-johns.nf.ca (John 
Hong) wrote:

> 	Anyone tried Squid yet?  I was just wondering how it performs 
> against SmartCache since Squid is OS/2 native.  The latest release is on 
> Hobbes.  It's a proxy for http in order to provide better web caching.  

No trouble running latest Squid here :-)


--
Ulv Bjerkan 
http://home.sol.no/~ulvb/os2dl.html
 ftp://ftp.sol.no/user/ulvb
---------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telenor Nextel (1:109/42)

+----------------------------------------------------------------------------+

From: info@qvision.net                                  12-Oct-99 19:06:29
  To: All                                               12-Oct-99 23:18:16
Subj: Circus Technology/Unite CD-Maker

From: info@qvision.net

I am interest in purchasing the rights and source code to the
Unite CD-Maker from Circus Technology. Please email me if
you can help.

John M. Schaeffer
John@qvision.net
<A HREF="http://www.quietvision.com">www.quietvision.com</A>
Home of the Electronic Paperback (R)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: XMission http://www.xmission.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         12-Oct-99 18:58:04
  To: All                                               12-Oct-99 23:18:16
Subj: OT: morgannalefey

From: Siobhan Perricone <morgannalefey@my-deja.com>

> you are right, mea culpa, mea maxima culpa. I just see 'deja' and
> immediately translate 'useless.' Sorry to the max . . . and pstat
> wings its way to morgan le fay even as we commune.

No problem, I often feel the same way about deja.  I'm only using this
because of some stupid policy that temp workers don't get real alltel e-
mail addresses.

> morgan was not a nice lady, by the way . . .

Nah, that's just propoganda spread by the winners. ;D

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: bdavis@fn.net                                     12-Oct-99 19:30:20
  To: All                                               12-Oct-99 23:18:16
Subj: Re: Strange hang up and how I can figure out why

From: bdavis@fn.net (Brian Davis)

On Tue, 12 Oct 1999 12:56:26, Siobhan Perricone <morgannalefey@my-deja.com>
wrote:

> In article <SKfw30zmCGmZ-pn2-DbBUXSdjviVt@localhost>,
>   doug.bissett"at"attglobal.net (Doug Bissett) wrote:
> 
> > > I'M NO NEWBIE.
> >
> > Well, actually, you are.
> 
> What I really meant by this is that I'm damn good at learning new
> systems and software.  It's a knack I have.  Something I'm used to
> being able to pick up rather quickly.  Part of the reason I'm good at
> picking this stuff up is because I am good at finding the references I
> need, using the help, and applying concepts and theories learned
> previously to my current situations.  I have good pattern recognition
> skills.  It is in that context that I protest I'm no newbie. :)
> 
> However, you're correct, I *am* an OS/2 newbie.
> 
> > OS/2 is a very complicated operating system,
> > once you get below the surface. I suggest that you may find a lot of
> > good information at the OS/2 supersite (http://www.os2ss.com). There
> > is a link there for new users, with a LOT of good information (even
> > for experienced users).
> 
> I've been wandering around the supersite and I've found an awful lot of
> links that don't go anywhere.  It's also not very well laid out.
> There's a lot of distracting noise on it.  But I'll suck it up and try
> going through there again.
> 
> > The user's guides, and tutorials, are only meant to be a beginners
> > introduction to OS/2. The newsgroups are the best source of
> > information (unless you want to buy an expensive service contract from
> > IBM)
> 
> Well, actually, I *am* able to call tech support, but I have to limit
> that 'cos the company doesn't want me running up a huge bill.  :)
> 
> > You did come across, as being an experienced OS/2 user
> > (probably because you understand the proper terms, and your signature
> > indicates, at least, a familiarity with computers).
> 
> *heh*  A little knowledge can be a terrible thing. ;D
> 
> > > I've got a program that looks great and useful, CAD Commander, but I
> > > can't figure out how to get it to close the delete confirmation
> window
> > > for the deletion of a print job that's sitting in a printer
> device.  I
> > > got it to terminate a variety of applications, but none what it
> > > terminated was what I needed to terminate.  WHY is this so HARD to
> > > find?!
> >
> > The problem is, that the delete confirmation window, is not a program.
> > It is part of the PMShell, which is the whole GUI (Graphical User
> > Interface). If you want to get rid of that, you need to kill the
> > PMShell (there are, usually, two of these running, and you need to get
> > the right one), which should blow away the desktop, and restart it
> > (doesn't always work, and some running programs will survive, while
> > others will also be terminated). There are a couple of other things to
> > consider, like whether you will restart programs, when you do this.
> 
> [snip]
> 
> > The proper way to close that window, is to reply to it. If it does not
> > close, there is something else wrong, that should be fixed. Give us a
> > little more information, about what your hardware configuration is,
> > what fix pack level you are at, how you got into the problem, and
> > about what you were trying to do, and somebody may be able to suggest
> > a possible fix.
> 
> I truly appreciate your patience with me.  My rant came at the end of a
> LOOOOONG week of the print server crashing and me not being able to
> identify why.  Let me explain a few things so that it's a little
> clearer.
> 
> It's an HP Vectra PC with OS/2 Warp 4, FP10 on it.  There are two
> network cards.  One card is connected to an image server (on one
> network), the other is connected to three IBM 3160 high speed printers
> (on a different network).  The *only* software actually running on this
> computer is PSF/2.  It is not used for ANYTHING else, period.  It will
> NEVER be used for anything other than running PSF/2.  Everything else
> in the system set up is supposed to support the running of PSF/2.
> 
> This system was set up by a person who is no longer working here.  He
> did not leave a single piece of documentation when he left.  The
> documents that were supposed to be here with the PSF/2 software aren't
> here (well, they are now, thanks to you wonderful people ;).  I started
> on this system on August 18th (my first day here) when it was totally
> crashed and would NOT run at ALL.  I and a coworker spent five days on
> the phone with IBM resetting up OS/2 (fixing .ini files, and stuff)
> because there was *no* backup of the system we could use.  We finally
> got PSF/2 and OS/2 running on that system, and saved the .ini files on
> our file server on yet another network.
> 
> After that my coworker worked on tracking how the jobs were hitting the
> print server, and worked closely with the people sending the jobs to
> control how much they sent over at a time (this is a large bank and the
> print server exists to print bank statements, some jobs have as many as
> 30,000 pages in them, many with images of checks).
> 
> I spent my time building a new, faster machine (management is convinced
> the stability problems are because the hardware is "too slow") with
> scsi network cards, bigger hard drives and more RAM.  Since no one here
> knows anything about OS/2 and PSF/2, it's been my job to learn the OS
> and the software, get the hardware set up, OS and software installed,
> and everythign configured so it "mirrors" the other system (IE, can do
> the same things, but "better").
> 
> Actually, that's not all I do here, I also have to maintain everyone's
> PCs (running windows).
> 
> So to give you the details of the latest problem that led to my rant of
> Friday. :)
> 
> A job gets created on the image server (using software written by
> Wausau on a Unix box) and shipped over the network via TCP/IP as an LPD
> command that drops into what we call an "intermediate queue".
> The "intermediate queue" is a printer device that has been set up using
> PSF/2.  The operator then uses the PSF/2 control panel to "transform"
> the print job over to one of the three printers so it will be printed
> properly.  PSF/2 takes the job and applies things like overlays, fonts,
> and other formatting to it, so there's a lot going on in the
> background, then it goes to the printer and the printer spews it onto
> statement paper.  The job gets dumped into another printer device that
> was created using PSF/2 and sits there until it gets released to the
> printer by the operator.
> 
> The problem I'm about to describe has happened twice in the last two
> weeks, but under somewhat different circumstances.  I'll describe the
> first time it happened.
> 
> After we did the system rebuild, two files started coming over in
> addition to every print job.  This is the banner and control files
> created by the LPD command.  The funky thing is that this never
> happened before the rebuild, and the jobs don't need these files to be
> printed (we're trying to figure out how to stop them, but that's
> ancillary to the problem I'm describing now).  So for every print job
> that comes over, the operator has to manually delete the banner and
> control files from the intermediate queue before sie transforms the job
> to the printer.
> 
> Two weeks ago the second shift operator (who is known for her
> impatience with the OS/2 machine) had selected two of these files,
> right clicked, and selected delete.  A window opens up and asks if you
> want to delete the files.  She clicked delete and nothing happened.
> She then spent, probably, around 10 minutes clicking, hammering the ESC
> key, and whatever else she felt like hammering, before calling me.  I
> arrived to see her hammering and clicking away.  I told her to stop and
> then I let it sit for about 10 minutes before doing anything with it.
> It was still printing some jobs that were in one of the printers, and
> we could click on other things with no problem.  We could transform
> jobs from queues other than the queue we were trying to delete from
> (there are a total of 7 queues), so the system was operational, but the
> delete window would not go away.
> 
> I told her to let the jobs she had printing finish, and then we'd shut
> down the system.  The jobs finished, and when I went to shut down the
> system it wouldn't finish the shut down sequence, but it *did* make the
> window go away.  Stupidly I tried deleting those jobs again and got the
> same result, only this time when I went to shut down (right click on
> desktop, then click shutdown), the window wouldn't close and I had to
> ctrl-alt-del to get it to shut down.  After we powered back up,
> everything worked fine until a week or so later.
> 
> What happened then was a larger hang up on the system that caused some
> print jobs to be incomplete.  The image server operator was going to
> resend the jobs, so all the jobs in the queue had to be deleted (it was
> a LOT of jobs).  The print server operator (first shift) selected the
> jobs and did the same thing the previous operator had done.  She
> selected delete, the first confirmation window came up, but it wouldn't
> go anywhere.  The rest of the system still functioned like before.
> Only this operator didn't hammer at the system, she just waited until I
> got in and left it for me to deal with.
> 
> I tried shutting it down with the right click on the desktop (after it
> was done printing what was in the print queue) and that wouldn't close
> the window.  Again I had to ctrl-alt-del to restart.
> 
> I need to either prevent this situation from happening, or I need a
> more graceful way of stopping it when it happens because I can't always
> keep the operators from trashing the system if it doesn't work exactly
> the way their instructions tell them it should.  Better yet, I'd like
> to understand what it's doing, and why it's hanging up like that.
> 
> It might be as simple as "well, you just need to reboot the system more
> often".  But I don't think that's the case.
> 
> Anyway, there's the details, any clues?
> 
> --
> Siobhan Perricone
> PC Technician
> Alltel Information Services
> (I only speak for myself, not for Alltel)
> 

I'll take a stab in the dark on the printing que problem.

Take a look at the properties for the printer that's causing
all the problems. Open the properties for the printer by
right clicking on the printer icon, then select properties.
This will display a properties page with selectable tabs.

Select the Printer driver tab then select the Job properties...
radio button. This should display another notebook settings
page. The first selectable tab should say Common. Look
at the Print Mode setting. Here's the Help dialog for
Print Mode.....
---------------------------------------------------------------
 Print Mode 

 This pulldown list allows you to select whether your 
 printouts are monochrome or color (if supported by 
 your printer). 

 If the printer allows multiple levels of grayscale or 
 more than one color format those selections will 
 appear in this list as well. 

 This number is sometimes represented as 
 "bits-per-pel" (bpp): 

      24-bit = 16.7 million colors/grayscales 
      8-bit  = 256 colors/grayscales 
      4-bit  = 16 colors/grayscales 
  
  Photo-Quality Printing 

  For best output results printing "photo-quality" 
  graphics please select the print mode that uses the 
  most colors/grayscales or highest "bits-per-pel". 

  Note:    This driver's monochrome printouts, by 
           default, use 256 grayscales and color 
           printouts use 256 colors (if none are listed). 

           Selecting color print modes will cause 
           printouts to take longer to finish than 
           selecting monochrome print modes for the 
           same document. 

           The more colors/grayscales used on a 
           printout (more "bits-per-pel") the longer 
           the printout will take to finish.
-------------------------------------------------------------

Select the appropriate printing mode for the printer and save the 
selection.

I've had a similar problem on one of my systems at home. The system has
a HP Deskjet 400 printer which can print using color or black inkjet 
cartridges.
My printer can only use one cartridge at a time, so if I want to print in 
color
I have to remove the black cartridge and install the color cartridge then 
select
the color Printing Mode.

If the wrong Printing Mode is selected for my printer then the change 
cartridge
light on my printer starts to flash on and off and I have to turn the 
printer off
and back on, then select the correct Printing Mode, save the selection, 
then
print the job. The print job is in the print que waiting to be printed 
during
the time the change cartridge light is flashing and the print job can not 
be
deleted no matter how many times I try to delete the job, curse, keep my
fingers crossed or weep in desperation. After the printer is turned on and
off OR the machine gets rebooted the print job will disappear from the que
and then I could select the correct printing mode and the printer functions
like it should.

I don't know if this will help your situation but it sure sounds like a 
similar
problem.  Hopefully someone else will post and lend a hand.

Brian Davis (bdavis@fn.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     12-Oct-99 20:25:18
  To: All                                               12-Oct-99 23:18:16
Subj: Re: cdwriter support

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On 12 Oct 1999 13:33:58 GMT, Pierre Jelenc wrote:

->> put cdrecord.exe/mkisofs.exe and readcd.exe in your path
->> and try again..
->
->cdrecord.exe/mkisofs.exe were already on the path. I added readcd.exe but
->it makes no difference:
->
->Cdrecord release 1.8a24 Copyright (C) 1995-1999 Jrg Schilling
->TOC Type: 0 = CD-DA
->scsidev: '3'
->devname: '3'
->scsibus: -2 target: -2 lun: -2
->D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe: No such file or directory.
->Cannot open SCSI driver.
->
->What "SCSI driver" is it looking for?

Have you loaded ASPIROUT.SYS? OS2ASPI.DMD? The driver for your SCSI card?


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: nospam2rhb@accessv.com                            12-Oct-99 21:07:19
  To: All                                               12-Oct-99 23:18:17
Subj: Re: Word6 CBT trick 

From: Rob Burton <nospam2rhb@accessv.com>

Ah, no.
The trick is, having just spent the time trying all suggestions, then
doing a little Win 31 install to compare and contrast, to add this
line to the first, [Microsoft Word] section of winword6.ini which you
find in the winos2 folder after an otherwise successful install of
Word 6.0a-c:

CBT-PATH=J:\WD6C\WORDCBT

As easy as that. Then you get the benefit of the on-screen movie demos
and examples.

BTW, my research discovered that this installation is blocked/broken
if you install Word 6 in NT, too, FWIW.

Regards,


On 09 Oct 1999 18:11:18 PDT, Cityboy@Spam-No-More.Net sent:

>>Anybody know how to get the Word 6 tutorials to install and run in
>>Win-OS2? I heard there was a trick, but I can't find it, and they won't
>>go now.
>
>Ah Yes! The trick is run WinOS/2 in a specific DOS version, ie. some
>version of MS-DOS. Read up on VMDISK in the OS/2 command reference to
>find out how to do it.  When the Word install runs it will then think
>it is being run in "real" DOS/Windows and install the tutorials and
>the CBT. Microsnot has something in there to detect OS/2 and prevent
>the help and training from being installed. With the specific DOS VDM
>it can't tell.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: Frank@get-lost.spam                               13-Oct-99 00:25:19
  To: All                                               13-Oct-99 03:37:02
Subj: Describe 4.0 : How to print ?

From: Frank@get-lost.spam (Frank)

I have a (shareware) copy of Describe 4.0, but I can't print anything 
with it.
The printer setup option is grayed out, so I'm not able to check 
wether ir recognizes a printer or not.

How do I overcome this problem.
(Is this a shareware lock or what ??)


Greeeeeetings,

Frank

The box said:"Requires Windows 95/98, NT or better" .......... So I 
installed OS/2.


Reply per Email to franklyware@-NOSPAM-beer.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     13-Oct-99 00:19:19
  To: All                                               13-Oct-99 03:37:02
Subj: Re: Fp12 and default fonts

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Mon, 11 Oct 1999 20:13:45, jvarela@mind-spring.com (John Varela) 
wrote:

> On Sun, 10 Oct 1999 20:15:11, doug.bissett"at"attglobal.net (Doug 
> Bissett) wrote:
> 
> > On Sat, 9 Oct 1999 21:48:31, jvarela@mind-spring.com (John Varela) 
> > wrote:
> 
> > > The tabs in Lotus Organizer have lost everything but their initials.  
> > > That is, "Calendar" displays as just a "C", "Addresses" as just "A" 
> > > and so forth.  No idea how to go about trying to correct that.
> 
> > There is a font setting in Organizer-> Section-> Customize (it only 
> > allows changing font size). Perhaps that will help.
> 
> Hmm.  Fooling with that brought back the writing on the tabs.  
> However, the tabs only display correctly if I check the "Scale with 
> window size" box.  But when I do that the text in the appointment 
> entries is too big.  When I uncheck that box, the entries are all 
> visible, but now the tabs are illegible.  It appears that perhaps the 
> tabs are printed in all caps with spacing for lower case (when 
> legible, they are in lower case).
> 
> --
> John Varela
> to e-mail, remove - between mind and spring

OK, what happens, if you select a differnet default font system wide? 
(System Setup-> Font Pallet-> pick a font, and size  (Edit font to 
change the options)-> Drag the font to the desktop, while holding down
the Alt key.

I don't know if this will change anything, but give it a shot. I don't
know where else it would get a default font from.
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     13-Oct-99 00:19:15
  To: All                                               13-Oct-99 03:37:02
Subj: Re: Strange hang up and how I can figure out why

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Tue, 12 Oct 1999 12:56:26, Siobhan Perricone 
<morgannalefey@my-deja.com> wrote:

..snip...
> What I really meant by this is that I'm damn good at learning new
> systems and software.  It's a knack I have.  Something I'm used to
> being able to pick up rather quickly.  Part of the reason I'm good at
> picking this stuff up is because I am good at finding the references I
> need, using the help, and applying concepts and theories learned
> previously to my current situations.  I have good pattern recognition
> skills.  It is in that context that I protest I'm no newbie. :)
> 
> However, you're correct, I *am* an OS/2 newbie.

With that attitude, you won't be a "Newbie" for long <g>.
 
..snip...
> I've been wandering around the supersite and I've found an awful lot of
> links that don't go anywhere.  It's also not very well laid out.
> There's a lot of distracting noise on it.  But I'll suck it up and try
> going through there again.

Actually, it is a bad time to be looking around on OS/2 sites, in 
general. With Warpstock '99 happening, soon now, a lot of the people 
who maintain these sites, are very busy with other things. 
Unfortunately, there also seems to be a lack of personnel at the OS/2 
supersite, and the links don't get updated all that often anyway. On 
the other hand, the links that do work, are mostly very good. You may 
want to bookmark the ones that you find to be useful, so you don't 
need to wade through the not so useful ones in the future.

..snip...
> Well, actually, I *am* able to call tech support, but I have to limit
> that 'cos the company doesn't want me running up a huge bill.  :)

That puts you a big step ahead of most of the people in the news 
groups.
 
..snip...
> I truly appreciate your patience with me.  My rant came at the end of a
> LOOOOONG week of the print server crashing and me not being able to
> identify why.  Let me explain a few things so that it's a little
> clearer.

Been there, done that...

OK, now we are getting somewhere...
 
> It's an HP Vectra PC with OS/2 Warp 4, FP10 on it.  There are two
> network cards.  One card is connected to an image server (on one
> network), the other is connected to three IBM 3160 high speed printers
> (on a different network).  The *only* software actually running on this
> computer is PSF/2.  It is not used for ANYTHING else, period.  It will
> NEVER be used for anything other than running PSF/2.  Everything else
> in the system set up is supposed to support the running of PSF/2.

OK, PSF/2 is something I know nothing about. Anybody else know about 
it???
 
..snip some of the background...

> Actually, that's not all I do here, I also have to maintain everyone's
> PCs (running windows).

That must keep you busy <g>.
 
> So to give you the details of the latest problem that led to my rant of
> Friday. :)
> 
> A job gets created on the image server (using software written by
> Wausau on a Unix box) and shipped over the network via TCP/IP as an LPD
> command that drops into what we call an "intermediate queue".
> The "intermediate queue" is a printer device that has been set up using
> PSF/2.  The operator then uses the PSF/2 control panel to "transform"
> the print job over to one of the three printers so it will be printed
> properly.  PSF/2 takes the job and applies things like overlays, fonts,
> and other formatting to it, so there's a lot going on in the
> background, then it goes to the printer and the printer spews it onto
> statement paper.  The job gets dumped into another printer device that
> was created using PSF/2 and sits there until it gets released to the
> printer by the operator.
> 
> The problem I'm about to describe has happened twice in the last two
> weeks, but under somewhat different circumstances.  I'll describe the
> first time it happened.
> 
> After we did the system rebuild, two files started coming over in
> addition to every print job.  This is the banner and control files
> created by the LPD command.  The funky thing is that this never
> happened before the rebuild, and the jobs don't need these files to be
> printed (we're trying to figure out how to stop them, but that's
> ancillary to the problem I'm describing now).  So for every print job
> that comes over, the operator has to manually delete the banner and
> control files from the intermediate queue before sie transforms the job
> to the printer.

OK, If you click on the information icon (the round blue circle, with 
an "i" in it, and a yellow page behind it, in WarpCenter, or open the 
Assistance icon, on the desktop, and double click Information)-> 
Reference and commands-> TCP/IP Command reference-> TCP/IP commands by
name-> LPD it will tell you that you will get a default banner, unless
you specify the "-b" parameter, without a file name. That should fix 
the banner problem (I hope). Then, it tells you that, if you specify 
the "-c" parameter, it will not create a control file, which should 
fix that problem. Of course, you need to find where the LPD program 
gets started. I am not sure, but it might be in x:\MPTN\BIN\SETUP.CMD,
where x: is your boot drive.
 
> Two weeks ago the second shift operator (who is known for her
> impatience with the OS/2 machine) had selected two of these files,
> right clicked, and selected delete.  A window opens up and asks if you
> want to delete the files.  She clicked delete and nothing happened.
> She then spent, probably, around 10 minutes clicking, hammering the ESC
> key, and whatever else she felt like hammering, before calling me.  I
> arrived to see her hammering and clicking away.  I told her to stop and
> then I let it sit for about 10 minutes before doing anything with it.
> It was still printing some jobs that were in one of the printers, and
> we could click on other things with no problem.  We could transform
> jobs from queues other than the queue we were trying to delete from
> (there are a total of 7 queues), so the system was operational, but the
> delete window would not go away.

I am not sure what is happening there (the 10 minute delay, probably, 
didn't do any good, or harm). I have never seen a problem, quite like 
that. It is possible, that if the print job has already been queued to
a printer (is PSF/2 some sort of virtual printer?), that it may not go
away until that printer actually starts to print, or, you power it 
off, to break the lock. (This doesn't really sound applicable, but it 
is a possibility, or may suggest what is actually going on). It is 
also possible that one, or more, of the jobs had not actually finished
spooling, and was still locked because of that.
 
> I told her to let the jobs she had printing finish, and then we'd shut
> down the system.  The jobs finished, and when I went to shut down the
> system it wouldn't finish the shut down sequence, but it *did* make the
> window go away.  Stupidly I tried deleting those jobs again and got the
> same result, only this time when I went to shut down (right click on
> desktop, then click shutdown), the window wouldn't close and I had to
> ctrl-alt-del to get it to shut down.  After we powered back up,
> everything worked fine until a week or so later.

OK, sometimes, something on the desktop abends, but leaves part of 
itself behind. If that happens, it is quite common that the desktop 
won't shut down (it tries to close the partial program, which is not 
responding, but cannot continue the shutdown, until that program does 
close), and you need to use Ctrl-Alt-Del to recover. Most of the time,
Ctrl-Alt-Del will work, and you do get a reasonably clean shut down. 
If that won't work, you need to turn the power off, but that, 
normally, doesn't do anything bad (except it will run CHKDSK when you 
come back up -> more later).

As for the "problem", it would seem that there is something wrong with
the file(s) (the print spool is just files, found in the Spool 
directory), and they are not being deleted properly. You should 
consider doing a diskette boot and run CHKDSK on all of your drives 
(especially the one that contains the print spool -> usually your boot
drive). CHKDSK will not be able to correct any errors on any disk that
has any file open (which is always the case, at least on the boot 
drive).

There are a couple of ways to create a set of boot diskettes. One is 
to use the System Setup-> Create Utility Diskettes thing (which, 
probably, won't work, if you select to update files from the system 
(Use Files from hard disk if they exist, on the second screen), which 
is recommended, because the fix packs have supplied driver files that 
are considerably larger than the original files, and they won't fit on
the diskettes. There are a few things that you can do to get around 
the problem, but it is a lot of work. A second (recommended) approach,
is to get a utility called BOOTOS2 (look for BOOTOS2.ZIP, or 
BTOS2920.ZIP, at HOBBES), which will work (most of the time, but may 
still have the problem where the files are too big to fit). BOOTOS2, 
does give you some instructions, and a couple of other options, to get
around the problem.

OK, now that you have a set of boot diskettes, you need to boot from 
them (nothing fancy here), and then you need to run CHKDSK on all of 
the partitions. For FAT formatted partitions, use "CHKDSK /F" (no 
quotes, all on one line). For HPFS partitions, use "CHKDSK /F:2". If 
you get something fixed, run it again (as many times as it requires), 
until it runs clean (shouldn't be more than about 3 passes, but 
sometimes there is something that it won't fix).

Another way to get CHKDSK to run, is to just power the machine off ( 
close all of the programs, and don't do a shutdown). CHKDSK will run 
(assuming you have the Autocheck thing set up properly in CONFIG.SYS->
go to a command line, and type HELP HPFS.IFS, for HPFS partitions, and
HELP DISKCACHE, for FAT partitions<- ).

