
                   comp.os.os2.apps                 (Usenet)

                 Saturday, 04-Sep-1999 to Friday, 10-Sep-1999

+----------------------------------------------------------------------------+

From: raphaelt@netnews.worldnet.att.net                 03-Sep-99 00:33:28
  To: All                                               04-Sep-99 05:58:09
Subj: Re: AOL Instant Messenger for OS/2 ????

From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum)

dagroe-nospam@messagehost.net (Dean Groe) wrote:

>On Sat, 28 Aug 1999 00:10:48, donm@ftel.net (Don Morse) wrote:
>
> 
>> is there a new Java version????  I'm running the olderclient here as
detailed
>> below, but I'd love to try a newer version
>> 
>Does this mean that you have AIM for Java running with 1.1.7? I have 
>been trying like crazy to make it fly, but no luck. I was hoping that 
>I would not have to download the 1.1.8 that is currently available. I 
>think that it is only the full JDK right now. All I need is a JVM. 
>
>Every time I try to launch AIM Java, I get a tiny window that says log
>(login maybe?) that cannot be adjusted and in the Java screen is see 
>errors about invalid functions, or something like that. I do not have 
>it on this computer and do not have the messages written down. I just 
>assumed it was a lack of functionallity on the part of OS/2 Java 1.1.7
> I do have other Java apps running OK. 

One thing: you need to be sure the cmd file you use to start
AIM-Java is in the same subdirectory as AIM.jar and all the
other things that unzip out of aim_generic.zip in the
distribution (i.e., in the /AIM subdirectory).  Once I fixed
this, it worked fine with 1.1.7.
 

-- 
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: mtve@hal-pc.org                                   03-Sep-99 11:31:28
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Word Pro page numbers shouldn't be this hard!

From: Marvin Volz <mtve@hal-pc.org>

It's not!
Under Text|Create page number:
Fill in type of number or letter, any text or spaces before or after, what
number to
start with.
Under "Options" indicate what page to start on.

MTV

rdegenna@utk.edu wrote:

> I admit it.  I'm stumped by another easy one.  I want the first page of a
> document to have no page number, and the second page to be numbered 1.  I've
> tried page layouts, sections, etc but can't get it to work.  I either get a
number
> on the first page (which I don't want), or the second page is numbered 2
rather
> than 1, or I get no page numbers at all.  I'm using WordPro 1.1.
>
> This can't be that hard ...
>
> Ray



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Houston Area League of PC Users, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         03-Sep-99 17:26:26
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Word Pro page numbers shouldn't be this hard!

From: racette@cablevision.qc.ca (Martin Racette)

On Fri, 3 Sep 1999 15:43:40, 
rdegenna@utk.edu wrote:

> I admit it.  I'm stumped by another easy one.  I want the first page of a 
> document to have no page number, and the second page to be numbered 1.  I've 

> tried page layouts, sections, etc but can't get it to work.  I either get a
number 
> on the first page (which I don't want), or the second page is numbered 2
rather 
> than 1, or I get no page numbers at all.  I'm using WordPro 1.1.
> 
> This can't be that hard ...
> 
> Ray

I just tried it, and it does work the 
way you want, here's how:

in the "Insert a page number" dialog 
choose the option and then tell it to 
start numbering from page 2 or 3 or 
etc...

//-------------------------
Good Luck

Bonne Chance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    03-Sep-99 11:25:05
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: "seth berk" <snberk@ibm.net>

On 3 Sep 1999 16:17:43 GMT, R. G. Newbury wrote:

>It very quickly reaches the point where getting a US P.O Box makes 
>sense. And the USPost is open about 363 days a year (AFAIR, only July 
>4 and Dec 25 closed, unlike CanPost).

But at what cost to my time?  I can't remember I popped across the
border, and with the lineups, well is it worth a half day to save
$30?  Plus the aggravation... not at this point.  