This may, or may not, fix something, but it is definitely something 
that should be done, if OS/2 does start to act in an unusual way.

..snip...
> I need to either prevent this situation from happening, or I need a
> more graceful way of stopping it when it happens because I can't always
> keep the operators from trashing the system if it doesn't work exactly
> the way their instructions tell them it should.  Better yet, I'd like
> to understand what it's doing, and why it's hanging up like that.

Hopefully, what I have said, above, will fix most of the problems, or 
explain a little about what might be happening...
 
> It might be as simple as "well, you just need to reboot the system more
> often".  But I don't think that's the case.

No. OS/2 seems to run well, for LONG periods of time. On the other 
hand, it may be something like a memory leak that is filling up the 
swap file (and more), or you don't have a large enough swap file, or 
there is insufficient disk space for the swap file to expand. Look 
through the CM2CFG.DAT file, that comes with the ConfigMaint/2 package
(CFGMT100.ZIP, and the latest update, CFGUPD3.ZIP, from HOBBES), it 
should be readable in the OS/2 system editor (just double click on the
file icon). There is some good information in that. Normally, the 
default swapper size is 2048 Kbytes (2 meg), which is not anywhere 
close to what is needed. I have a 64 meg machine, and a 70 meg default
swapper size. Look up SWAPPATH in the ConfigMaint/2 stuff, or do HELP 
SWAPPATH from a command line. You can check the size of your running 
swapper file, by going to x:\OS2\SYSTEM. do DIR SWAPPER.DAT (unless 
you have moved it elsewhere -> be careful to leave this alone, it is 
possible to delete it, or do other bad things, to that file <-). This 
file will expand beyond the default size, and it will shrink again 
down to the default size, if conditions warrant, but it is a good idea
to have a default size that will accommodate at least 95% of the 
maximum that you ever see (105% is better). If nothing else, it 
eliminates a lot of system overhead in managing the expansion, and 
contraction of that file.
 
> Anyway, there's the details, any clues?
> 
> --
> Siobhan Perricone
> PC Technician
> Alltel Information Services
> (I only speak for myself, not for Alltel)
> 
> 
> Sent via Deja.com http://www.deja.com/
> Before you buy.

Hopefully, at least SOME of the answers are in the above...

Perhaps others may know something about PSF/2, and may be able to add 
to this.

Good luck, and feel free to ask more questions...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    13-Oct-99 00:41:26
  To: All                                               13-Oct-99 03:37:02
Subj: Re: Describe 4.0 : How to print ?

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Frank (Frank@get-lost.spam) wrote:
: I have a (shareware) copy of Describe 4.0, but I can't print anything 
: with it.

	You're not running a shareware copy of Describe 4.0, what you are 
running is a workable demo.  I would suggest high-tailing it over to 
comp.os.os2.marketplace or eBay and try and locate Describe 5.  It's 
really cheap, I picked up a copy for $25.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: gjohn@csom.umn.edu                                12-Oct-99 19:53:08
  To: All                                               13-Oct-99 03:37:02
Subj: Re: Wordpro Woes

From: "gjohn" <gjohn@csom.umn.edu>

From personal experience, I would concur with that advice.  Re-installed the
beast, and it worked (for me).  Until then, FP12 was unbearable, with
Wordpro blowing up every time I printed something to my Postscript printer
on LPT1.  Wierd thing, though,.. it always printed perfectly thur the
network to a Deskjet 630cse on my W98 machine (2 machine LAN-- 1warp4 and
1w98 via coax cable)

>I'd say
>you should 1) upgrade to FixPak 12; 2) install the
>newest Device Driver fixpak; and 3) re-install
>WordPro.
>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Minnesota, Twin Cities Campus (1:109/42)

+----------------------------------------------------------------------------+

From: afjbell@onlink.net                                12-Oct-99 21:15:28
  To: All                                               13-Oct-99 03:37:02
Subj: Re: Mesa/2 and layers

From: "Alex Bell" <afjbell@onlink.net>

On 11 Oct 1999 18:50:18 -0400, Richard Bumby wrote:

Snipped

>Before committing yourself to a definite way of using the workbook,
>you should do experiments with toy data.  As long as you are referring
>to a sheet by name, you should be able to move the reference around in
>the index sheet without hurting the reference.  I think I have done
>such things, but I usually check that references have not been broken
>when I make major changes.  
>
Thanks, Richard.  Your advice and Rob's gives me the confidence to
experiment.

Regards, Alex


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ontario Northland--ONLink (1:109/42)

+----------------------------------------------------------------------------+

From: afjbell@onlink.net                                12-Oct-99 21:18:11
  To: All                                               13-Oct-99 03:37:02
Subj: Re: Mesa/2 and layers

From: "Alex Bell" <afjbell@onlink.net>

On Tue, 12 Oct 1999 01:22:44 GMT, Rob Burton wrote:

Snipped

>
>Mesa, as I think I said in my review of it, has all of the power and none of
>the ease of use that we need. At least you can always insert your patient's
>sheet in alphabetical order as you go.
>
Thanks, Rob.  Inserting pages/layers is just what I need.  I had forgotten
about the 'Page Tab popup menu'

Regards, Alex


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ontario Northland--ONLink (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  12-Oct-99 19:21:25
  To: All                                               13-Oct-99 03:37:02
Subj: Re: Squid?

From: Chuck McKinnis <mckinnis@ibm.net>

Where does one find Squid?

Ulv Bjerkan wrote:
> 
> On Mon, 11 Oct 1999 20:30:05, jdc0014@InfoNET.st-johns.nf.ca (John
> Hong) wrote:
> 
> >       Anyone tried Squid yet?  I was just wondering how it performs
> > against SmartCache since Squid is OS/2 native.  The latest release is on
> > Hobbes.  It's a proxy for http in order to provide better web caching.
> 
> No trouble running latest Squid here :-)
> 
> --
> Ulv Bjerkan
> http://home.sol.no/~ulvb/os2dl.html
>  ftp://ftp.sol.no/user/ulvb
> ---------------------------------------

-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  12-Oct-99 19:37:01
  To: All                                               13-Oct-99 03:37:02
Subj: PMPDF

From: Chuck McKinnis <mckinnis@ibm.net>

Has anyone out there got this to work?  The port driver installation
seems to have gone OK.  I have an entry in OS2SYS.INI for PM_PDF that
does not point to the proper directories.  I can't seem to change or get
rid of it.
-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: helle05@ibm.net                                   12-Oct-99 19:17:09
  To: All                                               13-Oct-99 03:37:02
Subj: Re: NS461: Drag 'n Drop/To and Fro

From: "Thomas A. Heller" <helle05@ibm.net>

Well, I've solved the problem (and answered my own
question!):

I was (unbeknownst to me) working with an older
version of N/S 4.61.  I have obtained the new
(9/16/99) copy and the Drag 'n Drop to Folders works
BEAUTIFULLY!

P.S. This was also the obstacle that had prevented
me from successfully installing Java 1.1.8


"Thomas A. Heller" wrote:
> 
> "Jeffrey S. Kobal" wrote:
> > > > You can drag any link or image to any folder.
> > >
> > > Unless the folder is set in Details mode, unfortunately.
> >
> > Already been fixed for a future fixpack.
> >
> > > > Then it's broken on your machine, for some
> > > > reason.  Make sure NS46DRAG.DLL exists in
> > > > your Netscape\Program directory, and that it
> > > > has a 9/16 date.
> 
> My NS46DRAG.DLL shows a date of 08-12-99(!) -- as do
> *all* the .DLL files in this directory beginning
> with "NS"
> 
> Does this indicate I got a "not ready for
> prime-time" download of 461 on Sept 24th?  Should I
> grab another Netscape 4.61 download?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: webmaster@aawc.com                                12-Oct-99 21:21:08
  To: All                                               13-Oct-99 03:37:03
Subj: How to export email from PMMail

From: William Richard Jones <webmaster@aawc.com>

 I need to import my mail messages from PMMail mail. Does anybody know
of an utility that
will convert PMMail mail messages into a form that is usable by another
major email
product (i.e., OutLook, Eudora, pegasus, etc)?  Due to business reasons
and
performance issues with PMMail, I need to move several thousand
messages.  I need to
move my messages to an email product that is upgradeable. I expect high
email volume
in the near future; consequently, would like have all my emails in one
email application.

Any advice or suggestions will be humbly appreciated.

Regards,

William

(William R. Jones)
webmaster@aawc.com

====================================
>From: "PMMail Windows Support" <pmmailwin@southsoft.com>
>To: "webmaster@aawc.com" <webmaster@aawc.com>
>Date: Tue, 05 Oct 1999 12:13:12 -0400
>Subject: Re: How to export emails from PMMail 98 v2?
>
>| haven't been asked this one before, so I am searching.  But I am
having
>no luck in finding converting PMMail to Outlook, or anything for that
matter.
>I am thinking maybe a switch to another mailer, and then a conversion
from
>it to Outlook, but I can't find any 'mediary' conversion.
>
>I am not certain, but I believe that Netscape stores its messages as
.MSG
>files as well.  Maybe convert PMMail to Netscape somehow, and then it
>should be easy to find a utility for Netscape to Outlook.
>

This is not correct.

>I'll keep on the lookout and let you know.
>
>
>jimmy
>
>Jimmy McCorquodale, Jr.
>
>PMMail 2000 2.10.0434 Pro
>
>homepage:  http://www.southsoft.com
>email:           pmmailwin@southsoft.com
>ICQ:             45476579
>
======================================

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Concentric Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    13-Oct-99 04:33:05
  To: All                                               13-Oct-99 03:37:03
Subj: Re: Squid?

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Chuck McKinnis (mckinnis@ibm.net) wrote:
: Where does one find Squid?

	Hobbes.  There are two entries for Squid, the latest is 2.2 
STABLE 4 release.  It's a unix port and requires EMX runtimes to be 
installed.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: dink@dont.spam.me                                 13-Oct-99 01:37:01
  To: All                                               13-Oct-99 03:37:03
Subj: Re: cdwriter support

From: "dinkmeister" <dink@dont.spam.me>

On 12 Oct 1999 13:33:58 GMT, Pierre Jelenc wrote:

:dinkmeister <dink@dont.spam.me> writes:
:> 
:> put cdrecord.exe/mkisofs.exe and readcd.exe in your path
:> and try again..
:
:cdrecord.exe/mkisofs.exe were already on the path. I added readcd.exe but
:it makes no difference:
:
:Cdrecord release 1.8a24 Copyright (C) 1995-1999 Jrg Schilling
:TOC Type: 0 = CD-DA
:scsidev: '3'
:devname: '3'
:scsibus: -2 target: -2 lun: -2
:D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe: No such file or directory.
:Cannot open SCSI driver.
:
:What "SCSI driver" is it looking for?

Did you install the aspi router and os2aspi.dmd /all
that's mentioned in the CDRecord/2 dox and on the
website?


- dink ( http://dink.org )




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       13-Oct-99 06:10:00
  To: All                                               13-Oct-99 03:37:03
Subj: Re: Process Commander and WSFeB

From: Will Rose <cwr@cts.com>

Kim Haverblad <kim@haverblad.com> wrote:
: I don't know if mentioned subject has been posted already. Guess I then
: missed it. But sent an e-mail to Stardock System asking if there is any fix
: or update to get PC to work on WSFeB. Well here is the answer:

:>Hello Kim,
:>PC was written for warp 4, and does not work with WSFeB.
:>Best Regards,
:>Ian Hanschen
:>Stardock Systems

: Well, I'm going to miss PC on my WSFeB installation. It's a piece of great
: software. Anyone that have a idea of workaround or something?

Actually PC doesn't work on Warp 3.0 FP 40, or Warp 4.0 FP 12 either.
It might be the same problem as with WSFeB, or not - the 3.0/4.0 problems
are with the installer, not PC itself.  What does the problem on WSeB
look like?  Does the installer run/does it give any warning messages?


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: helle05@ibm.net                                   12-Oct-99 23:17:20
  To: All                                               13-Oct-99 06:16:02
Subj: Candidates for fix in NS 461

From: "Thomas A. Heller" <helle05@ibm.net>

Now that I've got the right version in place (and
the drag 'n drop of URL's to folders finally works),
I've uncovered a couple of glitches with Comm 461:

1. Crashes (w/ 3175 error) if I cancel out of
sending a reply to a newsgroup;

2. I broke the "Edit Bookmarks" feature (and also
the "More Bookmarks" function) after an attempt to
manually edit the Bookmark.HTML.  Spotted some
messaage re: Netscape is reloading the bookmarks,
but I think I was closing the bookmark window at the
moment and thus a conflict undoubtedly arose.  Now I
just get some "ghost-like" vertical lines floating
across the screen after I trigger either function. 
(This behavior mysteriously remains even after a
delete/reinstall as well as a fresh install!)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: Super_Copy@yahoo.com                              13-Oct-99 08:57:05
  To: All                                               13-Oct-99 10:22:20
Subj: Shareware: Super Copy for DOS v1.00

From: Super_Copy@yahoo.com (Super Copy)

The shareware application described below is now available for download at
        http://www.winsite.com/info/pc/win3/util/scdos100.zip/
        ftp://ftp.simtel.net/pub/simtelnet/msdos/fileutil/scdos100.zip
and all mirrors thereof. For more download sites, please search for the
string "scdos100" at any major web search engine.
The shareware version is fully-functional, with no "nagging" displays or
prompts whatsoever. A MUST-HAVE for anyone who uses removable media in
his/her PC!
Commercial versions for Win32 and OS/2 are available! See "readme.txt"
for details.
===============================================================================
=
Description

"Super Copy" is a command-line utility for copying and backing up files. It is
meant to replace the functionality of the "copy" and "xcopy" commands
provided by DOS and other more advanced operating systems. Furthermore
"Super Copy" provides the special capability to selectively copy files
from one removable disk (or any comparable medium) to another even if you
only have a single disk drive to operate such media. We call this feature
"one-drive selective copy".

Advantages

"Super Copy" has the following functional advantages over competing utilities:

1) Optimized memory usage: can use all available memory under DOS.
Runs in 80386 protected mode, taking advantage of the greater memory
capabilities of modern CPUs. "Super Copy" is capable of addressing up
to 4 GigaBytes of memory, subject to the limitations of the operating system.

2) OS compatibility: runs in compatibility modem under Windows (3.1,
4.0 "Windows 95", 4.1 "Windows 98"), Windows NT and OS/2.
"Super Copy" can even use virtual memory under these operating systems.

3) Conveniently copy files or entire directory structures between removable
disks with a minimum amount of disk swapping. You will not be bothered
by a myriad of prompts asking you:
        "Please insert source disk"
        "Please insert destination disk"
over and over. You will not have to copy an entire disk when all you
want to do is copy one or two files from one disk to another.

4) A simple command-line syntax, similar to the "xcopy.exe" command. If
you already know how to use "xcopy", learning to use "Super Copy"should be
almost instantaneous. Another advantage of a similar syntax is that you
can call "Super Copy" from within your existing batch files with aminimal
amount of modifications.

5) Tested for compatibility with storage products from majormanufacturers:
        "Zip drive" from IOMega Corp.
        "SyJet" from SyQuest Corp.
just to name a few.
This utility relies on the operating system to support various connections
and transport protocols for storage devices, and therefore is compatible with
        IDE (EIDE, ATA, UDMA)
        SCSI (Fast-SCSI, Ultra-SCSI, Wide-SCSI)
and more.

6) Y2K compliant. "Super Copy" will discern and compare properly file
dates at 1 January 2000 and beyond.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          13-Oct-99 09:46:16
  To: All                                               13-Oct-99 10:22:20
Subj: Re: Describe: A Blast from the Past

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Tue, 12 Oct 1999 13:36:51, "Esko Kauppinen" <esko.kauppinen@ibm.net> a 
crit dans un message:

> 
> >>A good reason to download and try (and register after you've seen how 
> >>powerful and nifty it is) the MED (formerly "Mister ED") programmer's text 

> >>editor demo, which also has an editable toolbar and comes with some 24x24 
> >>buttons that work just fine with DeScribe. The URL is:
> >>
> >>	http://www.utopia-planitia.de/
> >
> >Hey, I didn't know that and I am a registered user of MED! I'll check those
> >buttons right away.
> 
> Aargh..same problem with those bmp's. Grey color turns into dark magenta,
> black is black, white is white but all other colors are wrong.

Then you should be looking to your display adapter settings, I think. 
What's your screen resolution/color depth set to, in OS/2 of course? Try 
setting a different screen res and see if that particular problem still 
exists.

Do you have "Video Palette Snoop" active in your CMOS BIOS settings? 
Sometimes that can be a factor, and is worth toggling both ways to test.

And we're assuming you don't have a "video memory starved" display adapter.

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          13-Oct-99 10:06:04
  To: All                                               13-Oct-99 10:22:20
Subj: Re: Describe: A Blast from the Past

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Tue, 12 Oct 1999 16:39:00, letoured@nospam.net a crit dans un message:

snapt
> 
> I looked over Describe once around version 2 or something, and spent a lot
> of time on the phone with their developers.

It was nice dealing with them, because they were very generous on the 
phone.


> It was a single user-type
> program that didn't do anything that made it a real stand out. It didn't
> have the long document capabilities of the old Lotus Manuscript,

I never used "old Lotus Manuscript" but can testify that DeScribe manages 
very long documents quite nicely. Both editing, and printing. I've printed 
output that took a full ream of printer paper, 500 sheets, and once I got 
my OS/2 printmonbuf and spooler settings ready to handle this kind of job, 
it went down without a hitch. 

The "Draft Document" functions in DeScribe come in very handy when you get 
this big, and it also has a "master document" function that can break docs 
down into chunks (chapters?) for easier editing, but still concatenate 
things properly for a master printout.


> and it
> didn't have the DTP capabilities of FrameMaker, 

It has a *lot* of the DTP capabilities of FrameMaker and PageMaker, which 
is one of the most attractive things about this "word processor." In fact, 
after finally getting to run Aldus PageMaker 3.01 for OS/2, dating from 
1990, I see that PM did not have one very nifty professional typesetting 
feature that DeScribe has, font width "tracking" which puts a little 
squeeze on your type, automatically and transparently.


>and it pretty much flopped making WordPerfect files that you could take to
another machine and run in WP -- which was the standard at the time for 
word processor. 

I came over to OS/2 and DeScribe at the same time, and had a ton of 
projects in progress in WP format. DeScribe brought everything "in" but I 
can't say I ever had to take anything back out. Other people have reported 
that the WP output formats work very well for export. (If you can find 
anybody who wants them.)

DeScribe 5 is worth another look. It is constantly available on the resale 
market, and despite being abandoned by its makers has enough unique power 
to be considered a "standard" for OS/2 users, at least. 

(The *ONLY* knock I've seen against it that stands up in my view, is the 
inability to print colored type in text frames. It prints colored graphic 
frames just fine, and you can use DeScribe to create graphic frames that 
contain colored text for headlines and callouts and captions and such, but 
if you want to set large amounts of text in color this ain't the program 
for you. I consider that a feature, not a bug.)


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          13-Oct-99 10:12:07
  To: All                                               13-Oct-99 10:22:20
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Tue, 12 Oct 1999 16:26:13, Siobhan Perricone <morgannalefey@my-deja.com>
a crit dans un message:

> In article <Z8vLRdP7nz3N-pn2-
> 3tEEd7gjCG31@sphericalburn.tampabay.rr.com>,
>   donnelly@tampabay.rr.com (Buddy Donnelly) wrote:
> 
> > On Tue, 12 ... Siobhan Perricone <morgannalefey@my-deja.com>
>                                     ^^^^^^^^^^^^^^^^^^^^^^^^^
> 
> > I'm just a nosy bystander but I can't identify an address I'd send a
> file
> > to, either.
> 
> Yet your software quotes it.  It's morgannalefey@my-deja.com.  That's
> an actual e-mail address that people can reply-to.  It's set as that in
> the reply-to field in the post header.  Don't mean to sound snippy,
> I've just never had anyone complain about this before, and I've had
> many people respond to me privately about things I've posted with this
> address.  I've even had people send me files there.

I did see the "my-deja.com" address and assumed that was still a "freemail"
address. I don't mean to sound snippy but I try to use a prefetch filter in
MR2 for all freemail domains here, since that's where much of the spam 
seems to originate. As well as crackpot mail.

Also the "morgannalefey" part made it look like a phony address, an 
anti-spam trick.

Didn't mean to give offense, of course.

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            13-Oct-99 10:42:21
  To: All                                               13-Oct-99 10:22:20
Subj: Re: Candidates for fix in NS 461

From: mike.luther@ziplog.com

In <3803F9D5.10E038FC@ibm.net>, "Thomas A. Heller" <helle05@ibm.net> writes:


>Now that I've got the right version in place (and
>the drag 'n drop of URL's to folders finally works),
>I've uncovered a couple of glitches with Comm 461:


>2. I broke the "Edit Bookmarks" feature (and also
>the "More Bookmarks" function) after an attempt to
>manually edit the Bookmark.HTML.  Spotted some
>messaage re: Netscape is reloading the bookmarks,
>but I think I was closing the bookmark window at the
>moment and thus a conflict undoubtedly arose.  Now I
>just get some "ghost-like" vertical lines floating
>across the screen after I trigger either function. 
>(This behavior mysteriously remains even after a
>delete/reinstall as well as a fresh install!)

Interesting, in that this version is the first version that will close
without a SYS3175, for me, after the bookmarks file is open, and you
don't close the expanded bookmark file before you close NS!

I never tried to edit the bookmark file manually. It may have gotten
grunged in some earlier problem, though, to cause this...

Shot in the dark time..

I wonder if your editor happens to use EOF marks at the end of the file?
Some editors, like old Wordstar, which I use heavily in the non-document
mode in a DOS-VDM, fill the entire end of the file from the end of the
data to the closest 512 byte file block, with CHR$(12) EOF characters!
I have discovered that some OS/2 control files which can be edited with
a text editor, do not like these EOF marks.

It used to be, a long time ago, the even the CONFIG.SYS file would break
things, if it had EOF's at the end of it, but that got fixed, as far as
I can tell.

Accordingly, if I do edit an OS/2 control file, such as CONFIG.SYS or
the LAN control file, or so on, I always run a utility called STRIP_Z to
remove all the CHR$(12)'s in the file!

Or, for example, editors like Wordstar, if you accidentally use the
document mode on a file such as the bookmark file, can toss in all kinds
of low order and high bit characters into the file.  I can vizualize
rather easily, how that could grunge a file such as the bookmark file.

--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          13-Oct-99 10:16:12
  To: All                                               13-Oct-99 10:22:20
Subj: Re: Process Commander and WSFeB

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Tue, 12 Oct 1999 18:16:27, "Kim Haverblad" <kim@haverblad.com> a crit 
dans un message:

> I don't know if mentioned subject has been posted already. Guess I then
> missed it. But sent an e-mail to Stardock System asking if there is any fix
> or update to get PC to work on WSFeB. Well here is the answer:
> 
> >Hello Kim,
> >PC was written for warp 4, and does not work with WSFeB.
> >Best Regards,
> >Ian Hanschen
> >Stardock Systems
> 
> Well, I'm going to miss PC on my WSFeB installation. It's a piece of great
> software. Anyone that have a idea of workaround or something?

Yup, the best workaround of them all, like not needing it. WSeB runs 
extremely solidly here.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: upatoyou@ibmmail.com                              13-Oct-99 21:36:15
  To: All                                               13-Oct-99 10:22:20
Subj: Galleria Image processing software for OS/2

From: "DeutschMick" <upatoyou@ibmmail.com>

Hi,

Does anyone know whether Bitware (producers of
Galleria Image processing software for OS/2 are
still alive and kicking?

Has anyone seen a version later than mid 1996?

Thanks for the time . . Mick Deutsch
      /                                       R  e  g  a  r  d  s  :
    /    -  __0      Mick Deutsch, Project Audio, Canberra, AUSTRALIA.
[@\      _  \<,_       m$tsch@pcug.org.zzz, zzzhic$@ibmmail.com 
[@/     (_) / (_)   searching for great sound!    NO DAVE!    I am not
    \                      Wind95/NT compatible, this is the 21st century!
     \

humans:  to reply, please replace the z's with au,
         and the currency symbol with deu - thanks.
          
Created and sent using OS/2, the most advanced PC OS
availabel in the last years of the 20th century.

Who wants to use Neanderthal Tinkering (tm) Operating System.

visit http://www.aberdeen.com/secure/onsite/case1/body.htm
to see for yourself.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            13-Oct-99 14:12:11
  To: All                                               13-Oct-99 14:36:18
Subj: Re: Describe: A Blast from the Past

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Wed, 13 Oct 1999 09:46:32 GMT, Buddy Donnelly wrote:

>On Tue, 12 Oct 1999 13:36:51, "Esko Kauppinen" <esko.kauppinen@ibm.net> a 
> crit dans un message:
>
>> 
>> >>A good reason to download and try (and register after you've seen how 
>> >>powerful and nifty it is) the MED (formerly "Mister ED") programmer's
text 
>> >>editor demo, which also has an editable toolbar and comes with some 24x24 

>> >>buttons that work just fine with DeScribe. The URL is:
>> >>
>> >>	http://www.utopia-planitia.de/
>> >
>> >Hey, I didn't know that and I am a registered user of MED! I'll check
those
>> >buttons right away.
>> 
>> Aargh..same problem with those bmp's. Grey color turns into dark magenta,
>> black is black, white is white but all other colors are wrong.
>
>Then you should be looking to your display adapter settings, I think. 
>What's your screen resolution/color depth set to, in OS/2 of course? Try 
>setting a different screen res and see if that particular problem still 
>exists.
>
>Do you have "Video Palette Snoop" active in your CMOS BIOS settings? 
>Sometimes that can be a factor, and is worth toggling both ways to test.
>
>And we're assuming you don't have a "video memory starved" display adapter.

I'm using a laptop at the moment and the screen is 12,1" 800x600 65K.
Cirrus Logic GD7543 display adapter, 1 Meg.

If these bitmaps work in your computer then I indeed seem to have some
problems but it still doesn't explain why the original bitmaps are OK.

The originals seem to be some odd format of bmp. They are all of size
976 bytes which is twice as much as the MED bitmaps.
If I open an original bitmap with PMVIEW and then save it again as a
OS2-bitmap, the size drops to almost a third ( and colors are 
corrupted when placed to Describe toolbar).

Well, this is no big problem. I can easily live with the original icons.

Esko



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         13-Oct-99 12:19:02
  To: All                                               13-Oct-99 14:36:18
Subj: another OT about e-mail addresses

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <Z8vLRdP7nz3N-pn2-
rxSyUOTVov5F@sphericalburn.tampabay.rr.com>,
  donnelly@tampabay.rr.com (Buddy Donnelly) wrote:

> I did see the "my-deja.com" address and assumed that was still
> a "freemail" address. I don't mean to sound snippy but I try to
> use a prefetch filter in MR2 for all freemail domains here, since
> that's where much of the spam seems to originate. As well as
> crackpot mail.

Fair enough.  I don't blame you. :)

> Also the "morgannalefey" part made it look like a phony address, an
> anti-spam trick.
>
> Didn't mean to give offense, of course.

*sigh*  It's finally come.  The day when having an imagination and
being well-read and interested in legend, myth, and lore looks like a
trick, rather than being thought of as clever. ;D

As I've noted to someone else, I don't have an Alltel address because
of some idiotic policy about not giving temp workers addresses (temp
because of a takeover of the company we have a contract with and they
don't know if the contract will be continued, but if it is, I'll be
made permanent).  Also, they don't have any news server access here.
But I had to access these newsgroups fast, so I got an account with my-
deja.com. ;)  The choice of Morgannalefey is a tweak on the nose of
corporate culture, rather than an anti-spam measure.  I may have to
work in a cubicle, but I don't have to think in one. :)  I get a big
kick out of telling my coworkers they can e-mail it to me at
morgannalefey@my-deja.com. ;D

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: brianc@pcisys.net.takemeoff                       13-Oct-99 07:02:23
  To: All                                               13-Oct-99 14:36:18
Subj: thumbnail maker?

From: "Brian Christie" <brianc@pcisys.net.takemeoff>

Does anyone know of a good graphics program to create thumbnails for use on a
web page?  The problem I have is that I want to catalogue pictures and I
normally use PMView, but I want to store all the pics off-line on CDs which
don't support eas.  This makes PMView's thumbnails useless.  I was thinking
if I could just find an app to make thumbnails easily from the pics, then I'd
just make an html index for the CD.

Thanks
Brian



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: Markus.Quandt@gmx.net                             13-Oct-99 15:43:18
  To: All                                               13-Oct-99 14:36:18
Subj: Re: PMPDF

From: Markus Quandt <Markus.Quandt@gmx.net>

Yes, it works here. Are you aware that the FTP site has a version dated
10/12/1999, which replaces the one from 10/10/1999, with a short
reference to "installation problems"? (Note that I didn't have such a
problem even with the 10/10/99 version).

Didn't using the properties menu allow you to enter the paths, as
described in the readme? That would be the usual way to adapt the
settings :-).

Best, MQ

Chuck McKinnis schrieb:
> 
> Has anyone out there got this to work?  The port driver installation
> seems to have gone OK.  I have an entry in OS2SYS.INI for PM_PDF that
> does not point to the proper directories.  I can't seem to change or get
> rid of it.
> --
> Chuck McKinnis
> Senior Systems Engineer
> Denver Solutions Group, Inc.
> IBM Business Partner
> IBM Senior Systems Engineer (retired)

-- 
__________________________________________________________________
Markus Quandt     quandt@wiso.uni-koeln.de | Markus.Quandt@gmx.net
  Institut f. Angewandte Sozialforschung der Universitaet zu Koeln
  Greinstr. 2     50939 Koeln
  Tel. +49-221/470-4232                      Fax. +49-221/470-5169
  Find my PGP public key and other information here:
http://www.uni-koeln.de/wiso-fak/ifas/html/personal/homepage/quandt-markus/inde
x.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universitaet zu Koeln (1:109/42)

+----------------------------------------------------------------------------+

From: dan@_nospam_kulp.com                              13-Oct-99 09:51:00
  To: All                                               13-Oct-99 14:36:18
Subj: Re: Mesa/2 and layers

From: "J. Daniel Kulp" <dan@_nospam_kulp.com>

On Tue, 12 Oct 1999 01:22:44 GMT, Rob Burton wrote:
>There's no difference between a "page" and a "layer". It's just sloppy
>terminology. You Add or Insert a "Layer" and you Delete a "Page". Go on, try
>it now with a dummy workbook. Put a label in Cell A1 of each of 3 sheets and
>start Adding and Inserting and Deleting. See? The difference between "Add"
>and "Insert" is that "Add" puts another "Page/Layer" at the end of the sheets
>and "Insert" puts one before the current sheet.

Actually, there IS a difference between a page and a layer.  A layer in
Mesa 2 is always referring to a layer of cells.  A page, however, can
refer to any page of the workbook which at this point only include
layers and scripts but may be expanded to include other things like
queries, etc... in the future.    The "Add/Insert Layer" commands add a
"Layer" page.  The "Add Script" command adds a script page.  However,
the "Delete Page" command can delete both Layers and Script pages.

Enjoy!

J. Daniel Kulp                                  dan@kulp.com
Sundial Systems Corporation    http://www.sundialsystems.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: ralbers@dccnet.com                                13-Oct-99 13:56:14
  To: All                                               13-Oct-99 14:36:18
Subj: Re: Process Commander and WSFeB

From: ralbers@dccnet.com

When Aurora when Gold, I changed my beta to the Gold version, and then
after everything was nicely configured and all apps installed, thought
it would be great to install PC, but had this 'gut' feeling, so I 
emailed Stardock, which they replied it did work on their beta of 
Aurora.

I installed PC, rebooted - That sickly feeling was becoming more and 
more painful as the boot tried to continue - quickly tried to recover 
by using one of the previous saved archives, but in the end I had to 
reformat the entire hard drive and start from scratch.  It appeared 
that PC had corrupted the LVM and needless to say ALL partitions, even
my data partition (did I mention how important a backup is?!)

I really liked PC on my warp4 system, and now really miss it, even 
though Aurora is rock solid, there are some erratic programs that just
hang the SIQ, and PC works (worked) great for the SIQ work around.  

After talking to Stardock about my mishap, they DO NOT have any plans 
to update PC to work with WSeB - Now that was a very SAD DAY!!

On Tue, 12 Oct 1999 18:16:27, "Kim Haverblad" <kim@haverblad.com> 
wrote:

> I don't know if mentioned subject has been posted already. Guess I then
> missed it. But sent an e-mail to Stardock System asking if there is any fix
> or update to get PC to work on WSFeB. Well here is the answer:
> 
> >Hello Kim,
> >PC was written for warp 4, and does not work with WSFeB.
> >Best Regards,
> >Ian Hanschen
> >Stardock Systems
> 
> Well, I'm going to miss PC on my WSFeB installation. It's a piece of great
> software. Anyone that have a idea of workaround or something?
> 
> //Kim
> 
> 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: ralbers@dccnet.com                                13-Oct-99 14:00:14
  To: All                                               13-Oct-99 14:36:18
Subj: Re: Mesa/2 and layers

From: ralbers@dccnet.com

Wouldn't your needs be met better with DBExpert or another database 
rather than something as static as a spreadsheet?  Would be happy to 
give you a hand in designing a database for this problem.

On Mon, 11 Oct 1999 22:50:18, bumby@lagrange.rutgers.edu (Richard 
Bumby) wrote:

> "Alex Bell" <afjbell@onlink.net> writes:
> 
> >...
> 
> >One of the current spreadsheets (an 'overall' spreadsheet) contains some
data
> >about all patients, including date of birth and their admission and
> >discharge dates for their last admission....
> >                      ....  The consolidated spreadsheet I am
> >trying to design would have the 'overall' spreadsheet as its first
> >layer, with other layers one for each patient.
> 
> >The first question is :What is the difference between a page and a
> >layer?  Is a page a layer which is used for scripts?  or is there some
> >other difference?  Or are these terms synonyms?
> 
> >Secondly, can one order layers?  ...
> 
> >Similarly, if I change the order of the rows on the first 'overall'
> >layer will the references to and from the individual layers be
> >retained?  
> 
> You can certainly add new layers for individual patients.  There may
> be a limit.  Layers are still treated like additional sheets bound
> into a workbook, rather than a true third dimension, so they are more
> awkward to use.  References between pages also behave more like DDE
> links than references within a single sheet.
> 
> Mesa2 separates scripts from worksheets; whichever type of page you
> want, you ask for.  The scripts are always at the end of the workbook.
> 
> The only way I have been able to rearrange worksheets has been to copy
> the old one to a new location.  This sounds painful for the
> application you have in mind.
> 
> Before committing yourself to a definite way of using the workbook,
> you should do experiments with toy data.  As long as you are referring
> to a sheet by name, you should be able to move the reference around in
> the index sheet without hurting the reference.  I think I have done
> such things, but I usually check that references have not been broken
> when I make major changes.  
> 
> It might be better to have the sheets appear in the order in which
> they are created, but maintain an alphabetical index on the cover sheet.
> 
> -- 
> R. T. Bumby **  Rutgers Math || Amer. Math. Monthly Problems Editor
1992--1996
> bumby@math.rutgers.edu       ||   
> Telephone:    [USA] 732-445-0277 (full-time message line) FAX 732-445-5530


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: heloman@my-deja.com                               13-Oct-99 14:42:17
  To: All                                               13-Oct-99 14:36:18
Subj: NS4.61

From: heloman@my-deja.com

When I access DeJanews and proceed to a particular forum all of
the msgs are listed. Once a particular msg(s) are selected and
clicked on those msgs appear. To return back to the listing for
that forum (clicking on forum) the cursor returns to the TOP of
the list. If I am in the middle of the list the cursor still
wants to reposition itself at the top causing one to scroll back
down to the last position. I have looked at the update hints in
HELP but did not see any switch/option to select to allow the
cursor to return to the place where it was before going to that
particular group of msgs. IS there something I am missing or a
way to accomplish this? Otherwise I am having no problems at
all. I await any and all responses...Thanks in advance....


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: bigfig@inorbit.com                                13-Oct-99 15:12:16
  To: All                                               13-Oct-99 14:36:18
Subj: Strange hang up and how I can figure out why

From: bigfig@inorbit.com (Gary Crossno)

In message <7tvb5k$lu2$1@nnrp1.deja.com> - Siobhan Perricone
<morgannalefey@my-deja.com>Tue, 12 Oct 1999 12:56:26 GMT
writes:
Why not just go to system properties/confirmations and
unflag the confirm delete box

Gary Crossno

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: ysme@sympatico.ca                                 13-Oct-99 15:59:25
  To: All                                               13-Oct-99 14:36:18
Subj: Re: AOL under winos2

From: ysme@sympatico.ca

In <19991012003749.16294.00000496@ng-fb1.aol.com>, dstg0001@aol.com (Dstg0001) 
writes:
>Is there any version of the 16-bit AOL software that runs in Warp 4 under
>WinOS2?
Ver 3 I beleive.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: HARNESS the ABILITY dial up BBS 1-416-604-1221 (1:109/42)

+----------------------------------------------------------------------------+

From: danielh@crosslink.net                             13-Oct-99 11:55:06
  To: All                                               13-Oct-99 14:36:18
Subj: Re: thumbnail maker?

From: danielh@crosslink.net

>Does anyone know of a good graphics program to create thumbnails for use
>on a web page?  The problem I have is that I want to catalogue pictures
>and I normally use PMView, but I want to store all the pics off-line on
>CDs which don't support eas.  This makes PMView's thumbnails useless.  I
>was thinking if I could just find an app to make thumbnails easily from
>the pics, then I'd just make an html index for the CD.

It's not real elegant, but the WWWThumb utility will do this (and it's free):

    WWWthumb creates, and delivers, thumbnails of images. 

    When offering a list of files for downloading over the WWW, it's often 
    convenient to graphically illustrate the contents of the file by
displaying 
    a thumbnail (a small GIF image) adjacent to the file name. For example,  
    thumbnails are often minatures of larger graphics files; or, they can also 

   be the desktop icon associated with a non-graphics file. 

It can be found at  http://www.srehttp.org/apps/wwwthumb/
      WWWthumb (which is written in REXX) can be run fom an OS/2 command 
     prompt, as an addon for the SRE-http web server,  or as a  script under
any 
     CGI-BIN compliant OS/2 web

Note that WWWThumb is specially designed to work with  PMView's "create a
thumbnail in the
extended attributes" option.




-- 
-----------------------------------------------------------
danielh@crosslink.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CrossLink Internet Services 1-888-4-CROSSLINK (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                13-Oct-99 12:06:10
  To: All                                               13-Oct-99 14:36:18
Subj: Re: Candidates for fix in NS 461

From: lifedata@xxvol.com

"Thomas A. Heller" <helle05@ibm.net> said:
>2. I broke the "Edit Bookmarks" feature (and also
>the "More Bookmarks" function) after an attempt to
>manually edit the Bookmark.HTML.

I'm curious why you would want to edit bookmarks manually.  I find it much
easier in the Netscape bookmark edit feature.  Isn't there a warning somewhere
against editing it?

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: ysme@sympatico.ca                                 13-Oct-99 16:20:21
  To: All                                               13-Oct-99 14:36:18
Subj: Re: Backing up and Restoring with Back Again/2

From: ysme@sympatico.ca

In <37fe2347.21516689@news.omen.net.au>, zayne@omen.com.au (Mooo) writes:
>Alan Beagley <abeagley@datatone.com> wrote:
>
>>I have found that I m getting a slew of "CRC mismatch" error messages when I 
try to verify backups
>>that were made using BA/2 Pro ver. 4.0i with the tape drive connected to my
on-board Adaptec SCSI
>
>This is the error that started around FP26 (was it 26?) for Warp3 and
>was never corrected.  
>
>Craig

Their was a Backup & Restore bug in MS DOS 3.*, that carried over to Ver 4, 5, 
6, and OS/2.

I 1st found it, and retested for it when I was moved to DOS 3.3 in 1988, and
reported it directly to the Head of 
Development of DB2, and OS/2 (same person as I recall) .  I was told it was a
carry over code from MS, and that 
it had to be changed by MS, and that MS has been told about it.  

At an IBM OS/2 training centre in 1990 and again in 1991, I again found the
same three bugs.  IBM canada reps
 came to the training centre the 2nd dsay, and US IBM reps the 3rd or 4th day, 
to see me duplicate the bug.

As I recall, I remembered to test Warp 3, and found one or more BU/Restore
bugs still their.  I never tested 
Warp 4, but I imagine its still their.  I keep quite about it, as it could be
used to cause problems for others.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: HARNESS the ABILITY dial up BBS 1-416-604-1221 (1:109/42)

+----------------------------------------------------------------------------+

From: ysme@sympatico.ca                                 13-Oct-99 16:58:12
  To: All                                               13-Oct-99 16:43:24
Subj: Re: Candidates for fix in NS 461

From: ysme@sympatico.ca

In <3803F9D5.10E038FC@ibm.net>, "Thomas A. Heller" <helle05@ibm.net> writes:
>Now that I've got the right version in place (and
>the drag 'n drop of URL's to folders finally works),
>I've uncovered a couple of glitches with Comm 461:
>
>1. Crashes (w/ 3175 error) if I cancel out of
>sending a reply to a newsgroup;
>
>2. I broke the "Edit Bookmarks" feature (and also
>the "More Bookmarks" function) after an attempt to
>manually edit the Bookmark.HTML.  Spotted some
>messaage re: Netscape is reloading the bookmarks,
>but I think I was closing the bookmark window at the
>moment and thus a conflict undoubtedly arose.  Now I
>just get some "ghost-like" vertical lines floating
>across the screen after I trigger either function. 
>(This behavior mysteriously remains even after a
>delete/reinstall as well as a fresh install!)
>
I attempted to edit and upload my Home page to Sympatico, and to Netscaep, and 
seemed to have broken my copy, 
so it now can't find either Home sites.  Being new to NS and the WWW, I
thought it was just me, and a 
reinstall, a un install, and a reinstall would fix things.  Well, thus far, I
still can't make it find either home
site, etc.   

Reinstallation on a new C: drive works just fine.  XCopying it over to the old
 E: drive, didn't fix anything.

I did edit preferenced to show paths as E: and not C: as the default.

Still can not find either Home page, or usenet.  e-Mail works just fine.



Any sugestions would be appreciated.


Thanks,  Jim

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: HARNESS the ABILITY dial up BBS 1-416-604-1221 (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         13-Oct-99 17:21:10
  To: All                                               13-Oct-99 16:43:24
Subj: Re: Strange hang up and how I can figure out why

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <s098b016bhk67@corp.supernews.com>,
  bigfig@inorbit.com wrote:
> In message <7tvb5k$lu2$1@nnrp1.deja.com> - Siobhan Perricone
> <morgannalefey@my-deja.com>Tue, 12 Oct 1999 12:56:26 GMT
> writes:

> Why not just go to system properties/confirmations and
> unflag the confirm delete box

Because I don't want the operators to be able to delete anything
without it being confirmed first.  That sets a dangerous precedent.
I'd rather have a fix than a kludge.  It *should* work *correctly*. :D

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: jensja@rz.fh-augsburg.de                          13-Oct-99 19:38:01
  To: All                                               13-Oct-99 16:43:24
Subj: Re: Database for webpage?

From: Jens Schiffler <jensja@rz.fh-augsburg.de>

Hi Jan,

Jan Eri wrote:
> 
> I have a dBase database that I would like to present on a web page.
> 
> It would be possible to present it as just a giant table, but not very
elegant
> of course.
> 
> Does anyone know an OS/2 friendly application I can use to do this without
to
> much work?

php3 - check it out at <http://www.php.org>.
Even if your webspace provider doesn't support php3, you could use it
for automatically creating static webpages from your database.

Bye
Jens

--
Jens Schiffler  email: jensja@rz.fh-augsburg.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Augsburg, InterNetNews (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    13-Oct-99 19:18:12
  To: All                                               13-Oct-99 16:43:24
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

Trevor Hemsley <Trevor-Hemsley@dial.pipex.com> writes:
> 
> Have you loaded ASPIROUT.SYS? OS2ASPI.DMD? The driver for your SCSI card?

device=D:\UTILITIES\MUSIC\CDRECORD\aspirout.sys
BASEDEV=OS2ASPI.DMD 
BASEDEV=OS2SCSI.DMD
BASEDEV=AIC7870.ADD  [ I think that's it. According to RMVIEW that's 
                       an Adaptec driver ]

There are no boot-time errors or complaints.

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    13-Oct-99 19:22:18
  To: All                                               13-Oct-99 16:43:24
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

Anssi Saari  <as@sci.fi> writes:
> rcpj@panix.com (Pierre Jelenc) writes:
>  
> > CDWriter, using pre-existing WAV files as a test, gives the the following
> > error:
> 
> Using what command?

Dummy write, verbose, filetype audio.

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: ysme@sympatico.ca                                 13-Oct-99 19:22:05
  To: All                                               13-Oct-99 16:43:24
Subj: Re: Oct 1st, still using 0s2 and ibm.net

From: ysme@sympatico.ca

In <37fe83d3$2$lllp186.vyyrtnygbfcnz$mr2ice@news-s01.ny.us.ibm.net>,
yyyc186.illegaltospam@ibm.net writes:
>In <37FDBA8E.4C860169@ibm.net>, on 10/08/99 
>   at 10:34 AM, Tony Wright <horseman@ibm.net> said:
>
>>yyyc186.illegaltospam@ibm.net wrote:
>
>>> In <37FC88C1.9CDE8AE1@ibm.net>, on 10/07/99
>>>    at 12:49 PM, Tony Wright <horseman@ibm.net> said:
>>>

>
>It is a DSL line provided by Flashnet.  It allows the phone line to still
>be used as a phone line while your on-line.  I'm putting it on my fax line
>so I will still be able to receive faxes while connected to the wide and
>wonderfull internet.


If its a 1-Meg Modem line, then YES, and POTS service may be sued on the 
same line at the same time.  I've got my dial up BBS Modem plug into the
1-meg modem, and it works just fine.  At other phone jacks, I've line filters,
 and a phone pluged in.  I probally will move The Stick a modem, fax, voice, 
extention auto sensor to the line shoarlty.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: HARNESS the ABILITY dial up BBS 1-416-604-1221 (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  13-Oct-99 16:15:22
  To: All                                               13-Oct-99 19:52:20
Subj: Re: Candidates for fix in NS 461

From: mchasson@ibm.net

In <s08oh234bhk19@corp.supernews.com>, on 10/13/99 at 10:42 AM,
   mike.luther@ziplog.com said:


>I wonder if your editor happens to use EOF marks at the end of the file?
>Some editors, like old Wordstar, which I use heavily in the non-document
>mode in a DOS-VDM, fill the entire end of the file from the end of the
>data to the closest 512 byte file block, with CHR$(12) EOF characters! I
>have discovered that some OS/2 control files which can be edited with a
>text editor, do not like these EOF marks.

>Mike.Luther@ziplog.com
>Mike.Luther@f3000.n117.z1.fidonet.org

My wife will be tickled to learn that she is not the last Worstar user on
the face of the earth.  She is resisting WordPro even though after nearly
fifteen years, she still cant remember how to get rid of hard cr's.  etc,
etc.  She is running WS5 in a DOS window in W98, and it only crashes
sometimes.  

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: cocke@ibm.net                                     13-Oct-99 16:57:14
  To: All                                               13-Oct-99 19:52:20
Subj: Re: Backing up and Restoring with Back Again/2

From: Michael W. Cocke <cocke@ibm.net>

On Wed, 13 Oct 1999 16:20:43 GMT, ysme@sympatico.ca wrote:

>In <37fe2347.21516689@news.omen.net.au>, zayne@omen.com.au (Mooo) writes:
>>Alan Beagley <abeagley@datatone.com> wrote:
>>
>>>I have found that I m getting a slew of "CRC mismatch" error messages when
I try to verify backups
>>>that were made using BA/2 Pro ver. 4.0i with the tape drive connected to my 
on-board Adaptec SCSI
>>
>>This is the error that started around FP26 (was it 26?) for Warp3 and
>>was never corrected.  
>>
>>Craig
>
<snipped>

I've been using BA/2 4.00i Professional for years, on warp 3, warp 4, 
and now WSeB with an assortment of tape drives, as well as a pair of 
EZ-Flyer 230 removable drives (Parallel). Since the only time I've ever 
seen any type of failure to verify correctly is when my tape drive was 
about to die, I suspect you may be encountering drive problems.  You can
try cleaning it- it should have come with a cleaning cartridge.

Mike-


========================================================================
Member: DNRC            Watcher: Babylon 5              User: OS/2 Warp

        If you're going to do something, do something worth doing.
------------------------------------------------------------------------



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: kim@haverblad.com                                 13-Oct-99 23:29:18
  To: All                                               13-Oct-99 19:52:20
Subj: Re: Process Commander and WSFeB

From: "Kim Haverblad" <kim@haverblad.com>

On 13 Oct 1999 06:10:01 GMT, Will Rose wrote:

>Actually PC doesn't work on Warp 3.0 FP 40, or Warp 4.0 FP 12 either.
>It might be the same problem as with WSFeB, or not - the 3.0/4.0 problems
>are with the installer, not PC itself.  What does the problem on WSeB
>look like?  Does the installer run/does it give any warning messages?

After installation and when trying to boot up, the system traps. Interesting
to know that PC won't work when fp12 is installed. I'm currently running with
FP9. Can't find ant reason to update ;-). So that cool, having a dead product
even for Warp 4. Guess that Stardock should care a litle bit more....

//Kim


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A Customer of Tele2 (1:109/42)

+----------------------------------------------------------------------------+

From: mc6530@mclink.it                                  13-Oct-99 21:10:26
  To: All                                               13-Oct-99 19:52:20
Subj: Re: Database for webpage?

From: mc6530@mclink.it (Yuri Dario)

On Sun, 10 Oct 1999 21:13:33, jan.eri@protector-group.no (Jan Eri) 
wrote:

> I have a dBase database that I would like to present on a web page.
> It would be possible to present it as just a giant table, but not very
elegant
> of course.

if you have apache or lotus-go, you can install mSQL and use w3-msql 
to write a simple script to get database records.

Bye,

	Yuri Dario

/*
 * member of TeamOS/2 - Italy
 * http://www.quasarbbs.com/yuri
 */

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MC-link The World On Line (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    13-Oct-99 22:04:07
  To: All                                               13-Oct-99 19:52:20
Subj: FP39...FP42

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

	Funny how things can happen.  If anyone would recall I posted 
sometime ago that I would take the PMMERGE.DLL and PMDDEML.DLL from FP42 
and stick them onto my FP39 system (Warp 3).  In the APARS for FP42, 
these two were sources of memory leaks that have now been fixed.  For 
myself the problem going to FP42 is that ever since FP40, some DOS 
functions have been broken (ie. VIDEO_MODE_RESTRICT) feature no longer 
works anymore after FP40 and FP42 has still not fixed it.
	Well, after copying PMMERGE and PMDDEML from FP42 onto my FP39 
box, everything had been working just fine...up until I tried to run a 
DOS application that had the VIDEO_MODE_RESTRICT set to CGA.  I exited 
via an error the same manner that I remember seeing when I had FP40, 41, 
and 42 on here.  So it looks like the fault lies in the PMMERGE/PMDDEML 
files.  I copied back the original FP39 files and everything was working 
fine again.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: rbi@rbi.com                                       13-Oct-99 17:36:04
  To: All                                               13-Oct-99 21:24:24
Subj: Arrrrrgh ..... Warp server for e-business lack of documentation for RAS

From: Rb Interfaces <rbi@rbi.com>

I am trying to install Warp server for E-business and cannot figure
out how to install RAS properly. There is but one paragraph in quick
start manual about how RAS replaced LAN distance and supports multiple
dial-ins and Windows clients and all. But that is it... For almost
$1700 US there should be some sort of documentation.