>
>Declare your purchase as your groceries......
>
>P.S. I think that the feds collecting PST (or the provinciales 
>collecting PST) at the border is unconstitutional. No 'sale' takes 
>place within the province. And if the assertion is that it's because 
>it is imported, customs is a federal regime (and the BNA act (sorry 
>Constitution Act) has a specific proscription against 'customs' duties
>between provinces.
>
>Of course, arguing with a customs agent about not collecting money is 
>kinda like arguing with city hall.......

Worse than City Hall, when was the last time a City Hall clerk strip
searched you?  I have had no problems at the border, and plan to keep
it that way!  My brother-in-law worked for Canadian Customs for
awhile, the powers that they *legally* have at the border is scary
(both sides, the US is similar in what they can do) - at least our
guys don't carry guns.  In Montana they are pilotting a new customs
building on the border where both the Canadian and US agents share
the same building.  Saves money.  They had to put the washrooms on
the US side of the building so that the US agents wouldn't have go
through the paper work of bringing them across the border everytime
they wanted to use the washrooms, and I guess the US agents didn't
like the idea of taking the guns off and leaving them on the US side
to use the washrooms.

Seth

>
>Geoff 
>
>
>
>On Thu, 2 Sep 1999 14:01:56, pasnak@delete.cableregina.com (J.P. 
>Pasnak) wrote:
>
>>
> 
>> 
>> I thought there might be a way around this, but it seems Sun Canada is
>> temporarily offline. (see below).  I wonder what the total cost would 
>> be if I ordered 10 CDs from the states?  GST is something we have to 
>> live with, but I wonder what other 'import' taxes Customs would add?
>> 
>Disclaimer: Unless explicitly mentioned otherwise, I speak for and 
>have always spoken for the company I work for. I am the fool company I
>work for.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: gholden@see.my.sig                                03-Sep-99 17:59:01
  To: All                                               04-Sep-99 05:58:10
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: "Gerard Holden" <gholden@see.my.sig>

On Wed, 01 Sep 1999 16:17:42 -0600, Kris Kadela wrote:

>seth berk wrote:
>> 
>> Anyone in Canada want to sell me a copy of their StarOffice CD?  I
>> would love to save the shipping and handling costs.  (To our US
>> friends, Canada Customs will assess a 7% GST (a sales tax) on the $16
>> ( a little over a dollar) and *then* add a $5.00 handling fee to
>> cover the cost of collecting the $1.12!!!! [smiley thing with the
>> tongue sticking out])
>
>Don't forget the GST on the handling fee as well. Just a week ago I
>bought a motherboard from US.
>
>The board was $100 US ($149CAD) plus $30CAD shipping ($170CAD) plus
>Money Order charge $4CAD.
>Guess what the duty charge was ..... $48CAD!!!! and then they charged
>GST on the duty ($3.50CAD) plus $8 brekerage fee plus GST on the
>brokerage fee = Total almost $250 CAD!! with $70 of that in taxes.
>Thank you Jean.
>
>Isn't this funny in a weird kind of way? We are being skinned alive
>here.
>
>:)))

Australia gets a 10% GST in July 2000. Sounds like next year we'll be
having the same sort of fun that you are having now. I wonder what the
S&H is to Australia. I'll check out the Sun site.

--

Gerard Holden
gholden(at)pcug(dot)org(dot)au


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Yeah right! (1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                03-Sep-99 13:43:15
  To: All                                               04-Sep-99 05:58:10
Subj: Re: BootManager Gone

From: John M Price PhD <jmprice@calweb.com>

Be sure to mark the Bootmanager partition as startable.  Otherwise, all
you'll ever get is windows.