All I want to do is replace my old Warp 3.0 connect pc withe a new
Dell Optiplex and Warp Server. But I need LAN Distance dial-in for old
Warp 3.0 connect dial-in. I would like to know how this is
accomplished.

After that, a slip dial-in would be nice. Since dynamic IP setup  info
for OS/2 is as rare as info for RAS. Supposedly, Warp server handles
both PPP and LAN Distance. Just no documentation.

Sorry for ranting, I've got 12 hrs. into this so far.
Rb I
ICQ 48080008

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Why must I fill these in? (1:109/42)

+----------------------------------------------------------------------------+

From: nospam2rhb@accessv.com                            13-Oct-99 22:55:09
  To: All                                               13-Oct-99 21:24:24
Subj: Re: Arrrrrgh ..... Warp server for e-business lack of documentation for

From: Rob Burton <nospam2rhb@accessv.com>

I don't think you grok the IBM theory of this. They'd a lot rather you
paid them to take care of all this for you, rather than let you read
up on it in a book...you should be calling "your IBM representative",
have you never heard the phrase?

On Wed, 13 Oct 1999 17:36:09 -0400, Rb Interfaces <rbi@rbi.com> sent:

>I am trying to install Warp server for E-business and cannot figure
>out how to install RAS properly. There is but one paragraph in quick
>start manual about how RAS replaced LAN distance and supports multiple
>dial-ins and Windows clients and all. But that is it... For almost
>$1700 US there should be some sort of documentation.
>
>All I want to do is replace my old Warp 3.0 connect pc withe a new
>Dell Optiplex and Warp Server. But I need LAN Distance dial-in for old
>Warp 3.0 connect dial-in. I would like to know how this is
>accomplished.
>
>After that, a slip dial-in would be nice. Since dynamic IP setup  info
>for OS/2 is as rare as info for RAS. Supposedly, Warp server handles
>both PPP and LAN Distance. Just no documentation.
>
>Sorry for ranting, I've got 12 hrs. into this so far.
>Rb I
>ICQ 48080008

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: bts@iaehv.nl                                      14-Oct-99 00:47:05
  To: All                                               13-Oct-99 21:24:24
Subj: Re: Netscape 4.61 animations

From: "Martin Bartelds" <bts@iaehv.nl>

Thank You Very Much !

It works, no more stalled NS !

Thank You,

Martin


On Tue, 12 Oct 1999 19:40:42 -0400, Jerry McBride wrote:

:>In article <ogfvnruiay.fjiwnq0.pminews@martin>,
:>"Martin Bartelds" <bts@iaehv.nl> wrote:
:>>A lot of sites do contain animations. Loading such a site
:>>with Netscape 4.61 gives a 100% CPU load and a stalled
:>>Netscape.
:>>
:>>Giving a "Stop animations" solves this problem, however
:>>the page loading also stops.
:>>
:>>How can I stop the animations or lower the priority of
:>>the animation thread ?
:>>
:>>Offending sites (for example):
:>>
:>>www.altavista.com
:>>www.zonnet.nl
:>>www.telegraaf.nl
:>>
:>>
:>>This problem is very anoying !
:>>
:>>It doesn't happen with a W95/98 browser.
:>>
:>>
:>
:>I JUST READ THIS TIP in comp.os2.beta and it WORKS! On my netscape 4.61ga,
:>strong encryption, I used a binary editor (HEXED/2 from Hobbes) and searched
:>for the string "NETSCAPE2.0" (minus the quotes) I changed the "." to a ","
and
:>then next to that string there's a "ANIMEXTS1." and I changed the "1" to a
"2".
:>
:>Now when I'm browsing online and one of those PESKY animated graphics pops
up,
:>it run's once though then stops DEAD! No more wasted cpu on a crummy graphic 
I
:>didn't want in the first place! YAHHHoooo!!!
:>
:>Your listed URL's now only display pictures! Not the cpu hogging movies they
:>call advertizment!
:>
:>Here's the entire posted message I read on comp.os2.beta...
:>
:>
:>--- quote ---
:>
:>
:>> Now there's something I'd very much like to see in Netscape
:>> preferences.  The ability to turn off wiggle graphics and NOT get
:>> piles of error messages!!!!!!!
:>
:>To make gif animations stop after one cycle, read this page:
:>http://simmons.starkville.ms.us/tips/081097/
:>
:>In short, search for NETSCAPE2.0 and for ANIMEXTS1.0 and change them to be
:>something else - I just changed the . to a , (in netscape.exe).
:>
:>        -Ariel
:>
:>PS. Use a binary safe editor.
:>
:>--- end quote ---
:>
:>That URL at simmons.starkville.ms.us points to a document describing the
:>origins of animated gifs and how to disable them...
:>
:>Yeoooo, is it just me or is anyone else excited about this? :')
:>
:>
:>--
:>
:>*****************************************************************************
**
:>*            Sometimes, the BEST things in life really ARE free...           
 *
:>*       Get a FREE copy of NetRexx 1.151 for your next java project at:      
 *
:>*                                                                            
 *
:>*                      GET IT NOW! WHILE IT'S STILL FREE!                    
 *
:>*                                                                            
 *
:>*                     http://www2.hursley.ibm.com/netrexx                    
 *
:>*****************************************************************************
**
:>
:>/----------------------------------------\
:>| From the desktop of: Jerome D. McBride |
:>|         mcbrides@erols.com             |
:>\----------------------------------------/
:>
:>--
:>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: BTSoftware (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          13-Oct-99 23:29:23
  To: All                                               13-Oct-99 21:24:24
Subj: Re: another OT about e-mail addresses

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 13 Oct 1999 12:19:04, Siobhan Perricone <morgannalefey@my-deja.com>
a crit dans un message:
snippo

> I get a big
> kick out of telling my coworkers they can e-mail it to me at
> morgannalefey@my-deja.com. ;D

No problem whatsover here with that sort of rebelliousness but I was trying
to suggest that you might have to explain that fact more clearly before 
complaining that newcomers to your address couldn't figure out how to mail 
to you.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             13-Oct-99 19:29:28
  To: All                                               13-Oct-99 21:24:24
Subj: Re: Backing up and Restoring with Back Again/2

From: Alan Beagley <abeagley@datatone.com>

Using (temporarily) a Trantor T130B ISA SCSI adapter for the tape drive solves 
all the "CRC mismatch"
problems. (Of course, it also ties up the CPU big time.) CDS is sending me a
Symbios Logic PCI card to
try, and I can buy it for a very good price if it works.

From the reports I have read from time to time, the more recent Adaptec SCSI
adapters simply do not get
on well with tape drives.


Alan

"Michael W. Cocke" wrote:

> On Wed, 13 Oct 1999 16:20:43 GMT, ysme@sympatico.ca wrote:
>
> >In <37fe2347.21516689@news.omen.net.au>, zayne@omen.com.au (Mooo) writes:
> >>Alan Beagley <abeagley@datatone.com> wrote:
> >>
> >>>I have found that I m getting a slew of "CRC mismatch" error messages
when I try to verify backups
> >>>that were made using BA/2 Pro ver. 4.0i with the tape drive connected to
my on-board Adaptec SCSI
> >>
> >>This is the error that started around FP26 (was it 26?) for Warp3 and
> >>was never corrected.
> >>
> >>Craig
> >
> <snipped>
>
> I've been using BA/2 4.00i Professional for years, on warp 3, warp 4,
> and now WSeB with an assortment of tape drives, as well as a pair of
> EZ-Flyer 230 removable drives (Parallel). Since the only time I've ever
> seen any type of failure to verify correctly is when my tape drive was
> about to die, I suspect you may be encountering drive problems.  You can
> try cleaning it- it should have come with a cleaning cartridge.
>
> Mike-
>
> ========================================================================
> Member: DNRC            Watcher: Babylon 5              User: OS/2 Warp
>
>         If you're going to do something, do something worth doing.
> ------------------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             13-Oct-99 19:31:22
  To: All                                               13-Oct-99 21:24:24
Subj: Re: Process Commander and WSFeB

From: Alan Beagley <abeagley@datatone.com>

After I upgraded my Warp 4 setup to FP12 (after disabling Process Commander),
and
then re-enabled PC, I got an error message on bootup, but it all still seems
to
work OK.

Alan


Kim Haverblad wrote:

> On 13 Oct 1999 06:10:01 GMT, Will Rose wrote:
>
> >Actually PC doesn't work on Warp 3.0 FP 40, or Warp 4.0 FP 12 either.
> >It might be the same problem as with WSFeB, or not - the 3.0/4.0 problems
> >are with the installer, not PC itself.  What does the problem on WSeB
> >look like?  Does the installer run/does it give any warning messages?
>
> After installation and when trying to boot up, the system traps. Interesting
> to know that PC won't work when fp12 is installed. I'm currently running
with
> FP9. Can't find ant reason to update ;-). So that cool, having a dead
product
> even for Warp 4. Guess that Stardock should care a litle bit more....
>
> //Kim

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          13-Oct-99 23:26:25
  To: All                                               13-Oct-99 21:24:24
Subj: Re: Describe: A Blast from the Past

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 13 Oct 1999 11:12:23, "Esko Kauppinen" <esko.kauppinen@ibm.net> a 
crit dans un message:

> 
> I'm using a laptop at the moment and the screen is 12,1" 800x600 65K.
> Cirrus Logic GD7543 display adapter, 1 Meg.
> 
> If these bitmaps work in your computer then I indeed seem to have some
> problems but it still doesn't explain why the original bitmaps are OK.

1 MB video doesn't do well with colors beyond 256, generally. The symptoms 
you're describing are typical "video memory suck" display anomalies.


(And I have learned not to complain about display problems on a laptop, 
ever, at least at the level of investment I'll make in one.)


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: DLaRue@NetSRQ.Com                                 13-Oct-99 23:43:05
  To: All                                               13-Oct-99 21:24:24
Subj: Re: How to export email from PMMail

From: DLaRue@NetSRQ.Com (David LaRue)

  William,

  Most email packages have some import utilities to read other applications
mail.  You'll have to check with the manufacturer for your new email product
to see if they have an import facility from PMMail.  I know Eudora has one.
The format is simple enough.  SouthSoft keeps it in the standard mail format.
Outlook would be a problem unless some other soul has saved you the trouble
of writing  few batch files.  You can always mail everything to your new
system.

  Good luck,

  David LaRue

In <380408B0.509D65EF@aawc.com>, William Richard Jones <webmaster@aawc.com>
writes:
>
> I need to import my mail messages from PMMail mail. Does anybody know
>of an utility that
>will convert PMMail mail messages into a form that is usable by another
>major email
>product (i.e., OutLook, Eudora, pegasus, etc)?  Due to business reasons
>and
>performance issues with PMMail, I need to move several thousand
>messages.  I need to
>move my messages to an email product that is upgradeable. I expect high
>email volume
>in the near future; consequently, would like have all my emails in one
>email application.
>
>Any advice or suggestions will be humbly appreciated.
>
>Regards,
>
>William
>
>(William R. Jones)
>webmaster@aawc.com
>
>====================================
>>From: "PMMail Windows Support" <pmmailwin@southsoft.com>
>>To: "webmaster@aawc.com" <webmaster@aawc.com>
>>Date: Tue, 05 Oct 1999 12:13:12 -0400
>>Subject: Re: How to export emails from PMMail 98 v2?
>>
>>| haven't been asked this one before, so I am searching.  But I am
>having
>>no luck in finding converting PMMail to Outlook, or anything for that
>matter.
>>I am thinking maybe a switch to another mailer, and then a conversion
>from
>>it to Outlook, but I can't find any 'mediary' conversion.
>>
>>I am not certain, but I believe that Netscape stores its messages as
>..MSG
>>files as well.  Maybe convert PMMail to Netscape somehow, and then it
>>should be easy to find a utility for Netscape to Outlook.
>>
>
>This is not correct.
>
>>I'll keep on the lookout and let you know.
>>
>>
>>jimmy
>>
>>Jimmy McCorquodale, Jr.
>>
>>PMMail 2000 2.10.0434 Pro
>>
>>homepage:  http://www.southsoft.com
>>email:           pmmailwin@southsoft.com
>>ICQ:             45476579
>>
>======================================
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Intelligence Network Online, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: engs0011@sable.ox.ac.uk                           13-Oct-99 22:42:00
  To: All                                               13-Oct-99 21:24:24
Subj: Re: Staroffice5.1 Starbase not included?

From: engs0011@sable.ox.ac.uk (Ian Johnston)

John Varela (jvarela@mind-spring.com) wrote:

: I've
: figured out how to create new categories, but I have searched the Help
: on every key I can think of and no way can I figure out how to DELETE 
: or rename categories.

I've similarly failed to find any way to delete unwanted templates from
the New -> From Template menus.

Ian

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Oxford University, England (1:109/42)

+----------------------------------------------------------------------------+

From: engs0011@sable.ox.ac.uk                           13-Oct-99 22:44:12
  To: All                                               13-Oct-99 21:24:24
Subj: Re: Describe: A Blast from the Past

From: engs0011@sable.ox.ac.uk (Ian Johnston)

John Hong (jdc0014@InfoNET.st-johns.nf.ca) wrote:

: 	AmiPro for Windows, yes.  That was a definate good one.  AmiPro 
: for OS/2?  Er, could've used more work, even in spite of the patch Lotus 
: released for it.

I gave up on AmiPro when I discovered how unhappy it was with multiple tables
I had a four page document with a simple table on each page (all text) which
took 11 minutes - yes, eleven - to save. Unfortunately I was on ten minute
autosaves, so it became impossible to work on it.

Ian

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Oxford University, England (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          13-Oct-99 23:48:22
  To: All                                               13-Oct-99 21:24:24
Subj: Re: Process Commander and WSFeB

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 13 Oct 1999 13:56:28, ralbers@dccnet.com a crit dans un message:

snippies
> After talking to Stardock about my mishap, they DO NOT have any plans 
> to update PC to work with WSeB - Now that was a very SAD DAY!!

Some of us would consider it a *great* day when stardock announces 
(therefore acting truthfully) that they *don't* plan to fix something 
they've made and sold. (Though I don't consider them at fault for not 
supporting a new version of Warp, without charging more money.)


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     13-Oct-99 23:43:07
  To: All                                               13-Oct-99 21:24:24
Subj: Re: cdwriter support

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On 13 Oct 1999 19:18:24 GMT, Pierre Jelenc wrote:

->> Have you loaded ASPIROUT.SYS? OS2ASPI.DMD? The driver for your SCSI card?
->
->device=D:\UTILITIES\MUSIC\CDRECORD\aspirout.sys
->BASEDEV=OS2ASPI.DMD 
->BASEDEV=OS2SCSI.DMD
->BASEDEV=AIC7870.ADD  [ I think that's it. According to RMVIEW that's 
->                       an Adaptec driver ]
->
->There are no boot-time errors or complaints.

I have /ALL specified on the BASEDEV=OS2ASPI.DMD.


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     13-Oct-99 19:10:15
  To: All                                               13-Oct-99 21:24:24
Subj: Re: DBExpert and Dates

From: yyyc186.illegaltospam@ibm.net

In <nsworyybayvaxarg.fjg0d41.pminews@news.onlink.net>, on 10/11/99 
   at 10:31 AM, "Alex Bell" <afjbell@onlink.net> said:

Did you bother to look at page 16-7 for the format statements?

>I am trying to design a database to help me keep track of the patients of
>our Assertive Community Treatment Team, and help me to measure the
>effectiveness of our work.  One of the things I want to do is to track
>all previous admissions and discharges, and to calculate the time spent
>in hospital and the time out of hospital - ie between admissions.  For
>reasons I need not go into it is necessary to enter the dates in
>yyyy/mm/dd format.

>So, how can I get DBExpert to accept dates in yyyy/mm/dd format, and
>treat them as dates?

>How can I get DBExpert to do date arithmetic?  There is mention in the
>manual of a dbeDateToNumber function which converts a date to a Julian
>number, but I am afraid that I cannot work out how to use it.

>Regards, Alex


-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: helle05@ibm.net                                   13-Oct-99 17:06:27
  To: All                                               14-Oct-99 03:59:07
Subj: Re: Candidates for fix in NS 461

From: "Thomas A. Heller" <helle05@ibm.net>


lifedata@xxvol.com wrote:
> 
> "Thomas A. Heller" <helle05@ibm.net> said:
> >2. I broke the "Edit Bookmarks" feature (and also
> >the "More Bookmarks" function) after an attempt to
> >manually edit the Bookmark.HTML.
> 
> I'm curious why you would want to edit bookmarks manually.  I find it much
> easier in the Netscape bookmark edit feature.  Isn't there a warning
somewhere
> against editing it?
> 
> Jim L
> Remove XX from address to Email
> Crooks and kooks will get guns regardless of laws.


Who knows why I do some things?  I had built up a
real tar-baby of a bookmark file and was desiring to
do a major clean-out, specifically to remove
multiple entries at a time.  With "Edit Bookmarks",
I was only able to remove one entry at a time, so I
decided to try a quicker route.  I opened the .html
file in Composer and began to hack away.  When I
saved the file, a quick message re: Netscape was
reloading the bookmark file appeared briefly, but I
think I was closing Composer at that very moment
(not willing to wait around).  So it probably
screwed up some related file.

Another possible reason: I'm experimenting with
using Netscape's URL drag 'n drop into a folder as a
substitute for the embedded bookmark file.  At any
rate, I was doing some housekeeping and wanted to
thin out the bloated (and/or poorly maintained)
bookmark file.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                13-Oct-99 17:36:07
  To: All                                               14-Oct-99 03:59:07
Subj: PMMail, Attachments, and application calling

From: John M Price PhD <jmprice@calweb.com>

I have a strange problem with attachments.  Some work, others don't, and
I can't see why.  For instance,  I have one with a .txt extension,
properly opened by E.EXE, as noted in the settings.  However, I can't
open the attachment, and I get a WinOS2 error message (!) about invalid
path.

I then typed the full path to the program, F:\EEE\E.EXE (which is on the
path in config.sys) and still, a WinOS2 error.  I moved the %s to the
program line, and I get, yep, a WinOS2 error.

JPGs work, GIFs don't.  Go figure.  PMView is registered for all picture
files, both within and without PMMail.  (Oh, and it is registerd withthe
authors as well!)

Any ideas here?  

-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

 If you don't want to convict the innocent, you have got to pay a
 price. The price is to acquit a certain amount of guilty people. The
 question is: how many guilty people are we prepared to acquit on the
 basis of reasonable doubt in order to be sure we are not convicting
 the innocent?
           - Chief Justice Antonio Lamer
             Supreme Court of Canada
             quoted in: HALIFAX DAILY NEWS  February 7, 1999


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: agi@direct.ca                                     13-Oct-99 17:41:13
  To: All                                               14-Oct-99 03:59:07
Subj: Netscape Communicator 4.61

From: Alan Ianson <agi@direct.ca>

I've just installed NS 4.61 on my system (486 DX2/66, Warp 3 FP40,
16Megs). It seems to be working well except the 1 thing. On sites like
net center, when you go to log on the is a line that says "User name:"
with a box beside it to enter your user name. For some reason I don't
get the box to enter a user name, I just get "___" or something similar.
Same thing happens when I try to log onto my banks site, or any of the
internet search boxes that show up on a lot of web pages. Anyone know
why this is happening or what I can do to fix it? Thanks!



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nope! (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             13-Oct-99 20:59:10
  To: All                                               14-Oct-99 03:59:07
Subj: Re: Candidates for fix in NS 461

From: Alan Beagley <abeagley@datatone.com>

You can delete multiple bookmark entries. Mark them with Ctrl-mousebutton or
Shift-mousebutton, then hit Delete.

Alan


"Thomas A. Heller" wrote:

> lifedata@xxvol.com wrote:
> >
> > "Thomas A. Heller" <helle05@ibm.net> said:
> > >2. I broke the "Edit Bookmarks" feature (and also
> > >the "More Bookmarks" function) after an attempt to
> > >manually edit the Bookmark.HTML.
> >
> > I'm curious why you would want to edit bookmarks manually.  I find it much
> > easier in the Netscape bookmark edit feature.  Isn't there a warning
somewhere
> > against editing it?
> >
> > Jim L
> > Remove XX from address to Email
> > Crooks and kooks will get guns regardless of laws.
>
> Who knows why I do some things?  I had built up a
> real tar-baby of a bookmark file and was desiring to
> do a major clean-out, specifically to remove
> multiple entries at a time.  With "Edit Bookmarks",
> I was only able to remove one entry at a time, so I
> decided to try a quicker route.  I opened the .html
> file in Composer and began to hack away.  When I
> saved the file, a quick message re: Netscape was
> reloading the bookmark file appeared briefly, but I
> think I was closing Composer at that very moment
> (not willing to wait around).  So it probably
> screwed up some related file.
>
> Another possible reason: I'm experimenting with
> using Netscape's URL drag 'n drop into a folder as a
> substitute for the embedded bookmark file.  At any
> rate, I was doing some housekeeping and wanted to
> thin out the bloated (and/or poorly maintained)
> bookmark file.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: driepon@nospam.POBoxes.com                        14-Oct-99 10:59:01
  To: All                                               14-Oct-99 03:59:07
Subj: Re: Squid?

From: Dennis Riepon <driepon@nospam.POBoxes.com>

G'Day,

Chuck McKinnis wrote:
> 
> Where does one find Squid?
> 

Try
http://www.os2.spb.ru/technology/squid/

regards
Dennis Riepon

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: OzEmail Ltd, Australia (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             13-Oct-99 18:10:07
  To: All                                               14-Oct-99 03:59:07
Subj: Re: Describe: A Blast from the Past

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On 12 Oct 1999 18:34:30 GMT, John Hong wrote:

>	Really?  It's too bad they didn't just do what Stardock did with 
>their Entrepreneur and say, oh yeah, its a Windows game.  If they just 
>said it was a Windows word processor, man, you really gotta wonder how it

Oh, they did. At first, Voyager was sold as an 'OS/2' book. But, as I
said, M$ and IBM had managed to get OS/2 drummed out of the bookstores.
So Voyager found it's way onto the Windows shelves. And, reportedly, it
sold rather well. Trouble is, selling it to Windows fanatics meant
selling it to Office fanatics. And that's the point where DeScribes
less glitzy interface really started to hurt it. If Jim Linnane had
pitched it to that crowd as a page layout app (with some killer Word
conversion filters bundled in) it still might even have sold as a
_companion_ to M$Word. But Bill Gates had to much control of his market
to brook a direct competitor to one of his flagship apps... And Jim
Linnane will never go down in history as one of the savviest marketing
minds of the twentieth century. ;-) 
 
>would've played out in the end.  Especially nowadays with a small part of 
>Linux's success doing the same thing, selling the CDROM with a nice fat 
>book on how to use it.  The bookstores are just clustered with that sort 
>of stuff.

It might well work NOW. The world is looking at M$ with different eyes,
now, than it was in 1995/6. But, unfortunately, Linnane has already
taken his toys and gone home.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             13-Oct-99 18:25:09
  To: All                                               14-Oct-99 03:59:07
Subj: Re: Frustration rant, I guess, but also problems terminating stuff

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Tue, 12 Oct 1999 17:42:39 GMT, hamei@pacbell.net wrote:

>morgan was not a nice lady, by the way . . . 

No, but she was DEFINITELY anti-establishment, so she couldn't have
been ALL bad. ;-)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             13-Oct-99 18:30:18
  To: All                                               14-Oct-99 03:59:07
Subj: Re: OT: morgannalefey

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Tue, 12 Oct 1999 18:58:09 GMT, Siobhan Perricone wrote:

>Nah, that's just propoganda spread by the winners. ;D

Ummm, it's been a while since I read the Arthurian Legends, but, didn't
Morgan Le Fay's side win? Modrid took over and Lance took off with
Gwen, right?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                13-Oct-99 18:34:06
  To: All                                               14-Oct-99 03:59:07
Subj: Re: PMMail, Attachments, and application calling

From: John M Price PhD <jmprice@calweb.com>

Never mind.  I found it.  There is semingly an association to NOTEPAD of
all the damned things....


-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

The universal chaos has within it a diverse anarchy
       giving rise to order and pattern.
  -  unknown

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: rbi@rbi.com                                       13-Oct-99 21:46:18
  To: All                                               14-Oct-99 03:59:07
Subj: Re: Arrrrrgh ..... Warp server for e-business lack of documentation for

From: Rb Interfaces <rbi@rbi.com>

Your point being???


On Wed, 13 Oct 1999 22:55:18 GMT, Rob Burton <nospam2rhb@accessv.com>
wrote:

>I don't think you grok the IBM theory of this. They'd a lot rather you
>paid them to take care of all this for you, rather than let you read
>up on it in a book...you should be calling "your IBM representative",
>have you never heard the phrase?
>
>On Wed, 13 Oct 1999 17:36:09 -0400, Rb Interfaces <rbi@rbi.com> sent:
>
>>I am trying to install Warp server for E-business and cannot figure
>>out how to install RAS properly. There is but one paragraph in quick
>>start manual about how RAS replaced LAN distance and supports multiple
>>dial-ins and Windows clients and all. But that is it... For almost
>>$1700 US there should be some sort of documentation.
>>
>>All I want to do is replace my old Warp 3.0 connect pc withe a new
>>Dell Optiplex and Warp Server. But I need LAN Distance dial-in for old
>>Warp 3.0 connect dial-in. I would like to know how this is
>>accomplished.
>>
>>After that, a slip dial-in would be nice. Since dynamic IP setup  info
>>for OS/2 is as rare as info for RAS. Supposedly, Warp server handles
>>both PPP and LAN Distance. Just no documentation.
>>
>>Sorry for ranting, I've got 12 hrs. into this so far.
>>Rb I
>>ICQ 48080008

Rb I
ICQ 48080008

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Why must I fill these in? (1:109/42)

+----------------------------------------------------------------------------+

From: mcmorran@norfolk.infi.net                         13-Oct-99 21:40:24
  To: All                                               14-Oct-99 03:59:07
Subj: Re: cdwriter support

From: mcmorran@norfolk.infi.net (Peter McMorran)

In
<geribeurzfyrlqvnycvcrkpbz.fjkqc20.pminews@news.dial.pipex.com>,
on 10/13/99 
   at 11:43 PM, "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>
said:

>On 13 Oct 1999 19:18:24 GMT, Pierre Jelenc wrote:

>->> Have you loaded ASPIROUT.SYS? OS2ASPI.DMD? The driver for
>your SCSI card? ->
>->device=D:\UTILITIES\MUSIC\CDRECORD\aspirout.sys
>->BASEDEV=OS2ASPI.DMD 
>->BASEDEV=OS2SCSI.DMD
>->BASEDEV=AIC7870.ADD  [ I think that's it. According to RMVIEW
>that's  ->                       an Adaptec driver ]
>->
>->There are no boot-time errors or complaints.

>I have /ALL specified on the BASEDEV=OS2ASPI.DMD.


Yes. Also, the _order_ of these entries may be important. I think
AIC7870.ADD should be first, followed by OS2ASPI.DMD. I have
aspirout.sys last, but that's not significant because it's a
DEVICE, not a BASEDEV. And you don't need OS2ASPI.DMD unless you
have a scanner or tape drive, but it probably doesn't hurt. 

When you watch the boot messages, after the blue splash screen,
do you see the message that the ASPI router has loaded
successfully? If it's up, the program should work. 

A quickie test for cdrecord is cdrecord dev=X,0 -inq which gives
the program's opinion of your drive, where X is the SCSI ID of
the CDR drive. If this works, you _should_ be able to do
anything. If it doesn't, you still have a configuration problem
somewhere. I always do this before starting a burn, just to
verify that everything's talking OK.

HTH and good luck

Cheers,
Peter

-- 
-----------------------------------------------------------
mcmorran@norfolk.infi.net (Peter McMorran)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: ttznii@eggman-network.hypermart.net               14-Oct-99 02:01:05
  To: All                                               14-Oct-99 03:59:08
Subj: Stop others from using your computer!!!  5641

From: ttznii@eggman-network.hypermart.net

That's right....stop others from using your computer now!
Desktop Blocker will password protect your Windows system so that nobody
except for you will be able to access your desktop.
Keep that co-worker off your computer, keep the babysitter off the Internet,
and keep the wife from discovering your "collection"(you shouldn't be looking
at that stuff anyway).
Desktop Blocker is a FREE download at: http://www.eggman.net/desktopblocker
Take a couple seconds to view our SCREENSHOT:
http://www.eggman.net/software/dbss.htm
Lock-up your desktop today!!!
-EggMan Network

iyhkztregwxpkbpn

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: nospam2rhb@accessv.com                            14-Oct-99 02:11:24
  To: All                                               14-Oct-99 03:59:08
Subj: Re: Netscape Communicator 4.61

From: Rob Burton <nospam2rhb@accessv.com>

As I read the docs, NS 4.61 didn't seem to be officially supported for
the Warp 3 platform. That's why I've held off installing it. Could
this be why?

On Wed, 13 Oct 1999 17:41:26 -0700, Alan Ianson <agi@direct.ca> sent:

>I've just installed NS 4.61 on my system (486 DX2/66, Warp 3 FP40,
>16Megs). It seems to be working well except the 1 thing. On sites like
>net center, when you go to log on the is a line that says "User name:"
>with a box beside it to enter your user name. For some reason I don't
>get the box to enter a user name, I just get "___" or something similar.
>Same thing happens when I try to log onto my banks site, or any of the
>internet search boxes that show up on a lot of web pages. Anyone know
>why this is happening or what I can do to fix it? Thanks!
>
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: steve53_remove_this@earthlink.net                 13-Oct-99 19:18:22
  To: All                                               14-Oct-99 03:59:08
Subj: Re: Mesa/2 and layers

From: steve53_remove_this@earthlink.net

In <euonpprffipbz.fjguhr0.pminews@206.221.240.2>, on 10/12/99 
   at 01:22 AM, "Rob Burton" <rhb@accessv.com> said:

>You can't sort the pages. Cheer up, you can't sort them in Excel, either.
>Alas, in Mesa, you can't move them, either, and at least Excel lets you
>do that.

You can move pages in Mesa.  It's a bit hidden...

Mark the page.  Select the destination page.  Then use Edit->Paste
Special->Move.  To find this you either have to RTFM, read the menus or
ask the programmer. :)

Not as nice ask Quattro's drag and drop, but it works.

HTH,

Steven



--
---------------------------------------------------------------
Steven Levine <steve53removethis@earthlink.net>  MR2/ICE #10183 Warp4/FP11
---------------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: moschleg@erols.com                                13-Oct-99 22:44:11
  To: agi@direct.ca                                     14-Oct-99 03:59:08
Subj: Re: Netscape Communicator 4.61

To: Alan Ianson <agi@direct.ca>
From: Mark Schlegel <moschleg@erols.com>

This sounds like the matrox bug, matrox doesn't support
the "couier new" font very well and so it draws them like
they are of 0 size, so you get a line.  Try to go
in netscapes preferences and set the font to
just plain courier or helvetica for the fixed screen
font (see Edit->preferences->appearance->fonts)

Mark

Alan Ianson wrote:
> 
> I've just installed NS 4.61 on my system (486 DX2/66, Warp 3 FP40,
> 16Megs). It seems to be working well except the 1 thing. On sites like
> net center, when you go to log on the is a line that says "User name:"
> with a box beside it to enter your user name. For some reason I don't
> get the box to enter a user name, I just get "___" or something similar.
> Same thing happens when I try to log onto my banks site, or any of the
> internet search boxes that show up on a lot of web pages. Anyone know
> why this is happening or what I can do to fix it? Thanks!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: geishan@ozemail.com.au                            14-Oct-99 13:16:15
  To: All                                               14-Oct-99 03:59:08
Subj: os2 as cleint to linux samba really slow compared to win95

From: Sean Hennessy - Geishan <geishan@ozemail.com.au>

I'm in the act of setting up a small network (7 stations) to replace an
os/2 peer server with linuxand samba.  The workstations are mainly os/2
but with 2 win machines(1 95; 1 NT).

Problem.
current access for a particular page:
    using os/2 server = 3.5 secs - All machines
    using Samba = 3 secs windows   = 22 secs OS/2

Now 22 secs is just a little bit on the slowwww side.

This reeks of an adjustment somewhere, but I'm just not cluey enough to
know what it is.


Can someone please HHEEELLLLPPPPPP.

TIA

Sean Hennessy

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: OzEmail Ltd, Australia (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       14-Oct-99 04:48:06
  To: All                                               14-Oct-99 03:59:08
Subj: Re: Process Commander and WSFeB

From: Will Rose <cwr@cts.com>

Kim Haverblad <kim@haverblad.com> wrote:
: On 13 Oct 1999 06:10:01 GMT, Will Rose wrote:

:>Actually PC doesn't work on Warp 3.0 FP 40, or Warp 4.0 FP 12 either.
:>It might be the same problem as with WSFeB, or not - the 3.0/4.0 problems
:>are with the installer, not PC itself.  What does the problem on WSeB
:>look like?  Does the installer run/does it give any warning messages?

: After installation and when trying to boot up, the system traps. Interesting
: to know that PC won't work when fp12 is installed. I'm currently running
with
: FP9. Can't find ant reason to update ;-). So that cool, having a dead
product
: even for Warp 4. Guess that Stardock should care a litle bit more....

At a guess, then, DOSCALL1.DLL has different entry points.  It might be
possible to find and patch the changes, but I can't see myself ever running
WSFeB to check it out.  I've just had a nightmare install of 4.0, around
three days worth, the like of which I haven't experienced since beta 2.1
days; if I every get it running solidly I'll check out FP 12 myself and
confirm that it's got the same problem as Warp 3.0 FP 40.


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       14-Oct-99 04:50:17
  To: All                                               14-Oct-99 03:59:08
Subj: Re: Candidates for fix in NS 461

From: Will Rose <cwr@cts.com>

mchasson@ibm.net wrote:
: In <s08oh234bhk19@corp.supernews.com>, on 10/13/99 at 10:42 AM,
:    mike.luther@ziplog.com said:


:>I wonder if your editor happens to use EOF marks at the end of the file?
:>Some editors, like old Wordstar, which I use heavily in the non-document
:>mode in a DOS-VDM, fill the entire end of the file from the end of the
:>data to the closest 512 byte file block, with CHR$(12) EOF characters! I
:>have discovered that some OS/2 control files which can be edited with a
:>text editor, do not like these EOF marks.

:>Mike.Luther@ziplog.com
:>Mike.Luther@f3000.n117.z1.fidonet.org

: My wife will be tickled to learn that she is not the last Worstar user on
: the face of the earth.  She is resisting WordPro even though after nearly
: fifteen years, she still cant remember how to get rid of hard cr's.  etc,
: etc.  She is running WS5 in a DOS window in W98, and it only crashes
: sometimes.  

I still use WS 6.0 in an MSDOS window under OS/2.  It does all I want,
and I've never found a reason to change.


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: nospam2rhb@accessv.com                            14-Oct-99 06:13:21
  To: All                                               14-Oct-99 05:36:08
Subj: Re: Mesa/2 and layers

From: Rob Burton <nospam2rhb@accessv.com>

It *sort* of works. But it's not a "real" "move". (The original
"page/layer" is still there, albeit the contents "moved".) In fact,
it's a mess.

Lest you think I don't appreciate Mesa's finer points, I say again, no
other spreadsheet's faster, and that's a significant productivity
boost, especially for very big, long-calculating 'sheets.

On Wed, 13 Oct 1999 19:18:44 -0700, steve53_remove_this@earthlink.net
sent:

>In <euonpprffipbz.fjguhr0.pminews@206.221.240.2>, on 10/12/99 
>   at 01:22 AM, "Rob Burton" <rhb@accessv.com> said:
>
>>You can't sort the pages. Cheer up, you can't sort them in Excel, either.
>>Alas, in Mesa, you can't move them, either, and at least Excel lets you
>>do that.
>
>You can move pages in Mesa.  It's a bit hidden...
>
>Mark the page.  Select the destination page.  Then use Edit->Paste
>Special->Move.  To find this you either have to RTFM, read the menus or
>ask the programmer. :)
>
>Not as nice ask Quattro's drag and drop, but it works.
>
>HTH,
>
>Steven

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   14-Oct-99 01:38:08
  To: All                                               14-Oct-99 05:36:08
Subj: Re: Netscape Communicator 4.61

From: Kris Kadela <kris@dgraph.com>


Mark Schlegel wrote:
> 
> This sounds like the matrox bug, matrox doesn't support
> the "couier new" font very well and so it draws them like
> they are of 0 size, so you get a line.  Try to go
> in netscapes preferences and set the font to
> just plain courier or helvetica for the fixed screen
> font (see Edit->preferences->appearance->fonts)
> 
> Mark
> 

Not really a Matrox bug. Some installs do not have the Courier New font
no matter what the vid card is. Just use a different fixed width font.


> Alan Ianson wrote:
> >
> > I've just installed NS 4.61 on my system (486 DX2/66, Warp 3 FP40,
> > 16Megs). It seems to be working well except the 1 thing. On sites like
> > net center, when you go to log on the is a line that says "User name:"
> > with a box beside it to enter your user name. For some reason I don't
> > get the box to enter a user name, I just get "___" or something similar.
> > Same thing happens when I try to log onto my banks site, or any of the
> > internet search boxes that show up on a lot of web pages. Anyone know
> > why this is happening or what I can do to fix it? Thanks!

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            14-Oct-99 11:25:22
  To: All                                               14-Oct-99 10:29:21
Subj: Re: Describe: A Blast from the Past

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Wed, 13 Oct 1999 23:26:51 GMT, Buddy Donnelly wrote:

>On Wed, 13 Oct 1999 11:12:23, "Esko Kauppinen" <esko.kauppinen@ibm.net> a 
> crit dans un message:
>
>> 
>> I'm using a laptop at the moment and the screen is 12,1" 800x600 65K.
>> Cirrus Logic GD7543 display adapter, 1 Meg.
>> 
>> If these bitmaps work in your computer then I indeed seem to have some
>> problems but it still doesn't explain why the original bitmaps are OK.
>
>1 MB video doesn't do well with colors beyond 256, generally. The symptoms 
>you're describing are typical "video memory suck" display anomalies.

 I disagree on that. It is pure mathematics, 1 Meg is enough to show
 65K colors. The problems I have come from faults in driver software.

 One of the few problems I have is in the OS2 chess game which is
 unusable because all the pieces are of same color.
 I tried once the GENGRADD driver and it worked well put slowly. It corrected
 the chess problem with same resolution and colors.

 Esko.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Brian@webone.com.au                               14-Oct-99 21:50:03
  To: All                                               14-Oct-99 10:29:21
Subj: Re: Galleria Image processing software for OS/2

From: Brian@webone.com.au

Mick
I am running 2.31. Have not heard of any updates.
You know the author lives in Manuka?
Brian

In <zgfpucphtbetmmmmmmuvpvozznvypbz.fjkkgv0.pminews@newshost.pcug.org.au>,
"DeutschMick" <upatoyou@ibmmail.com> writes:
>Hi,
>
>Does anyone know whether Bitware (producers of
>Galleria Image processing software for OS/2 are
>still alive and kicking?
>
>Has anyone seen a version later than mid 1996?
>
>Thanks for the time . . Mick Deutsch
>      /                                       R  e  g  a  r  d  s  :
>    /    -  __0      Mick Deutsch, Project Audio, Canberra, AUSTRALIA.
>[@\      _  \<,_       m$tsch@pcug.org.zzz, zzzhic$@ibmmail.com 
>[@/     (_) / (_)   searching for great sound!    NO DAVE!    I am not
>    \                      Wind95/NT compatible, this is the 21st century!
>     \
>
>humans:  to reply, please replace the z's with au,
>         and the currency symbol with deu - thanks.
>          
>Created and sent using OS/2, the most advanced PC OS
>availabel in the last years of the 20th century.
>
>Who wants to use Neanderthal Tinkering (tm) Operating System.
>
>visit http://www.aberdeen.com/secure/onsite/case1/body.htm
>to see for yourself.
>
>
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Web One Internet http://webone.com.au (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         14-Oct-99 12:12:25
  To: All                                               14-Oct-99 14:36:08
Subj: Re: OT: morgannalefey

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <qfqneebjaivargpbz.fjkbv02.pminews@news.nvinet.com>,
  "Doug Darrow" <d.s.darrow@nvinet.com> wrote:
> On Tue, 12 Oct 1999 18:58:09 GMT, Siobhan Perricone wrote:
>
> >Nah, that's just propoganda spread by the winners. ;D
>
> Ummm, it's been a while since I read the Arthurian Legends, but,
didn't
> Morgan Le Fay's side win? Modrid took over and Lance took off with
> Gwen, right?

That she won at that point in time doesn't mean the history wasn't
revised later by others who won other battles. ;)

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         14-Oct-99 12:14:23
  To: All                                               14-Oct-99 14:36:08
Subj: Re: another OT about e-mail addresses

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <Z8vLRdP7nz3N-pn2-
RRZebdYMBxfd@sphericalburn.tampabay.rr.com>,
  donnelly@tampabay.rr.com (Buddy Donnelly) wrote:
> On Wed, 13 Oct 1999 12:19:04, Siobhan Perricone <morgannalefey@my-
deja.com>
> a crit dans un message:
> snippo
>
> > I get a big
> > kick out of telling my coworkers they can e-mail it to me at
> > morgannalefey@my-deja.com. ;D
>
> No problem whatsover here with that sort of rebelliousness but I was
trying
> to suggest that you might have to explain that fact more clearly
before
> complaining that newcomers to your address couldn't figure out how to
mail
> to you.

Hrm.  Most people just try hitting "reply".  *shrug*

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: britton@rochester.rr.com                          14-Oct-99 08:34:12
  To: All                                               14-Oct-99 14:36:08
Subj: Re: Arrrrrgh ..... Warp server for e-business lack of documentation for

From: Britton Robbins <britton@rochester.rr.com>

If it is anything like the previous version of Warp Server, there are
postscript files with the System Administrator manuals  (well over 1000
pages) located on one of the CDROMs.  I'll have to look at the Warpserver
CDs when I get back to my office to let you know where they are located.
Once you locate these files, you just dump them to a printer with a
postscript intrepreter to print them out.

Britton Robbins


Rb Interfaces wrote:

> Your point being???
>
> On Wed, 13 Oct 1999 22:55:18 GMT, Rob Burton <nospam2rhb@accessv.com>
> wrote:
>
> >I don't think you grok the IBM theory of this. They'd a lot rather you
> >paid them to take care of all this for you, rather than let you read
> >up on it in a book...you should be calling "your IBM representative",
> >have you never heard the phrase?
> >
> >On Wed, 13 Oct 1999 17:36:09 -0400, Rb Interfaces <rbi@rbi.com> sent:
> >
> >>I am trying to install Warp server for E-business and cannot figure
> >>out how to install RAS properly. There is but one paragraph in quick
> >>start manual about how RAS replaced LAN distance and supports multiple
> >>dial-ins and Windows clients and all. But that is it... For almost
> >>$1700 US there should be some sort of documentation.
> >>
> >>All I want to do is replace my old Warp 3.0 connect pc withe a new
> >>Dell Optiplex and Warp Server. But I need LAN Distance dial-in for old
> >>Warp 3.0 connect dial-in. I would like to know how this is
> >>accomplished.
> >>
> >>After that, a slip dial-in would be nice. Since dynamic IP setup  info
> >>for OS/2 is as rare as info for RAS. Supposedly, Warp server handles
> >>both PPP and LAN Distance. Just no documentation.
> >>
> >>Sorry for ranting, I've got 12 hrs. into this so far.
> >>Rb I
> >>ICQ 48080008
>
> Rb I
> ICQ 48080008

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Time Warner Road Runner - Rochester NY (1:109/42)

+----------------------------------------------------------------------------+

From: cfellows@execpc.com                               14-Oct-99 08:11:10
  To: All                                               14-Oct-99 14:36:08
Subj: Re: Beta vs GA

From: Cliff Fellows <cfellows@execpc.com>

Allrighty then... I think I'll install the GA.
Should I install it over the beta? Or do I have to Un-install the beta
first?
If these questions sound sorta' dumb, it's cuz' I fix basements not
computers.
Thnks!

Cliff Fellows wrote:

> I have 4.61 Beta installed and working rather well. Is there a benefit
> to installing the GA?
> Warp4, FP-11, AMD 233 w/32M-o-ram..
> Thanks!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ExecPC Internet - Milwaukee, WI (1:109/42)

+----------------------------------------------------------------------------+

From: luistino@my-deja.com                              14-Oct-99 13:48:21
  To: All                                               14-Oct-99 14:36:08
Subj: Re: AOL under winos2

From: luistino <luistino@my-deja.com>

ysme@sympatico.ca wrote:
> 
> In <19991012003749.16294.00000496@ng-fb1.aol.com>, dstg0001@aol.com
(Dstg0001) writes:
> >Is there any version of the 16-bit AOL software that runs in Warp 4 under
> >WinOS2?
> Ver 3 I beleive.

version 4 also has 4 16bit option. The AOL site or 800 number will tell
you.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: luistino@my-deja.com                              14-Oct-99 13:53:01
  To: All                                               14-Oct-99 14:36:08
Subj: Re: Beta vs GA

From: luistino <luistino@my-deja.com>

Cliff Fellows wrote:
> 
> Allrighty then... I think I'll install the GA.
> Should I install it over the beta? Or do I have to Un-install the beta
> first?
> If these questions sound sorta' dumb, it's cuz' I fix basements not
> computers.
> Thnks!
> 
> Cliff Fellows wrote:
> 
> > I have 4.61 Beta installed and working rather well. Is there a benefit
> > to installing the GA?
> > Warp4, FP-11, AMD 233 w/32M-o-ram..
> > Thanks!

IMHO you should delete all instances of netscape, including references
in the config.sys and other places. Then do a completely fresh install.
Other voices may disagree.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: horseman@ibm.net                                  14-Oct-99 14:58:07
  To: All                                               14-Oct-99 14:36:08
Subj: Re: another OT about e-mail addresses

From: Tony Wright <horseman@ibm.net>

Buddy Donnelly wrote:

> On Wed, 13 Oct 1999 12:19:04, Siobhan Perricone <morgannalefey@my-deja.com>
> a crit dans un message:
> snippo
>
> > I get a big
> > kick out of telling my coworkers they can e-mail it to me at
> > morgannalefey@my-deja.com. ;D
>
> No problem whatsover here with that sort of rebelliousness but I was trying
> to suggest that you might have to explain that fact more clearly before
> complaining that newcomers to your address couldn't figure out how to mail
> to you.
>

Tch, Tch.... "Methinks he doth protest too much"! 
Stop pursuing and defending the fact of why you jumped to an invalid
conclusion - you're straying out of character now...Benedick Prince of
Padua:
 "I'll tell thee what prince;  a college of wit-crackers  cannot flout
me out of my humour. Does thou think I care for a satire or epigram? No:
if a man will be beaten with brains, a' shall wear nothing handsome
about him.  ("Much ado about Nothing")  <g>

Leave the Gaelic lass alone! - you're usual well humoured retort would
be more like:
 "no matter....a rose by any other name....."  and sagely accept that
others may not have (or even wish to share) your diabolically devious
"wordly wise" savvy when it comes to surviving on the Internet? <g>...

As Sir Arthur Conan Doyle wrote (Sherlock Holmes):
"It is a cardinal sin to theorise without data....."

and don't forget the salutary reminder for us all from Shakespeares
Comedy of Errors ActIV Scene III: "I am an ass indeed - you may prove it
by my long ears..." <vbg>
  
Those Florida "orange pips" aggravating your dentures again Dr
Watson?<vbg>

> Good luck,
>
> Buddy
>
> Buddy Donnelly
> donnelly@tampabay.rr.com

--
Rgds Tony W   Email: horseman@attglobal.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Equi-Tek CompCon (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         14-Oct-99 14:42:13
  To: All                                               14-Oct-99 14:36:09
Subj: Back Again/2(?) Help

From: Siobhan Perricone <morgannalefey@my-deja.com>

Warp 4, FP 10, PII system with two scsi hard drives and an IDE HP
Colorado 8gig travan tape drive, IDE CDROM drive, and regular floppy
drive.

I used the work around suggested by someone on one of the other OS2
newsgroups for the creation of utility disks not using any of the files
from the hard drive.  The disks got created.  I then created the BA/2
recovery disk according to the instructions.  Then I tested it to see
if it would work.

I shut down, put the first utility disk in and restarted.  It asked for
the second and then the third disk, but didn't ask for the fourth disk,
and dropped me at an A: prompt.  So I put in the BA/2 recovery disk and
typed CLREST and hit enter.

After some time it gives me the following error:

OS/2 Warp 4 System Installation
SYS0041: Data error (cyclic redundancy check) on A:
Return error code to pgoram
End program...
Retry command...
Ignore error and continue

I tried all the options, nothing solved the problem (obviously, I'm
just be thorough).

I can't seem to find a reference to this error.  Can anyone help?

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                14-Oct-99 10:25:21
  To: All                                               14-Oct-99 14:36:09
Subj: Re: Beta vs GA

From: lifedata@xxvol.com

Cliff Fellows <cfellows@execpc.com> said:

>Allrighty then... I think I'll install the GA.
>Should I install it over the beta? Or do I have to Un-install the beta
>first?

Some people say you should remove the beta before installing the GA.  I found
it
to work quite well installing over it.  My Real Audio went out, but I think
that
had to do with the new plugin, not the main Netscape program.  I got RA back
later.

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    14-Oct-99 15:14:00
  To: All                                               14-Oct-99 14:36:09
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

Peter McMorran <mcmorran@norfolk.infi.net> writes:
> "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com> said:
> 
> >I have /ALL specified on the BASEDEV=OS2ASPI.DMD.

I've had it with and without (with currently) but it makes no difference.
 
> Yes. Also, the _order_ of these entries may be important. I think
> AIC7870.ADD should be first, followed by OS2ASPI.DMD.

That's what I have.

> When you watch the boot messages, after the blue splash screen,
> do you see the message that the ASPI router has loaded
> successfully? If it's up, the program should work. 

Yes, as far as I can tell it loads fine. All the drivers mentionned show
up with Alt-F2 and there is no error message anywhere.

> A quickie test for cdrecord is cdrecord dev=X,0 -inq which gives
> the program's opinion of your drive, where X is the SCSI ID of
> the CDR drive. 

[C:\]cdrecord dev=3,0 -inq
Cdrecord release 1.8a24 Copyright (C) 1995-1999 Jrg Schilling
scsidev: '3,0'
scsibus: 0 target: 3 lun: 0
Device type    : Removable CD-ROM
Version        : 2
Response Format: 2
Capabilities   : SYNC
Vendor_info    : 'YAMAHA  '
Identifikation : 'CRW6416S        '
Revision       : '1.0b'
Device seems to be: Generic mmc CD-RW.

Looks like this works. But...

CDWriter:

Cdrecord release 1.8a24 Copyright (C) 1995-1999 Jrg Schilling
TOC Type: 0 = CD-DA
scsidev: '3'
devname: '3'
scsibus: -2 target: -2 lun: -2
D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe: No such file or directory.
Cannot open SCSI driver.

Quite obviously these "-2" are wrong compared to the successful test
above. But there are no "-2" that I can see anywhere in CDWriter.

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             14-Oct-99 11:28:09
  To: All                                               14-Oct-99 14:36:09
Subj: Re: Back Again/2(?) Help

From: Alan Beagley <abeagley@datatone.com>

That sounds like a bad floppy. Try reformatting the floppy disk and
recreate the rescue disks.

Alan


Siobhan Perricone wrote:

> Warp 4, FP 10, PII system with two scsi hard drives and an IDE HP
> Colorado 8gig travan tape drive, IDE CDROM drive, and regular floppy
> drive.
>
> I used the work around suggested by someone on one of the other OS2
> newsgroups for the creation of utility disks not using any of the files
> from the hard drive.  The disks got created.  I then created the BA/2
> recovery disk according to the instructions.  Then I tested it to see
> if it would work.
>
> I shut down, put the first utility disk in and restarted.  It asked for
> the second and then the third disk, but didn't ask for the fourth disk,
> and dropped me at an A: prompt.  So I put in the BA/2 recovery disk and
> typed CLREST and hit enter.
>
> After some time it gives me the following error:
>
> OS/2 Warp 4 System Installation
> SYS0041: Data error (cyclic redundancy check) on A:
> Return error code to pgoram
> End program...
> Retry command...
> Ignore error and continue
>
> I tried all the options, nothing solved the problem (obviously, I'm
> just be thorough).
>
> I can't seem to find a reference to this error.  Can anyone help?
>
> --
> Siobhan Perricone
> PC Technician
> Alltel Information Services
> (I only speak for myself, not for Alltel)
>
> Sent via Deja.com http://www.deja.com/
> Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: rothgv@yahoo.com                                  14-Oct-99 15:12:26
  To: All                                               14-Oct-99 14:36:09
Subj: Re: Java install failure

From: rothgv@yahoo.com

Hi,
I am also having problems installing Java118 (also reinstalling 117). I
keep getting error messages that it cannot install a dummy plugin and
resolve a plugin variable. Using the WPTOOLS and READFI instructions I
was able to determine that my FI.INI got corrupted when I installed
Stellar Frontier earlier this year. The first game I look at in years
and it got me. Oh well!!

I removed some of the references to JAVA11 from FI.INI and now I get the
JAVA11\UNINSTAL directory created, but nothing else. I think that I need
to have the entries in my FI.INI but am unclear as to how they are
constructed. Could you post your JAVA11 FI.INI entries and any notes on
where the interpretation takes place, so I could try to resolve this
problem.

Thanks in advance

Gary
---------------

In article <3802E040.7260@capgemini.nl>,
  nospam_hkelder@capgemini.nl wrote:
> John Mandeville wrote:
>
> > Note that the URL's for
> > your files were wrong.  Because I recognized your name, I was able
to
> > guess the correct URL's.  They are
> >
> > http://www.os2ss.com/information/kelder/readfi.exe
> > http://www.os2ss.com/information/kelder/WPTOOLS.NEW
>
> Sorry about that. I thought I did it okay.
>
> > readfi.exe kept crashing on me.
>
> That's what you get if you add some code before checking it.
> I added an %s in the prinft that is used when the objecthandle could
not
> be translated without supplying an argument for it. I have already
> modified it and uploaded it.
>
> Anyhow, good to see your problems are solved.
>
> Henk
>
> John Mandeville wrote:
> >
> > Thanks for the help below.  I now have Java successfully installed.
My
> > FI.INI file seemed sufficiently screwed up that I renamed it (also
> > FI.BAK and FISETUP.LOG but *not* FIBASE.RSP).  Note that the URL's
for
> > your files were wrong.  Because I recognized your name, I was able
to
> > guess the correct URL's.  They are
> >
> > http://www.os2ss.com/information/kelder/readfi.exe
> > http://www.os2ss.com/information/kelder/WPTOOLS.NEW
> >
> > readfi.exe kept crashing on me.  From your description, together
with
> > the WPTOOLS documentation from your standard distribution archive, I
> > could take a pretty good guess as to what it does an experimented
with a
> > REXX script.  It appears that readfi.exe crashed for unresolvable
> > ObjectHandles, i.e., those for which my REXX script's call to
> > WPToolsQueryObject return 0.  It would appear that you need to check
> > return values for NULLs.
> >
> > Thanks again for your help
> >
> > John Mandeville
> > jemandy at earthlink dot net
> >
>


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: kentuckybob@att.net                               14-Oct-99 11:59:22
  To: All                                               14-Oct-99 14:36:09
Subj: Re: How to export email from PMMail

From: kentuckybob@att.net

It appears you are moving to a windows system, correct?

for OS/2, MR2ICE is still being upgraded.  there is a REXX program to
convert at http://nick.secant.com/mr2ice.htm

bob




In <380408B0.509D65EF@aawc.com>, on 10/12/99 
   at 09:21 PM, William Richard Jones <webmaster@aawc.com> said:


> I need to import my mail messages from PMMail mail. Does anybody know of
>an utility that
>will convert PMMail mail messages into a form that is usable by another
>major email
>product (i.e., OutLook, Eudora, pegasus, etc)?  Due to business reasons
>and
>performance issues with PMMail, I need to move several thousand messages. 
>I need to
>move my messages to an email product that is upgradeable. I expect high
>email volume
>in the near future; consequently, would like have all my emails in one
>email application.

>Any advice or suggestions will be humbly appreciated.

>Regards,

>William

>(William R. Jones)
>webmaster@aawc.com

>====================================
>>From: "PMMail Windows Support" <pmmailwin@southsoft.com>
>>To: "webmaster@aawc.com" <webmaster@aawc.com>
>>Date: Tue, 05 Oct 1999 12:13:12 -0400
>>Subject: Re: How to export emails from PMMail 98 v2?
>>
>>| haven't been asked this one before, so I am searching.  But I am
>having
>>no luck in finding converting PMMail to Outlook, or anything for that
>matter.
>>I am thinking maybe a switch to another mailer, and then a conversion
>from
>>it to Outlook, but I can't find any 'mediary' conversion.
>>
>>I am not certain, but I believe that Netscape stores its messages as
>..MSG
>>files as well.  Maybe convert PMMail to Netscape somehow, and then it
>>should be easy to find a utility for Netscape to Outlook.
>>

>This is not correct.

>>I'll keep on the lookout and let you know.
>>
>>
>>jimmy
>>
>>Jimmy McCorquodale, Jr.
>>
>>PMMail 2000 2.10.0434 Pro
>>
>>homepage:  http://www.southsoft.com
>>email:           pmmailwin@southsoft.com
>>ICQ:             45476579
>>
>======================================

-- 
-----------------------------------------------------------

Robert Underwood - kentuckybob@att.net
OS/2 Warp 3.0 (Fixpack 39): MR2/ICE 1.62 (Registered)

-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: steve53_remove_this@earthlink.net                 14-Oct-99 09:30:12
  To: All                                               14-Oct-99 16:31:18
Subj: Re: Netscape Communicator 4.61

From: steve53_remove_this@earthlink.net

In <qjsFOPYtP++96zhrk5hl38vrcLKN@4ax.com>, on 10/14/99 
   at 02:11 AM, Rob Burton <nospam2rhb@accessv.com> said:

>As I read the docs, NS 4.61 didn't seem to be officially supported for
>the Warp 3 platform. That's why I've held off installing it. Could this
>be why?

No, this is a known problem with the default font.  Change it to something
other than Courier New and the pages will be fine.

Many are running 4.61 on Warp3.  Not supported, in IBM speak, does not
mean will not work. :)

Steven


--
---------------------------------------------------------------
Steven Levine <steve53removethis@earthlink.net>  MR2/ICE #10183 Warp4/FP11
---------------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: steve53_remove_this@earthlink.net                 14-Oct-99 09:20:24
  To: All                                               14-Oct-99 16:31:18
Subj: Re: Mesa/2 and layers

From: steve53_remove_this@earthlink.net

In <EHQFOB8bgJkS=q7rgMpdTaipLvbi@4ax.com>, on 10/14/99 
   at 06:13 AM, Rob Burton <nospam2rhb@accessv.com> said:

>It *sort* of works. But it's not a "real" "move". (The original
>"page/layer" is still there, albeit the contents "moved".) In fact, it's
>a mess.

I becomes a real move after you delete the original page with 2 mouse
clicks.  As I said, not my preference, but it works.  Just takes some
extra mouse clicks to insert and delete the pages.

My biggest Mesa nit, for now, is that it will not allow me to insert a
page in front of a protected page.  Try keeping a multipage journal in
reverse time order with the new page in the front.  It's handy to protect
the historical pages because there's no reason they should change.  It's
also handy to have the newest stuff on the first page.  It's not so handy
to have to unprotect all of the existing pages just to insert a new page.

>Lest you think I don't appreciate Mesa's finer points, I say again, no
>other spreadsheet's faster, and that's a significant productivity boost,
>especially for very big, long-calculating 'sheets.

I understand.  Dan's heard my wishlist more than once. :)

Steven

--
---------------------------------------------------------------
Steven Levine <steve53removethis@earthlink.net>  MR2/ICE #10183 Warp4/FP11
---------------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: worlock@frontiernet.net                           14-Oct-99 13:32:20
  To: All                                               14-Oct-99 16:31:18
Subj: EscapeGL 3.0 and OpenGL problems...

From: "RichS" <worlock@frontiernet.net>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

After all the negative BS about OS/2, I thought I'd do a little purchasing...
Bought the brand new EscapeGL version 3.0. After the install program wiped
out my desktop and a whole day to recover, I finally have things back to
'normal'. Now, I don't necessarily blame Snow Storm Software and their
install program for the crash since this system has been running continuously
since OS/2 2.0 (Warp 4 fp10 at the moment).....

But to the point... EscapeGL is a wonderful screensaver and has all kinds of
new modules. Unfortunately, it loves to crash. I have installed oglgold from
IBM. EscapeGL does run and all the modules do work. But if I leave it alone
in the screensaver mode it traps as follows:
- ------------------------------------------------------------

10-14-1999  11:42:13  SYS3175  PID 0064  TID 0001  Slot 00ae
I:\SSS\ESCGL\ESCGL.EXE
c0000005
1d162f2b
P1=00000000  P2=ffffffff  P3=XXXXXXXX  P4=XXXXXXXX
EAX=00b43520  EBX=10abe054  ECX=bed62653  EDX=00000000
ESI=0091c450  EDI=0091d770
DS=0053  DSACC=d0f3  DSLIM=1fffffff
ES=0053  ESACC=d0f3  ESLIM=1fffffff
FS=150b  FSACC=00f3  FSLIM=00000030
GS=0000  GSACC=****  GSLIM=********
CS:EIP=005b:1d162f2b  CSACC=d0df  CSLIM=1fffffff
SS:ESP=0053:000381b0  SSACC=d0f3  SSLIM=1fffffff
EBP=000381c4  FLG=00012293

NT.EGL
0001:00012f2b

-
------------------------------------------------------------------------------
- -------------
The test.exe program doesn't seem to run at all however? Although I thought
it did way back when oglgold was released? Maybe a fixpack problem? Maybe my
S3 Trio64 drivers? Maybe only 32 megs of memory? Maybe I don't have a clue
and thought someone out there might have some experience with ogl and
EscapeGL?

But, if some kind person does know what's wrong, please let me know...

Thanks in advance,

Rich...

******************************************************************************
Practice Random Acts of Kindness and Senseless...Umm...Uhh....
Oh - Heck...I never could remember all that "nice" stuff.
-
-----------------------------{worlock@frontiernet/net}-------------------------
-------
******************************************************************************



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: noconv

wj8DBQE4BgXKJUo5KMjfuWMRAvrfAKClO9ZmnyDB6el3RDGYcK2iUDXtEACg3sO0
2D0r4dba7yRS0sMP/y7sYCY=
=v4n3
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     14-Oct-99 17:29:08
  To: All                                               14-Oct-99 16:31:18
Subj: Re: Beta vs GA

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Thu, 14 Oct 1999 12:11:20, Cliff Fellows <cfellows@execpc.com> 
wrote:

> Allrighty then... I think I'll install the GA.
> Should I install it over the beta? Or do I have to Un-install the beta
> first?
> If these questions sound sorta' dumb, it's cuz' I fix basements not
> computers.
> Thnks!
>  
> Cliff Fellows wrote:
>  

The only dumb question, is the one you don't ask <g>.

On the other hand, why would you use a beta program, if you are not a 
computer "expert"?  (I guess that is really beside the point here).

Personally, whenever I do use a beta program, and the time comes to 
replace it with a GA version (ALWAYS replace any beta program with the
GA version, when/if it becomes available), I uninstall the beta 
program, then remove everything that I can find, that has anything to 
do with it. After a clean boot, I install the GA program (actually, 
that is not always true. I sould say "almost always". There are 
certain software authors who do have a good track record of creating 
good install programs that do clean up beta stuff properly).

Now, about that crack in my basement wall <g>...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         14-Oct-99 17:29:14
  To: All                                               14-Oct-99 16:31:18
Subj: Re: Back Again/2(?) Help

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <3805F693.64D3F3B4@datatone.com>,
  Alan Beagley <abeagley@datatone.com> wrote:

> That sounds like a bad floppy. Try reformatting the floppy disk and
> recreate the rescue disks.

You mean recreate the utility disks and the BA/2 recovery disk?  (just
confirming :)

> Siobhan Perricone wrote:
>
> > Warp 4, FP 10, PII system with two scsi hard drives and an IDE HP
> > Colorado 8gig travan tape drive, IDE CDROM drive, and regular floppy
> > drive.
> >
> > I used the work around suggested by someone on one of the other OS2
> > newsgroups for the creation of utility disks not using any of the
files
> > from the hard drive.  The disks got created.  I then created the
BA/2
> > recovery disk according to the instructions.  Then I tested it to
see
> > if it would work.
> >
> > I shut down, put the first utility disk in and restarted.  It asked
for
> > the second and then the third disk, but didn't ask for the fourth
disk,
> > and dropped me at an A: prompt.  So I put in the BA/2 recovery disk
and
> > typed CLREST and hit enter.
> >
> > After some time it gives me the following error:
> >
> > OS/2 Warp 4 System Installation
> > SYS0041: Data error (cyclic redundancy check) on A:
> > Return error code to pgoram
> > End program...
> > Retry command...
> > Ignore error and continue
> >
> > I tried all the options, nothing solved the problem (obviously, I'm
> > just be thorough).
> >
> > I can't seem to find a reference to this error.  Can anyone help?

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             14-Oct-99 13:59:23
  To: All                                               14-Oct-99 16:31:18
Subj: Re: Back Again/2(?) Help

From: Alan Beagley <abeagley@datatone.com>

Yes, the utility disks and the BA/2 recovery disk. ("Rescue disks,"
"recovery disks"; it's difficult to keep track of what the various programs
call them --  especially when the "senior moments" get longer and more
frequent.) Although it sounds as though the utility disks are OK, I don't
think BA/2 will give you an opportunity to make the BA/2 recovery disk
without  making the others, will it? Or will it?

Alan


Siobhan Perricone wrote:

> In article <3805F693.64D3F3B4@datatone.com>,
>   Alan Beagley <abeagley@datatone.com> wrote:
>
> > That sounds like a bad floppy. Try reformatting the floppy disk and
> > recreate the rescue disks.
>
> You mean recreate the utility disks and the BA/2 recovery disk?  (just
> confirming :)
>
> > Siobhan Perricone wrote:
> >
> > > Warp 4, FP 10, PII system with two scsi hard drives and an IDE HP
> > > Colorado 8gig travan tape drive, IDE CDROM drive, and regular floppy
> > > drive.
> > >
> > > I used the work around suggested by someone on one of the other OS2
> > > newsgroups for the creation of utility disks not using any of the
> files
> > > from the hard drive.  The disks got created.  I then created the
> BA/2
> > > recovery disk according to the instructions.  Then I tested it to
> see
> > > if it would work.
> > >
> > > I shut down, put the first utility disk in and restarted.  It asked
> for
> > > the second and then the third disk, but didn't ask for the fourth
> disk,
> > > and dropped me at an A: prompt.  So I put in the BA/2 recovery disk
> and
> > > typed CLREST and hit enter.
> > >
> > > After some time it gives me the following error:
> > >
> > > OS/2 Warp 4 System Installation
> > > SYS0041: Data error (cyclic redundancy check) on A:
> > > Return error code to pgoram
> > > End program...
> > > Retry command...
> > > Ignore error and continue
> > >
> > > I tried all the options, nothing solved the problem (obviously, I'm
> > > just be thorough).
> > >
> > > I can't seem to find a reference to this error.  Can anyone help?
>
> --
> Siobhan Perricone
> PC Technician
> Alltel Information Services
> (I only speak for myself, not for Alltel)
>
> Sent via Deja.com http://www.deja.com/
> Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: wnmccaw@bmi.net                                   14-Oct-99 11:19:07
  To: All                                               14-Oct-99 20:03:12
Subj: Ghost writer

From: "W.N.(Bill) McCaw" <wnmccaw@bmi.net>

I make up camera ready pages for our local singing group's programs,
using Lotus WordPro for OS2.

The printer is a Mac outfit, using the Mac version of Page Maker, so I
bought Page Maker 6.0 for Windows, so that I could send the stuff in on
a disk and save the endless trips when proofing the final copy.  

Turns out that 6.0 uses a later version of Win 32 than OS2 supports, and
of course, Page Maker will not accept WordPro files.  

What version of Ghost writer do I need to get to transform Word Pro
files into Page Maker format?  

Is the program (Ghost writer) reliable for this purpose?

Too bad that there is no Page Maker style program for OS2 that could
turn out acceptable files.
-- 
Cheers! W.N.(Bill) McCaw

"When is doubt, Act like a pro!!"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: donm@ftel.net                                     14-Oct-99 18:40:20
  To: All                                               14-Oct-99 20:03:12
Subj: Re: Netscape 4.61 animations

From: donm@ftel.net (Don Morse)

In message <ogfvnruiay.fjiwnq0.pminews@martin> - "Martin Bartelds"
<bts@iaehv.nl>Wed, 13 Oct 1999 00:04:38 +0200 (CDT) writes:
:>
:>A lot of sites do contain animations. Loading such a site
:>with Netscape 4.61 gives a 100% CPU load and a stalled 
:>Netscape.
:>
:>Giving a "Stop animations" solves this problem, however
:>the page loading also stops.
:>
:>How can I stop the animations or lower the priority of
:>the animation thread ?
:>
:>Offending sites (for example): 
:>
:>www.altavista.com 
:>www.zonnet.nl
:>www.telegraaf.nl
:>
:>
:>This problem is very anoying !
:>
:>It doesn't happen with a W95/98 browser.
:>


didn't happen with my 4.61 OS/2 browser either..  loading
animation came up to 30% CPU, then its sitting at 13% to 9% 
in the background...


********************************************************
  If a million monkeys on typewriters can eventually
       type out the Bible, given enough time.
     Then Bill Gates had 25 monkeys and a week! 
********************************************************
  dmorse@pacificnet.net using Merlin and EmTec News
    ICQ 245937, AOL IM merlinof2  www.blackpalace.com
********************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Franklin interNet http://www.franklin.net (1:109/42)

+----------------------------------------------------------------------------+

From: donm@ftel.net                                     14-Oct-99 18:37:17
  To: All                                               14-Oct-99 20:03:12
Subj: Re: thumbnail maker?

From: donm@ftel.net (Don Morse)

In message <oevnapcpvflfarg.fjjg0m0.pminews@news.pcisys.net> - "Brian
Christie" <brianc@pcisys.net.takemeoff>Wed, 13 Oct 1999 07:02:46 -0600 (MDT)
writes:
:>
:>Does anyone know of a good graphics program to create thumbnails for use on
a
:>web page?  The problem I have is that I want to catalogue pictures and I
:>normally use PMView, but I want to store all the pics off-line on CDs which
:>don't support eas.  This makes PMView's thumbnails useless.  I was thinking
:>if I could just find an app to make thumbnails easily from the pics, then
I'd
:>just make an html index for the CD.
:>
:>Thanks
:>Brian
:>
:>
:>


there is a package available on Hobbes called mkalb113.zip  ...  when run
it creates a webpage with a frame down the left with file names linking
to the images that can be brought up one at a time....

also, 

available on hobbes is a package called montage that will create a 
jpg of the gifs/jpgs in a directory..

hope this helps...


********************************************************
  If a million monkeys on typewriters can eventually
       type out the Bible, given enough time.
     Then Bill Gates had 25 monkeys and a week! 
********************************************************
  dmorse@pacificnet.net using Merlin and EmTec News
    ICQ 245937, AOL IM merlinof2  www.blackpalace.com
********************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Franklin interNet http://www.franklin.net (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          14-Oct-99 18:37:23
  To: All                                               14-Oct-99 20:03:12
Subj: Re: Galleria Image processing software for OS/2

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 13 Oct 1999 10:36:31, "DeutschMick" <upatoyou@ibmmail.com> a crit 
dans un message:
> 
> Does anyone know whether Bitware (producers of
> Galleria Image processing software for OS/2 are
> still alive and kicking?

They are still in business as far as providing downloadable demos and 
taking registrations are concerned. Try here:

	http://ourworld.compuserve.com/homepages/bitware/

> 
> Has anyone seen a version later than mid 1996?

No, nothing new since then. V.2.31 is the latest, dated 7/96. It still runs
fine with all Warp versions, however.

Write to 
	bitware@ibm.net
to complain or praise.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          14-Oct-99 22:57:29
  To: All                                               14-Oct-99 20:03:12
Subj: Re: Netscape Communicator 4.61

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

On Wed, 13 Oct 1999 22:44:23 -0400, Mark Schlegel wrote:

:>This sounds like the matrox bug, matrox doesn't support
:>the "couier new" font very well and so it draws them like
:>they are of 0 size, so you get a line.  Try to go
:>in netscapes preferences and set the font to
:>just plain courier or helvetica for the fixed screen
:>font (see Edit->preferences->appearance->fonts)

Nothing to do with Matrox. I'm running a G400 with the Matrox
drivers and after installing Win-OS2 I got the Courier New
font and everything is well.

Cheers

Wayne

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
  Running on OS/2 Warp 4 (UK)  + FixPak 9
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: as@sci.fi                                         14-Oct-99 19:57:00
  To: All                                               14-Oct-99 20:03:12
Subj: Re: cdwriter support

From: Anssi Saari <as@sci.fi>

rcpj@panix.com (Pierre Jelenc) writes:

> Anssi Saari  <as@sci.fi> writes:
> > rcpj@panix.com (Pierre Jelenc) writes:
> >  
> > > CDWriter, using pre-existing WAV files as a test, gives the the
following
> > > error:
> > 
> > Using what command?
> 
> Dummy write, verbose, filetype audio.

I was more interested in how you were specifying the device you want
to write to, since that seemed odd in the output.

-- 
Anssi Saari - as@sci.fi

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tampere University of Technology (1:109/42)

+----------------------------------------------------------------------------+

From: jensja@rz.fh-augsburg.de                          14-Oct-99 21:46:19
  To: All                                               14-Oct-99 20:03:12
Subj: Re: Database for webpage?

From: Jens Schiffler <jensja@rz.fh-augsburg.de>

Hi all,

Sorry, I didn't check the url before posting - it must read 
<http://www.php.net>
At this location you'll find everything about php3.

Bye
Jens
--
Jens Schiffler  email: jensja@rz.fh-augsburg.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Augsburg, InterNetNews (1:109/42)

+----------------------------------------------------------------------------+

From: lomholt@post8.tele.dk                             14-Oct-99 23:35:02
  To: All                                               14-Oct-99 20:03:13
Subj: Re: Candidates for fix in NS 461

From: Johannes Lomholt <lomholt@post8.tele.dk>

mchasson@ibm.net skrev:
> 
> In <s08oh234bhk19@corp.supernews.com>, on 10/13/99 at 10:42 AM,
>    mike.luther@ziplog.com said:
> 
> >I wonder if your editor happens to use EOF marks at the end of the file?
> >Some editors, like old Wordstar, which I use heavily in the non-document
> >mode in a DOS-VDM, fill the entire end of the file from the end of the
> >data to the closest 512 byte file block, with CHR$(12) EOF characters! I
> >have discovered that some OS/2 control files which can be edited with a
> >text editor, do not like these EOF marks.
> 
> >Mike.Luther@ziplog.com
> >Mike.Luther@f3000.n117.z1.fidonet.org
> 
> My wife will be tickled to learn that she is not the last Worstar user on
> the face of the earth.  She is resisting WordPro even though after nearly
> fifteen years, she still cant remember how to get rid of hard cr's.  etc,
> etc.  She is running WS5 in a DOS window in W98, and it only crashes
> sometimes.
> 
> --
> ----------------------------------------------------
> ------
> Monroe Chasson
> mchasson@ibm.net
> -----------------------------------------------------------
> MR2ICE reg#51

Hope you don't mind my mixing in my opinion.

I know Wordstar and Word Pro are larger program but try to look at
Semware Pro for Dos or Windows; call www.semware.com or look in the
 news unden ftp.semware.pro

It may be a solution.

 Good luck

Johs. Lomholt

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: My own (1:109/42)

+----------------------------------------------------------------------------+

From: thotti@muenster.de                                14-Oct-99 23:41:03
  To: All                                               14-Oct-99 20:03:13
Subj: Re: Stop others from using your computer!!!  5641

From: thotti@muenster.de

ttznii@eggman-network.hypermart.net wrote:
> 
> That's right....stop others from using your computer now!
> Desktop Blocker will password protect your Windows system so that nobody
except for you will be able to access your desktop.
> Keep that co-worker off your computer, keep the babysitter off the Internet, 
and keep the wife from discovering your "collection"(you shouldn't be looking
at that stuff anyway).
> Desktop Blocker is a FREE download at: http://www.eggman.net/desktopblocker
> Take a couple seconds to view our SCREENSHOT:
> http://www.eggman.net/software/dbss.htm
> Lock-up your desktop today!!!
> -EggMan Network
> 
> iyhkztregwxpkbpn
FINE !

what is that doing ?
deltree Windows ????

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Citykom Muenster GmbH (1:109/42)

+----------------------------------------------------------------------------+

From: diin@xs4all.nl                                    14-Oct-99 18:49:12
  To: All                                               14-Oct-99 20:03:13
Subj: scan

From: diin@xs4all.nl (DiiN)

With my present motherboard i get the following errormsgs when i try to 
make a scan. I get it with Sane as well as with Galleria.

The process has stopped. The software diagnostic code (exception code) 
is 0005.

SYS3171: A program in this session encountered a problem and
cannot continue.

EXPLANATION: The process was terminated without running exception
handlers because there was not enough room left on the stack to
dispatch the exception.  This is typically caused by exceptions
occurring in exception handlers.

ACTION: If you purchased this program, contact the supplier of the
program.  If you are the developer of this program, refer to the
information in the register.

Has someone perhaps an idea how i can resolve this?
Because this happens with Sane and Galleria, the program is possible not
the cause, but perhaps the driver of the scsi card?

-- 

The Big and Slow Dino's already died out
so naturally NT will die out as well...

Groetens, Dieter.

***Email  diin@xs4all.nl (Dieter)
***Netmail 2:280/815.16

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Klompen en Molens! (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               15-Oct-99 00:23:25
  To: All                                               14-Oct-99 21:38:24
Subj: ICQ security holes!

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Hi all!

I just came across an article about possible ICQ security holes in the
latest VOICE newsletter. If you're using ICQ then have a look at
http://www.os2voice.org/VNL/past_issues/VNL1099H/vnewsf3.htm and see
yourself.
According to the article people can shutdown your ICQ client, send you
messages using invalid UINs, keep messages for you from reaching you and
even get those messages that were only meant for you! And getting your
IPs or whatever is easy because Mirabilis passes this information on.

So you've been warned...

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    14-Oct-99 22:36:03
  To: All                                               14-Oct-99 21:38:24
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

Anssi Saari  <as@sci.fi> writes:
> 
> I was more interested in how you were specifying the device you want
> to write to, since that seemed odd in the output.

Program Path: D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe
SCSI Device: 3
Speed: 4
Pregap: 0
Other options: (blank)
Command file: makedisc.cmd

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             14-Oct-99 19:18:15
  To: All                                               14-Oct-99 21:38:24
Subj: Re: ICQ security holes!

From: Alan Beagley <abeagley@datatone.com>

I have read somewhere that using ICQ is like putting a ladder up to the open
window of the room where you keep all your valuables and putting up a sign
saying "Help Yourself!"

Alan


Christian Hennecke wrote:

> Hi all!
>
> I just came across an article about possible ICQ security holes in the
> latest VOICE newsletter. If you're using ICQ then have a look at
> http://www.os2voice.org/VNL/past_issues/VNL1099H/vnewsf3.htm and see
> yourself.
> According to the article people can shutdown your ICQ client, send you
> messages using invalid UINs, keep messages for you from reaching you and
> even get those messages that were only meant for you! And getting your
> IPs or whatever is easy because Mirabilis passes this information on.
>
> So you've been warned...
>
> Christian Hennecke
> --
> Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     14-Oct-99 18:31:25
  To: All                                               14-Oct-99 21:38:24
Subj: Re: FP12: A Piece Of Cake!

From: yyyc186.illegaltospam@ibm.net

In <3800CAF4.6BD75C3D@powertech.no>, on 10/10/99 
   at 07:20 PM, Bj rn Vermo <bvermo@powertech.no> said:

>yyyc186.illegaltospam@ibm.net wrote:

>>
>> I did get FP12 to seemingly function with the SB-16 card in my workstation
>> at home, but that is the only box FP-12 seems to function on.  Everything
>> else is a serious kludge of work arounds and do withouts.
>>

>What kind of problem on two different computers was it you tried to fix
>by applying the FP?

>This may be a reminder to many that you are not supposed to install
>fixpacks unless there is something you need fixed which is noted as fixed
>on the APAR-list of the fixpack.

The notebook had lots of software which had been installed and
un-installed.  I was upgrading java and netscape along with several other
tools and in some of the release notes I read that I should upgrade for
device driver support, etc.  Since my notebook is my life (and the thing
which broke the worst) I always test ALL installs on my home workstation
before trying anything on the notebook.  The workstation only had minor
OS/2 problems.  When I got done it had different minor problems...and once
I stuck in a 506 device driver statement turning off bus mastering (on an
ALL SCSI machine no less) system hangs seemed to be reduced.

Bolstered by the modest success I did the install on the notebook.  Major
mistake.

It appears that IBM has been talking to Stardock way too much.  Their
development practices are rubbing off...compiled...first screen came
up...SHIP IT!


Roland


-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@ibm.net                     14-Oct-99 18:39:03
  To: All                                               14-Oct-99 21:38:24
Subj: Re: Back Again/2(?) Help

From: yyyc186.illegaltospam@ibm.net

In <7u4q4f$m8r$1@nnrp1.deja.com>, on 10/14/99 
   at 02:42 PM, Siobhan Perricone <morgannalefey@my-deja.com> said:

Clean your floppy drive, then buy a new floppy.  That error is caused by
dirt on the floppy head or a damaged floppy disk.

Roland

>Warp 4, FP 10, PII system with two scsi hard drives and an IDE HP
>Colorado 8gig travan tape drive, IDE CDROM drive, and regular floppy
>drive.

>I used the work around suggested by someone on one of the other OS2
>newsgroups for the creation of utility disks not using any of the files
>from the hard drive.  The disks got created.  I then created the BA/2
>recovery disk according to the instructions.  Then I tested it to see if
>it would work.

>I shut down, put the first utility disk in and restarted.  It asked for
>the second and then the third disk, but didn't ask for the fourth disk,
>and dropped me at an A: prompt.  So I put in the BA/2 recovery disk and
>typed CLREST and hit enter.

>After some time it gives me the following error:

>OS/2 Warp 4 System Installation
>SYS0041: Data error (cyclic redundancy check) on A:
>Return error code to pgoram
>End program...
>Retry command...
>Ignore error and continue

>I tried all the options, nothing solved the problem (obviously, I'm just
>be thorough).

>I can't seem to find a reference to this error.  Can anyone help?

>--
>Siobhan Perricone
>PC Technician
>Alltel Information Services
>(I only speak for myself, not for Alltel)


>Sent via Deja.com http://www.deja.com/
>Before you buy.
-- 
-----------------------------------------------------------
yyyc186.illegaltospam@ibm.net              To Respond delete ".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Frank@get-lost.spam                               14-Oct-99 23:34:22
  To: All                                               14-Oct-99 21:38:24
Subj: Re: Describe 4.0 : How to print ?

From: Frank@get-lost.spam (Frank)

On Wed, 13 Oct 1999 00:41:53, jdc0014@InfoNET.st-johns.nf.ca (John 
Hong) wrote:

>You're not running a shareware copy of Describe 4.0, what you are 
> running is a workable demo.  

But..is it possible to have this demo version print anything ?


Greeeetings,

Frank 

The box said:"Requires Windows 95/98, NT or better" .......... So I 
too installed OS/2.


Reply per Email to franklyware@-NOSPAM-beer.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             14-Oct-99 17:32:29
  To: All                                               15-Oct-99 02:48:15
Subj: Re: Database for webpage?

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Thu, 14 Oct 1999 21:46:39 -0400, Jens Schiffler wrote:

>Sorry, I didn't check the url before posting - it must read 
><http://www.php.net>
>At this location you'll find everything about php3.

Nope. It's  www.php3.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: peter@seagoon.newcastle.edu.au                    15-Oct-99 00:44:19
  To: All                                               15-Oct-99 02:48:15
Subj: Re: another OT about e-mail addresses

From: peter@seagoon.newcastle.edu.au (Peter Moylan)

Siobhan Perricone <morgannalefey@my-deja.com> wrote:
>In article <Z8vLRdP7nz3N-pn2-
>RRZebdYMBxfd@sphericalburn.tampabay.rr.com>,
>  donnelly@tampabay.rr.com (Buddy Donnelly) wrote:
>> On Wed, 13 Oct 1999 12:19:04, Siobhan Perricone <morgannalefey@my-
>deja.com>
>> a ?crit dans un message:
>> snippo
>>
>> > I get a big
>> > kick out of telling my coworkers they can e-mail it to me at
>> > morgannalefey@my-deja.com. ;D
>>
>> No problem whatsover here with that sort of rebelliousness but I was
>trying
>> to suggest that you might have to explain that fact more clearly
>before
>> complaining that newcomers to your address couldn't figure out how to
>mail
>> to you.
>
>Hrm.  Most people just try hitting "reply".  *shrug*

Once upon a time that worked well.  Over the years we've been trained
out of doing it, because experience shows that 90% of the replies
are going to bounce.  These days I ignore requests in newsgroups for
private replies, because it's just not worth all the trouble.

It's just your bad luck that you have a genuine e-mail address that
looks like a fake.  Mind you, I don't blame you for hanging onto
something that will make a mark on your fellow orkers of cows.

-- 
Peter Moylan                                         peter@ee.newcastle.edu.au
See http://eepjm.newcastle.edu.au for OS/2 information and software

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: peter@seagoon.newcastle.edu.au                    15-Oct-99 00:36:16
  To: All                                               15-Oct-99 02:48:15
Subj: Re: Beta vs GA

From: peter@seagoon.newcastle.edu.au (Peter Moylan)

Cliff Fellows <cfellows@execpc.com> wrote:

>If these questions sound sorta' dumb, it's cuz' I fix basements not
>computers.

Stick around.  Soon it'll be us asking you for help, as the OS/2
community gradually moves underground.

-- 
Peter Moylan                                         peter@ee.newcastle.edu.au
See http://eepjm.newcastle.edu.au for OS/2 information and software

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: dmcbride@no.tower.spam.to.org                     15-Oct-99 02:31:19
  To: All                                               15-Oct-99 02:48:15
Subj: Re: DB2 Installation (continued)

From: "Darin McBride" <dmcbride@no.tower.spam.to.org>

On Sun, 03 Oct 1999 01:08:10 GMT, Roy Brickley wrote:

>    I also want to commend everyone involved at DB2 support for the 
>  excellant UDB 6.1 PDE CD package. I did have to download Visual Age for
Java
>  Entry Edition 2.0, as the CDs didn't include an OS/2 version!
>
>    Two questions, for anyone proferring an answer:
>
>  1). I installed DB2 Personal Connect after getting all of UDB PDE 6.1 base
>    working. Now, I get a countdown from 60 days message at reboots that
>    Personal Connect will expire if I don't supply a license key. Will that
>    happen. This is supposed to be the non-expiring PDE version of UDB.

Well, the problem is that you have two licensed products installed now:

1. DB2 UDB Personal Edition (licensed)
2. DB2 Connect Personal Edition (unlicensed)

You need to purchase DB2 Connect Personal Edition (aka DB2 CPE for those of
us who hate typing long names every time) and install the license to continue
to use DB2 CPE's functionality after 60 days.  However, all functionality
contained within the fully licensed DB2 UDB PE will continue to work as per
its own license.

>  2). After all else installed and working, I installed VA/Java EE 2.0. When
I 
>   try using Help and Search within DB2, I'm told the NetQ server can't be 
>   located. When I fire up VA/Java and Help, its Search functions fine. I
know
>   both DB2 UDB and VA/Java install NetQ Search, and I thought VA/Java had
>   to be installed last. What gives with the DB2 search?

Get Fixpak 1.  There was a slight incompatibility in how VAJava 2 and DB2 6
use searches.  Fixpak 1 for DB2 should fix this and work both with and
without VAJava 2 installed.  That was the last thing I did before Brad took
over... <reminiscing sigh>  :-)

---
Disclaimer: unless explicitly mentioned otherwise, I do not speak
for the company I work for.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: afjbell@onlink.net                                14-Oct-99 22:28:09
  To: All                                               15-Oct-99 02:48:15
Subj: Re: Mesa/2 and layers

From: "Alex Bell" <afjbell@onlink.net>

On Wed, 13 Oct 1999 14:00:28 GMT, ralbers@dccnet.com wrote:

>Wouldn't your needs be met better with DBExpert or another database 
>rather than something as static as a spreadsheet?  Would be happy to 
>give you a hand in designing a database for this problem.
>

Thanks for your suggestion.  The more I try to design the project as a
spreadsheet the more I think you are correct.  I have DBExpert, but have had
some problems with entering dates in the required yyyy/mm/dd format, and with
understanding date arithmetic.  But there seem to be solutions to these
problems, so I will try to design a data base.

Let me start first with the reports I will need.  
-	There must be a summary report which gives me information about all
the patients.  For this I will need the patient's first and last names, their
casebook number, the patient's sex, the ICD9 diagnostic code in nnn.n format,
the age, the date of the last admission, the date of the last discharge or
expected discharge, the length of stay, the time out of hospital or the
number of weeks till the expected date of discharge, the ward on which the
patient resides if still and inpatient, and a couple of yes/no fields.  Age
will be a calculated field based on the difference between the date of birth
and the date the report is generated.  Length of stay will of course be the
difference between between admission and discharge dates, while time out of
hospital will be the difference between date of admission and date of
previous discharge.
-	For each patient I will need the number of the admission, their age
at admission, the number of days out since the last admission, the dates of
admission and discharge for each inpatient admission, the length of stay, and
the text version of the diagnosis.  Age, length of stay, and time out will
again be calculated fields.

For these reports I think I will need three tables.
-	A patient table, with fields for first name, last name, casebook
number, and sex.
- 	An admissions table with fields for casebook number, dates of
admission and discharge, and numerical diagnosis
-	A diagnosis table containing numerical diagnosis and the matching
text diagnosis.

How does this look as a start?  Please tell me on what basis you would be
willing to give me a hand.  Perhaps the discussion should go to e-mail?

Regards, Alex



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ontario Northland--ONLink (1:109/42)

+----------------------------------------------------------------------------+

From: tkayser@ibm.net                                   14-Oct-99 21:48:21
  To: All                                               15-Oct-99 02:48:15
Subj: Re: Communicator 4.61 newsgroups

From: Terry Kayser <tkayser@ibm.net>

Justin,

I was having the same problem as you and fixed mine by setting the newsgroup
server to
news1.ibm.net.  Try it and see if it works for you.

Terry

Justin Curtner wrote:

> Hi there.
>
>         I'm having a problem with Communicator, in it's newsgroup ability. 
I can add
> news servers, and newsgroups, but after I close Communicator, they're all
> gone.  I HAVE managed to get one of them to stay, by selecting it as the
> default server, but the others all still disappear after restarting
> CommunicaX-Mozilla-Status: 0009ps subscribed to stay at all either, even in
my
> default news server.  Any idea what's wrong??
>
> Thanks,

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                14-Oct-99 23:42:19
  To: All                                               15-Oct-99 02:48:15
Subj: Re: Candidates for fix in NS 461

From: lifedata@xxvol.com

Johannes Lomholt <lomholt@post8.tele.dk> said:
>I know Wordstar and Word Pro are larger program but try to look at Semware
Pro
>for Dos or Windows; call www.semware.com or look in the
> news unden ftp.semware.pro

>It may be a solution.

Hard not to be if you can use the macro language.

Jim L
Remove XX from address to Email
Crooks and kooks will get guns regardless of laws.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bCandid - Powering the world's discussions - http
(1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  14-Oct-99 22:40:18
  To: All                                               15-Oct-99 02:48:15
Subj: Re: Communicator 4.61 newsgroups

From: Chuck McKinnis <mckinnis@ibm.net>

You might also want to try switching over to news1.attglobal.net. 
Unfortunately, you have to re-subscribe to everything.

Terry Kayser wrote:
> 
> Justin,
> 
> I was having the same problem as you and fixed mine by setting the newsgroup 
server to
> news1.ibm.net.  Try it and see if it works for you.
> 
> Terry
> 
> Justin Curtner wrote:
> 
> > Hi there.
> >
> >         I'm having a problem with Communicator, in it's newsgroup ability. 
 I can add
> > news servers, and newsgroups, but after I close Communicator, they're all
> > gone.  I HAVE managed to get one of them to stay, by selecting it as the
> > default server, but the others all still disappear after restarting
> > CommunicaX-Mozilla-Status: 0009ps subscribed to stay at all either, even
in my
> > default news server.  Any idea what's wrong??
> >
> > Thanks,

-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: prnicho@ibm.net                                   15-Oct-99 05:49:25
  To: All                                               15-Oct-99 02:48:15
Subj: Document Management

From: prnicho@ibm.net (Philip Nicholls)

Anyone come across a good document management system for OS/2?
I tried UniteLite a while ago but the interface is too clunky.
I have stuck with an old version of Documagix Papermaster (Win3.1) 
which is fine - interface is a filing cabinet with drawers, folders 
etc. - but there are obvious limitations under win-OS/2.

Now if there were a good filing system interface for Copyshop/2, that 
would be perfect.....

Thanks for any suggestions.

Philip Nicholls
Hong Kong

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            15-Oct-99 05:49:25
  To: All                                               15-Oct-99 02:48:15
Subj: Re: Candidates for fix in NS 461

From: mike.luther@ziplog.com

In <38065A98.8B4A381@post8.tele.dk>, Johannes Lomholt <lomholt@post8.tele.dk>
writes:
>mchasson@ibm.net skrev:

>Hope you don't mind my mixing in my opinion.

>I know Wordstar and Word Pro are larger program but try to look at
>Semware Pro for Dos or Windows; call www.semware.com or look in the
> news unden ftp.semware.pro
>
>It may be a solution.
>
> Good luck
>
>Johs. Lomholt

Yep..  There is simply no substitute for the touchtyping position for
near total control of the typing interface that was/is present in the
WordStar operations.  In pure text transcription environments where W/S
can be compared against W/P and other, expecially, mouse oriented
platforms, the throughput on W/S is significantly better.

In one really comparable scenario I know about, typists paid on the basis
of a per-line output in W/S and the others earned, on average, almost
20% more than any other system counterparts in the facility.  The whole
issue was so demoralizing that the outfit actually had to abandone the
per-line payment method and revert to straight salary for typists to
solve the problem!!

More importantly, the SemWare Pro for DOS and WINDOWS does come with a
counterpart for native OS/2!  That's important for another reason, than
just because you can get it in OS/2.  Each of the SemWare products has a
configurable keyboard template which allows you to auto-set it for the
old WordStar keyboard!  You can thus preserve editor typing interface
identity across the entire spectrum of DOS, WIN and OS/2 from this one
vendor!

I still use W/S 7 for all my real text bashing.  I happen to own the
whole set of SemWare tools as well, including the OS/2 native version.
It is ** Wonderful ** to be able to switch platforms and call the
SemWare products my 'editor' in all the assignable stuff like MR/2, PR
Mailer, whatever...  The throughput that way is way beyond what I could
ever do, in pure text, in any other keyboard mode ..  since once upon a
time .. so very long ago and far away ..

Semware is doing this composition job right now.. in native OS/2, even
though the WS 7 is waiting faithully in DOS-VDM right behind it on the
same desktop!    Thanks IBM for OS/2 ,., :)


     I listened to what an Indian could teach me about sending
     smoke signals from a keyboard!

--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: arjen@removethis.hacom.nl                         15-Oct-99 09:29:09
  To: All                                               15-Oct-99 05:27:03
Subj: Re: EscapeGL 3.0 and OpenGL problems...

From: "Arjen Meijer" <arjen@removethis.hacom.nl>

On Thu, 14 Oct 1999 13:32:41 -0400 (EDT), RichS wrote:

EscapeGL is on my machine wonderful stable. To find out which component has a 
bug, disable ALL the Dive settings.

If it traps after that it is a escgl error (I think), otherwise it is the
screendriver.

Arjen



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sizzen en Dwan (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   15-Oct-99 01:53:04
  To: All                                               15-Oct-99 05:27:03
Subj: Re: Netscape 4.61 animations

From: Kris Kadela <kris@dgraph.com>


Don Morse wrote:
> 
> In message <ogfvnruiay.fjiwnq0.pminews@martin> - "Martin Bartelds"
> <bts@iaehv.nl>Wed, 13 Oct 1999 00:04:38 +0200 (CDT) writes:
> :>
> :>A lot of sites do contain animations. Loading such a site
> :>with Netscape 4.61 gives a 100% CPU load and a stalled
> :>Netscape.
> :>
> :>Giving a "Stop animations" solves this problem, however
> :>the page loading also stops.
> :>
> :>How can I stop the animations or lower the priority of
> :>the animation thread ?
> :>
> :>Offending sites (for example):
> :>
> :>www.altavista.com
> :>www.zonnet.nl
> :>www.telegraaf.nl
> :>
> :>
> :>This problem is very anoying !
> :>
> :>It doesn't happen with a W95/98 browser.
> :>
> 
> didn't happen with my 4.61 OS/2 browser either..  loading
> animation came up to 30% CPU, then its sitting at 13% to 9%
> in the background...

Same here. Cheap Trident vid on a P90. ~20% CPU load at the most.


> 
> ********************************************************
>   If a million monkeys on typewriters can eventually
>        type out the Bible, given enough time.
>      Then Bill Gates had 25 monkeys and a week!
> ********************************************************
>   dmorse@pacificnet.net using Merlin and EmTec News
>     ICQ 245937, AOL IM merlinof2  www.blackpalace.com
> ********************************************************

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   15-Oct-99 01:54:10
  To: All                                               15-Oct-99 05:27:03
Subj: Re: Database for webpage?

From: Kris Kadela <kris@dgraph.com>


Doug Darrow wrote:
> 
> On Thu, 14 Oct 1999 21:46:39 -0400, Jens Schiffler wrote:
> 
> >Sorry, I didn't check the url before posting - it must read
> ><http://www.php.net>
> >At this location you'll find everything about php3.
> 
> Nope. It's  www.php3.com

Same thing

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: rsteiner@visi.com                                 15-Oct-99 01:49:27
  To: All                                               15-Oct-99 10:27:10
Subj: Re: Beta vs GA

From: rsteiner@visi.com (Richard Steiner)

Here in comp.os.os2.apps, peter@seagoon.newcastle.edu.au (Peter Moylan)
spake unto us, saying:

>Cliff Fellows <cfellows@execpc.com> wrote:
>
>>If these questions sound sorta' dumb, it's cuz' I fix basements not
>>computers.
>
>Stick around.  Soon it'll be us asking you for help, as the OS/2
>community gradually moves underground.

Hehehe.  :-)

-- 
   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
               I am tolerant of your (fruitcake) beliefs

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       15-Oct-99 09:50:14
  To: All                                               15-Oct-99 10:27:10
Subj: Current Java?

From: Will Rose <cwr@cts.com>

I haven't kept current with OS/2 and Java.  What's the current level
of Java available under Warp 4.0?  Is it automatically updated in
the Warp 4.0 Fixpacks?  If not, where are updates to be found?


Thanks - Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: janswa@algonet.se                                 15-Oct-99 10:47:17
  To: All                                               15-Oct-99 10:27:10
Subj: Re: Document Management

From: janswa@algonet.se (Jan Swartling)

On Fri, 15 Oct 1999 05:49:51, prnicho@ibm.net (Philip Nicholls) wrote:

> Anyone come across a good document management system for OS/2?
> I tried UniteLite a while ago but the interface is too clunky.
> I have stuck with an old version of Documagix Papermaster (Win3.1) 
> which is fine - interface is a filing cabinet with drawers, folders 
> etc. - but there are obvious limitations under win-OS/2.
> 
> Now if there were a good filing system interface for Copyshop/2, that 
> would be perfect.....
> 
> Thanks for any suggestions.
> 
> Philip Nicholls
> Hong Kong

Philip, 

Checkout Solution Technology Inc, "www.stiscan.com".  They have document 
managers, and further more, they have TWAIN drivers you can use with  your
CopyShop/2 which should be TWAIN enabled for OS/2.

Jan Swartling
 Blue Soft
 Sweden

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Blue Soft (1:109/42)

+----------------------------------------------------------------------------+

From: jdesmaraNOjdSPAM@novanthealth.or...               15-Oct-99 05:33:03
  To: All                                               15-Oct-99 14:34:16
Subj: Re: Stop others from using your computer!!!  5641

Message sender: jdesmaraNOjdSPAM@novanthealth.org.invalid

From: John Desmarais <jdesmaraNOjdSPAM@novanthealth.org.invalid>

In article <38065C03.2379@muenster.de>, thotti@muenster.de wrote:
> ttznii@eggman-network.hypermart.net wrote:
> >
> > That's right....stop others from using your computer now!
> > Desktop Blocker will password protect your Windows system so
> that nobody except for you will be able to access your desktop.
> > Keep that co-worker off your computer, keep the babysitter off
> the Internet, and keep the wife from discovering your
> "collection"(you shouldn't be looking at that stuff anyway).
> > Desktop Blocker is a FREE download at:
> http://www.eggman.net/desktopblocker
> > Take a couple seconds to view our SCREENSHOT:
> > http://www.eggman.net/software/dbss.htm
> > Lock-up your desktop today!!!

> what is that doing ?
> deltree Windows ????

Nah, it says it will Lock-up your desktop - it must be installing
Windows.




* Sent from RemarQ http://www.remarq.com The Internet's Discussion Network *
The fastest and easiest way to search and participate in Usenet - Free!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://www.remarq.com: The World's Usenet/Discuss
(1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         15-Oct-99 13:00:05
  To: All                                               15-Oct-99 14:34:16
Subj: CHKDSK problem 

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <38065ba5$2$lllp186.vyyrtnygbfcnz$mr2ice@news-
s01.ny.us.ibm.net>,
  yyyc186.illegaltospam@ibm.net wrote:
> In <7u4q4f$m8r$1@nnrp1.deja.com>, on 10/14/99
>    at 02:42 PM, Siobhan Perricone <morgannalefey@my-deja.com> said:
>
> Clean your floppy drive, then buy a new floppy.  That error is caused
by
> dirt on the floppy head or a damaged floppy disk.

Thank you for this helpful response. :)

Turns out y'all were right (not that I expected anything less).  I made
a new set of recovery disks with fresh new floppies and it works fine.

NOW I have a stupid chkdsk thing that's coming up.

I'm going through the notes people have sent me on the best way to
procede with this back up and restore test I'm going.  So I obediently
try to do a chkdsk on the c: drive (that's my boot drive and the only
drive with anything on it, the other two are blank).  I get a message
telling me there's an allocation error in c:\os2
\help\_<somefilename>.db but it can't fix it because I didn't use
the /f switch.

So I do help on chkdsk and read about the /f switch (someone had
suggested I use /f:2 so I look that up as well).  My interpretation of
what the help file says is that you need the /f (or /f:n) switch in
order for chkdsk to fix the errors it finds, but that you can't use it
from the drive you boot from.  I say "OH" and reboot using the utility
disks.  After some wrangling with commands and finally putting the
right disk into the drive, I try the chkdsk /f:2 thing.  It tells me
the disk is locked.  I try chkdsk /f.  Disk is locked.  Then just
chkdsk.  It goes through the process and tells me there were no errors
reported.  So I try booting back up normally, and running chkdsk again
on the c: drive and it gives me the SAME allocation error on that file.

So what am I doing wrong?

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: heloman@my-deja.com                               15-Oct-99 13:09:26
  To: All                                               15-Oct-99 14:34:16
Subj: Re: Document Management

From: heloman@my-deja.com

In article <PE1H44FYZvpu-pn2-huQu5UydHNEp@PNLAW2>,
  prnicho@ibm.net (Philip Nicholls) wrote:
> Anyone come across a good document management system for OS/2?
> I tried UniteLite a while ago but the interface is too clunky.
> I have stuck with an old version of Documagix Papermaster
(Win3.1)
> which is fine - interface is a filing cabinet with drawers,
folders
> etc. - but there are obvious limitations under win-OS/2.
>
> Now if there were a good filing system interface for
Copyshop/2, that
> would be perfect.....
>
> Thanks for any suggestions.
>
> Philip Nicholls
> Hong Kong
>
Philip, I am currently using a program called Pagekeeper made by
Caere. Unfortunately, it is only a windows program. It is a very
good program for keeping track of documents and it asigns all
the keywords it needs eliminating the need for you to do it. You
will have to find an earlier version perhaps one of the online
auction sites as the newest version only is w95. To be honest
with you I also would love to find an os/2 program that
incorporates all of the functionality that this program has. And
as usual Caere has NO INTENTIONS OF SUPPORTING OS/2 - like we
haven't heard this mantra before. While this may not be your
ultimate program it may be something to think about until
something better comes along. Best wishes in your search and let
the rest of us know if you find a 'killer' app.


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: hrishikesh@cybermedia.co.in                       15-Oct-99 18:32:06
  To: All                                               15-Oct-99 14:34:16
Subj: Long filenames and OS2 16-bit apps

From: hrishikesh@cybermedia.co.in

Hi All,

I am new to OS/2 and this newsgroup. I am working on a command line
16-bit OS/2 application to scan files in a specified directory and
process them. 

To open the files, I'm using DosOpen2 which works for file names in old
DOS 8+3 format. But it fails to open files with long filenames. The
documentation which comes along with the watcom compiler, says that
DosOpen2 function handles long filenames. The DosOpen2 returns an error
code 206 which is buffer exceeded. Do I have to set any flags prior to
using this call ? Or Am I using a wrong function ? 

Thanks,

Hrishikesh.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: VSNL (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         15-Oct-99 13:28:02
  To: All                                               15-Oct-99 14:34:16
Subj: Re: CHKDSK problem 

From: Siobhan Perricone <morgannalefey@my-deja.com>

In article <7u78gi$fhp$1@nnrp1.deja.com>,
  Siobhan Perricone <morgannalefey@my-deja.com> wrote:

> I'm going through the notes people have sent me on the best way to
> procede with this back up and restore test I'm going.  So I obediently
> try to do a chkdsk on the c: drive (that's my boot drive and the only
> drive with anything on it, the other two are blank).  I get a message
> telling me there's an allocation error in c:\os2
> \help\_<somefilename>.db but it can't fix it because I didn't use
> the /f switch.

Ok, I'm only responding to myself to save y'all from having to
respond. :)  I did a search in Deja about this problem and found the
answer. :)  So you don't need to answer.  It was easier to find than I
thought it would be. :)  Thanks for all you're help!  I'll let you know
if there's any more problems (heh, IF). :)

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           15-Oct-99 14:31:14
  To: All                                               15-Oct-99 14:34:17
Subj: Re: Current Java?

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Fri, 15 Oct 1999 09:50:28, Will Rose <cwr@cts.com> wrote:

> I haven't kept current with OS/2 and Java.  What's the current level
> of Java available under Warp 4.0?  Is it automatically updated in
> the Warp 4.0 Fixpacks?  If not, where are updates to be found?
> 
> 

The current GA release of Java for Warp 4 (and all the other
Warp platforms) is version 1.1.8. You can download it from
Software Choice (do it now because Software Choice will
be "paid subscription only" as of January 1 2000).

URL http://www-4.ibm.com/software/os/warp/swchoice/

While you're there you can also download the latest
Feature Installer (version 1.2.5) and the GA Netscape
4.61 release as well. The FI is "required" (I think) to
install the 1.1.8 version of Java.

There is also a set of patches to 1.1.8 that is available
at the Husley FTP site that you might want to apply.

URL ftp://ftp.hursley.ibm.com/pub/java/fixes/os2/11/118/

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: as@sci.fi                                         15-Oct-99 05:50:21
  To: All                                               15-Oct-99 14:34:17
Subj: Re: cdwriter support

From: Anssi Saari <as@sci.fi>

rcpj@panix.com (Pierre Jelenc) writes:

> Anssi Saari  <as@sci.fi> writes:
> > 
> > I was more interested in how you were specifying the device you want
> > to write to, since that seemed odd in the output.
> 
> Program Path: D:\UTILITIES\MUSIC\CDRECORD\cdrecord.exe
> SCSI Device: 3
> Speed: 4
> Pregap: 0
> Other options: (blank)
> Command file: makedisc.cmd

Oh sorry, now I understand. You're using some weird front end. Just a
guess, but maybe you should specify the device in cdrecord syntax,
3,0? Or maybe, if you just set the environment variable CDR_DEVICE you
don't need to guess what the author had in mind?

-- 
Anssi Saari - as@sci.fi

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tampere University of Technology (1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 15-Oct-99 14:35:10
  To: All                                               15-Oct-99 14:34:17
Subj: Re: Backing up and Restoring with Back Again/2

From: zayne@omen.com.au (Mooo)

Michael W. Cocke <cocke@ibm.net> wrote:

>I've been using BA/2 4.00i Professional for years, on warp 3, warp 4, 
>and now WSeB with an assortment of tape drives, as well as a pair of 
>EZ-Flyer 230 removable drives (Parallel). Since the only time I've ever 
>seen any type of failure to verify correctly is when my tape drive was 
>about to die, I suspect you may be encountering drive problems.  You can
>try cleaning it- it should have come with a cleaning cartridge.

Yes I thought so too for a while.  A search of Dejanews will show that
a few people do indeed have the same trouble as me though.

Since then, and having tested a great number of back up programs, the
only one that works for me (same tapes, same drive as tested with
Ba/2) is Cristies PC-Bax.

Craig

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nothing I say is my own opinion (1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 15-Oct-99 14:35:11
  To: All                                               15-Oct-99 14:34:17
Subj: Re: PMMail, Attachments, and application calling

From: zayne@omen.com.au (Mooo)

I have the same problem.  Have yet to be able to work it out :(  My
associations are correct, because if I drag the attachment to the
desktop, then double click on it, it opens with the application I
want.

sigh..
Craig



John M Price PhD <jmprice@calweb.com> wrote:

>I have a strange problem with attachments.  Some work, others don't, and
>I can't see why.  For instance,  I have one with a .txt extension,
>properly opened by E.EXE, as noted in the settings.  However, I can't
>open the attachment, and I get a WinOS2 error message (!) about invalid
>path.
>
>I then typed the full path to the program, F:\EEE\E.EXE (which is on the
>path in config.sys) and still, a WinOS2 error.  I moved the %s to the
>program line, and I get, yep, a WinOS2 error.
>
>JPGs work, GIFs don't.  Go figure.  PMView is registered for all picture
>files, both within and without PMMail.  (Oh, and it is registerd withthe
>authors as well!)
>
>Any ideas here?  
>
>-- 
>John M. Price, PhD                                     jmprice@calweb.com
>Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
>  Email responses to my Usenet articles will be posted at my discretion. 
>Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
>                     Syndicate Section III - Number 1
>
> If you don't want to convict the innocent, you have got to pay a
> price. The price is to acquit a certain amount of guilty people. The
> question is: how many guilty people are we prepared to acquit on the
> basis of reasonable doubt in order to be sure we are not convicting
> the innocent?
>           - Chief Justice Antonio Lamer
>             Supreme Court of Canada
>             quoted in: HALIFAX DAILY NEWS  February 7, 1999
>
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nothing I say is my own opinion (1:109/42)

+----------------------------------------------------------------------------+

From: jabraham@ucalgary.ca                              15-Oct-99 11:09:03
  To: All                                               15-Oct-99 21:58:13
Subj: Best way to get Wordpro Documents into StarOffice?

From: John Abraham <jabraham@ucalgary.ca>

I've installed StarOffice and want to give it a try.  But it doesn't
convert my Lotus WordPro files (it just launches WordPro when I try to
open them.)

What's the best way to get them in?  Should I "save as MSWord" from
Wordpro?  Or RTF? Or AmiPro?

Or is it supposed to be able to convert them directly?

-- 
John Abraham, M.Sc. P.Eng.
T.J. Modelling Ltd.
Mathematical Modelling for Transportation Planning and Urban Design
jabraham@ucalgary.ca

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Calgary (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          15-Oct-99 17:36:01
  To: All                                               15-Oct-99 21:58:14
Subj: Re: Current Java?

From: piquant00@uswestmail.net (Annie K.)

On Fri, 15 Oct 1999 09:50:28, Will Rose <cwr@cts.com> wrote:

:I haven't kept current with OS/2 and Java.  What's the current level
:of Java available under Warp 4.0?  

 1.1.8

:Is it automatically updated in
:the Warp 4.0 Fixpacks?  

 No.

:If not, where are updates to be found?

 I usually get them from ftp.hursley.ibm.com.

-- 
Klaatu barada nikto

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: bd83h@bedford.waii.com                            15-Oct-99 17:34:00
  To: All                                               15-Oct-99 21:58:14
Subj: OD - alternatives?

From: Steve Drewell <bd83h@bedford.waii.com>

The main (and probably only) things I use Object Desktop for are the
enhanced folders and the zip/rar/etc archive utilities. I already use
Xfolder and can therefore do away with the OD enhanced folders. However,
it is the zip/rar/etc archive utilities which I'd miss the most should I
uninstall OD. Are there any decent alternatives to this functionality of
OD where an archive is shown and treated in a similar way to a normal
folder, and files can be dragged and dropped to or from the archive?

Cheers,
Steve


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Western Geophysical, Houston, TX (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    15-Oct-99 17:15:27
  To: All                                               15-Oct-99 21:58:14
Subj: Re: cdwriter support

From: rcpj@panix.com (Pierre Jelenc)

Anssi Saari  <as@sci.fi> writes:
> 
> Oh sorry, now I understand. You're using some weird front end. Just a
> guess, but maybe you should specify the device in cdrecord syntax,
> 3,0? Or maybe, if you just set the environment variable CDR_DEVICE you
> don't need to guess what the author had in mind?

It's CDwriter. 

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  15-Oct-99 14:21:11
  To: All                                               15-Oct-99 21:58:14
Subj: Re: another OT about e-mail addresses

From: mchasson@ibm.net

In <3805E176.72815DBA@ibm.net>, on 10/14/99 at 02:58 PM,
   Tony Wright <horseman@ibm.net> said:

>Buddy Donnelly wrote:

>> complaining that newcomers to your address couldn't figure out how to mail
>> to you.
>>

>Tch, Tch.... "Methinks he doth protest too much"! 
>Stop pursuing and defending the fact of why you jumped to an invalid
>conclusion - you're straying out of character now...Benedick Prince of
>Padua:
> "I'll tell thee what prince;  a college of wit-crackers  cannot flout me
>out of my humour. Does thou think I care for a satire or epigram? No: if
>a man will be beaten with brains, a' shall wear nothing handsome about
>him.  ("Much ado about Nothing")  <g>

>--
>Rgds Tony W   Email: horseman@attglobal.net


Ah...of course.  I know now that Buddy is a candidate for the HLAS
newsgroup.  (Humanities.Lit.Authors.Shakespeare).  There are truly mind
boogling and bending types populating that territory who Buddy could use
to vent his spleen upon and therefor save us to enjoy the benefit of his
excellent insights on op sys questions.  

Of course Buddy may be one of them.  That is Oxfordians, and Baconians,
and anyone but WS wrote those plays, but I think not, and  he will enjoy
the many enlightened and illuminating discussions from people who really
know the Bard. -- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: psmedley@my-deja.com                              15-Oct-99 20:36:28
  To: All                                               15-Oct-99 21:58:14
Subj: Pronews/2

From: psmedley@my-deja.com (Paul Smedley)

Hi,
Just wondering if anyone knows a way in Pronews/2 to set it to 
automatically download the bodies of all messages on startup?  I know 
that I can hit the A key on startup to download all bodies for all 
groups but this is a pain.  I may be blind, but I can't see a way to 
do this in the default Group settings.

Thanks in advance for any help.

Seeya,

Paul Smedley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"attglobal.net                     15-Oct-99 18:06:21
  To: All                                               15-Oct-99 21:58:14
Subj: Re: CHKDSK problem 

From: doug.bissett"at"attglobal.net (Doug Bissett)

On Fri, 15 Oct 1999 13:00:10, Siobhan Perricone 
<morgannalefey@my-deja.com> wrote:

> In article <38065ba5$2$lllp186.vyyrtnygbfcnz$mr2ice@news-
> s01.ny.us.ibm.net>,
>   yyyc186.illegaltospam@ibm.net wrote:
> > In <7u4q4f$m8r$1@nnrp1.deja.com>, on 10/14/99
> >    at 02:42 PM, Siobhan Perricone <morgannalefey@my-deja.com> said:
> >
> > Clean your floppy drive, then buy a new floppy.  That error is caused
> by
> > dirt on the floppy head or a damaged floppy disk.
> 
> Thank you for this helpful response. :)
> 
> Turns out y'all were right (not that I expected anything less).  I made
> a new set of recovery disks with fresh new floppies and it works fine.
> 
> NOW I have a stupid chkdsk thing that's coming up.
> 
> I'm going through the notes people have sent me on the best way to
> procede with this back up and restore test I'm going.  So I obediently
> try to do a chkdsk on the c: drive (that's my boot drive and the only
> drive with anything on it, the other two are blank).  I get a message
> telling me there's an allocation error in c:\os2
> \help\_<somefilename>.db but it can't fix it because I didn't use
> the /f switch.
> 
> So I do help on chkdsk and read about the /f switch (someone had
> suggested I use /f:2 so I look that up as well).  My interpretation of
> what the help file says is that you need the /f (or /f:n) switch in
> order for chkdsk to fix the errors it finds, but that you can't use it
> from the drive you boot from.  I say "OH" and reboot using the utility
> disks.  After some wrangling with commands and finally putting the
> right disk into the drive, I try the chkdsk /f:2 thing.  It tells me
> the disk is locked.  I try chkdsk /f.  Disk is locked.  Then just
> chkdsk.  It goes through the process and tells me there were no errors
> reported.  So I try booting back up normally, and running chkdsk again
> on the c: drive and it gives me the SAME allocation error on that file.
> 
> So what am I doing wrong?
> 
> --
> Siobhan Perricone
> PC Technician
> Alltel Information Services
> (I only speak for myself, not for Alltel)
> 
> 
> Sent via Deja.com http://www.deja.com/
> Before you buy.

I see (from another post) that you figured out your problem. I just 
wanted to emphasize that "/F", is used on a FAT formatted drive, while
"/F:2" is used on a HPFS formatted drive.

As for the "recovery" disk thing. The BEST approach, that I have 
found, is to ignore the BA/2 thing to modify the UTILITY diskettes, 
and ignore the OS/2 thing to make the UTILITY diskettes, and use the 
BOOTOS2 utility to make a set of boot diskettes (which end up being 
customized for your machine, rather than having a LOT of useless stuff
on them. Use the 2 disk method, it works better). Then just take a 
blank diskette (freshly formatted is a good idea), and look up the 
list of files that are required to run the CLREST program (the list is
in the BA/2 book). Now, you have a set of 2 diskettes (rather than 4. 
The last of the 4 only has a bunch of utilities on it, and you don't 
need it to get to a command line) to boot with (the second diskette 
has the "usual" utilities on it). To use the BA/2 standalone restore, 
just pop the diskette, with the listed files, into the drive, and type
CLREST.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at attglobal.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: ahc@YY.lanl.gov                                   15-Oct-99 13:48:17
  To: All                                               15-Oct-99 21:58:14
Subj: NS 4.04 & NS 4.61 characters

From: "Allen Cogbill" <ahc@YY.lanl.gov>

I've been using NS 4.04 until today, when I installed NS 4.61. Under 4.04,
I've had a problem displaying the degree symbol (code table value 248 when 
using Code Table 850; the HTML code number is 176). I was hoping that that 
problem would go away after installing NS 4.61, but the problem remains. 
What should be the degree symbol appears as a square pattern of 9 small, 
solid squares. Note that when using WebExplorer, the degree symbol is 
displayed correctly.

I'm using Warp 4 Fixpak 5, and my font display is set to "Western".

Anyone know what's going on?

Thanks,
Allen Cogbill


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Los Alamos National Laboratory (1:109/42)

+----------------------------------------------------------------------------+

From: nospam_hkelder@capgemini.nl                       15-Oct-99 21:48:29
  To: All                                               15-Oct-99 21:58:14
Subj: Re: Long filenames and OS2 16-bit apps

From: Henk kelder <nospam_hkelder@capgemini.nl>

You should create a .DEF file and mark the application as being capable
of long filenames.

e.g.
---------- cut here --------------
NAME myprog WINDOWCOMPAT NEWFILES
PROTMODE
---------------------------------

The NEWFILES keyword does the trick.

Henk

hrishikesh@cybermedia.co.in wrote:
> 
> Hi All,
> 
> I am new to OS/2 and this newsgroup. I am working on a command line
> 16-bit OS/2 application to scan files in a specified directory and
> process them.
> 
> To open the files, I'm using DosOpen2 which works for file names in old
> DOS 8+3 format. But it fails to open files with long filenames. The
> documentation which comes along with the watcom compiler, says that
> DosOpen2 function handles long filenames. The DosOpen2 returns an error
> code 206 which is buffer exceeded. Do I have to set any flags prior to
> using this call ? Or Am I using a wrong function ?
> 
> Thanks,
> 
> Hrishikesh.

-- 
Remove nospam when replying..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: capgemini.nl (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               15-Oct-99 21:11:05
  To: All                                               15-Oct-99 21:58:14
Subj: Re: OD - alternatives?

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Steve Drewell schrieb:
> 
> The main (and probably only) things I use Object Desktop for are the
> enhanced folders and the zip/rar/etc archive utilities. I already use
> Xfolder and can therefore do away with the OD enhanced folders. However,
> it is the zip/rar/etc archive utilities which I'd miss the most should I
> uninstall OD. Are there any decent alternatives to this functionality of
> OD where an archive is shown and treated in a similar way to a normal
> folder, and files can be dragged and dropped to or from the archive?

Hm, there are shareware-programs like RPF Zipcontrol and WarpZip, but
AFAIK they are not as tightly integrated into the WPS as OD's object
archives. On the other hand, why throw away the good things of Object
Desktop? All you need to do is deinstall the Enhanced Folder features by
using the normal install facility or simply deregistering the
TSEnhancedFolder class via XFolder. That's what I've done and it works
great.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  15-Oct-99 20:17:17
  To: All                                               15-Oct-99 21:58:14
Subj: (No subject)

From: l_luciano@da.mob (Stan Goodman)

I have just downloaded and installed the new JStreet (Band) Mailer pvk11 
version. It runs, of course, but it has at least two annoying, newly 
introduced bugs:

1) Although the message font (i.e. that in the browser window) is now 
"fully confugurable", it is not persistent. If you change folders, the 
default size (too small on my screen) is restored, and one has to specify 
the font anew for with each and ever folder change. Not the way it is 
intended to work, I trust.

2) When the program comes up, not all the lines in the message-list window 
have icons (showing which are still unread) at the left side. A little 
scrolling brings back the missing icons. This one is far less bothersome 
than the first one.

Sorry to have to report this here rather than on the users mailing list. 
Only members can post there, and I do not wish to receive messages from the
list.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: kemitche@earthlink.net                            15-Oct-99 12:48:10
  To: All                                               15-Oct-99 21:58:15
Subj: Screen cam software?

From: Ken <kemitche@earthlink.net>

Hi all,

Does anyone have any recommendation for a screen cam (not capture, but
that can be an additional feature...) app for Warp4?  I'm looking for
some cross platform - at least be able to create an avi.  I've looked
and can't seem to find any.

Many thanks!

Ken Mitchell
HDS San Diego


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: bschwand@dvart.com                                15-Oct-99 13:47:08
  To: All                                               15-Oct-99 21:58:15
Subj: Re: Print to graphic [was Re: METAFILE CONVERTION]

From: bruno schwander <bschwand@dvart.com>

the best in my opinion is to print to a postscript file using a postscript
printer
driver.
then use ghostscript to create an EPS file from it.

I love postscript, if anything goes wrong, you can always look at the source
code :-)

bruno

Mat Kramer wrote:

> A more general question: is there a printer driver that will allow
> output to be saved as a file and then imported into Word 97 as a
> graphic?  Word will import HPGL -- which driver should I use for that?
>
> bv wrote:
> > You could get the Windows metafile into an OS/2 metafile format simply by
> > printing it under WinOS/2 and intercepting the spoolfile. The spoolfile is 
an
> > OS/2 metafile, but it is probably not in a format your application will be 
able
> > to handle.
> >
> > I think the best way is to convert them to a format like EPS, and exchange
> > that. This should work for some types of metafiles.
>
> --
> Mat Kramer [MekTek] mek@compuserve.com
> VyperHelp: http://ourworld.compuserve.com/homepages/mek/vyper.htm

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  15-Oct-99 20:35:18
  To: All                                               15-Oct-99 21:58:15
Subj: New J Street mailer update

From: l_luciano@da.mob (Stan Goodman)

Sorry for the missing subject.

My original message was in error. The message font isn't persistent at all;
you have you respecify it again each and every time you look at a different
message. 'Tain't tolerable.


On Fri, 15 Oct 1999 20:17:35, l_luciano@da.mob (Stan Goodman) wrote:

> I have just downloaded and installed the new JStreet (Band) Mailer pvk11 
> version. It runs, of course, but it has at least two annoying, newly 
> introduced bugs:
> 
> 1) Although the message font (i.e. that in the browser window) is now 
> "fully confugurable", it is not persistent. If you change folders, the 
> default size (too small on my screen) is restored, and one has to specify 
> the font anew for with each and ever folder change. Not the way it is 
> intended to work, I trust.
> 
> 2) When the program comes up, not all the lines in the message-list window 
> have icons (showing which are still unread) at the left side. A little 
> scrolling brings back the missing icons. This one is far less bothersome 
> than the first one.
> 
> Sorry to have to report this here rather than on the users mailing list. 
> Only members can post there, and I do not wish to receive messages from the
> list.
> 
> -------------
> Stan Goodman
> Qiryat Tiv'on
> Israel
> 
> Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
> 
> 


-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: william1@teleport.com                             15-Oct-99 17:01:12
  To: All                                               15-Oct-99 21:58:15
Subj: 3D graphics programs?

From: williamd <william1@teleport.com>

Could anyone recommend some good 3D graphics programs that would work 
under Warp 3? Especially those that can easily be used in website 
creation?

Thanks for any suggestions. 

Bill

__
william1@teleport.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Teleport Inc. (1:109/42)

+----------------------------------------------------------------------------+

+============================================================================+