In comp.os.os2.apps article <7qmh55$cd3$1@fir.prod.itd.earthlink.net> Alex
Smariga <smariga@gte.net> wrote:
: On Thu, 02 Sep 1999 15:09:30 GMT, Milind Rao wrote:

:>On Thu, 2 Sep 1999 10:19:22, Alex Smariga <smariga@gte.net> wrote:
:>
:>> On Wed, 01 Sep 1999 17:15:41 -0400 (EDT), gordon mcleod wrote:
:>> 
:>> >I had to install win95 on my laptop that had bootmanager with dos/os2
:>> >win95 deleted the bootmanager can it be re activated easily
:>> >
:>> If in Win95 you start up FDISK, you will see that the "active" partition
:>> is the Win95 partition.  Make the boot manager partition the active one,
:>> and you will be back in business.  Also, while you are there, add the 
:>> Win95 partition to the boot manager, and you can swap back and forth.
:>
:>Can you add a bootmanager menu from Window's FDISK?
:>
: Good point.  You'll have to reboot to OS/2, and then using the OS2 
: FDisk, add the Win95 partition to the boot manager.  Then you will be in
: good shape.






-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

But it is also the case that whenever an intellectual discipline produces
what appears to be an important breakthrough in our understanding of the
world, whether it be racial theory or chaos theory, the chances are that
it will be appropriated by people whose most striking characteristic is
their lack of intellectual discipline. 
	- Damian Thompson 5Mar97 Gaia Anti-Christ, Kingston University

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: bill.m@no.spam.net                                03-Sep-99 20:49:27
  To: All                                               04-Sep-99 05:58:10
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: bill.m@no.spam.net

On 3 Sep 1999 16:17:43 GMT, R. G. Newbury wrote:

>It very quickly reaches the point where getting a US P.O Box makes 
>sense. And the USPost is open about 363 days a year (AFAIR, only July 
>4 and Dec 25 closed, unlike CanPost).

There are some 'bugs' in your suggestion:
 >It very quickly reaches the point where getting a US P.O
Box makes  >sense.

Fedex, UPS, Airborne, ect. will not/can not deliver to a
P.O. box and most senders use these services.

> And the USPost is open about 363 days a year .

Well the building is and you can have access to your P.O.
Box but those are for letters! If you have a package ....
well they don't fit!!! Come back tomorrow during business
hours, that is if it is not Sunday or one of a number of
holidays.

Have a good one!

wmmorrow (at) flash (dot) net 
 All opinion expressed are my own - no one else believes
them.


Bill M.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: JeremyB@clear.net.nz                              31-Aug-99 22:47:26
  To: All                                               04-Sep-99 05:58:10
Subj: Communicator Startup Bug

From: Jeremy Bowen <JeremyB@clear.net.nz>

Can anyone point me to a reference to the Communicator 4.61 command
line options. I wish to create Icons on the desktop for different
users and have it startup using the correct profile.

I seem to remember from older versions something of the form 
"netscape -mail -p Jeremy" which would startup in the mail view
using my profile.

When I try this now, I get:
'Communicator cannot use the profile "-mail", because the directory 
containing the profile has been moved or deleted'

-- 
 /----------------------------------------------------------\   o@C>-  
|  <Jeremy Bowen> | "It's a question of intelligence         |  __/___  
|   JeremyB@clea  |  so your opinion has very little         | {_XX_(_@=
|     r.net.nz    |  relevance" . . . Avon  Blake's 7        | o@C>-    
 \----------------------------------------------------------/    o@C>-

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CLEAR Net New Zealand (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       03-Sep-99 22:21:04
  To: All                                               04-Sep-99 11:08:13
Subj: Re: Process Commander and DOS box.

From: Will Rose <cwr@cts.com>

Will Rose <cwr@cts.com> wrote:
: J. R. Fox <jr_fox@earthlink.net> wrote:
: : Will Rose wrote:
: :> 
: :> I've been hunting down problems with Process Commander, and have found
: :> an odd one; the full-screen version seems to prevent a DOS box running
: :> more than once.  That is, you can start a windowed DOS session just fine,
: :> but if that window is closed and you try to re-open it you get an error
: :> message "Cannot run" or words to that effect.  I've been trying to find
: :> this problem's source for some time; at a guess it appeared with FP 22.
: :> However, I've confirmed its appearance and disappearance with Process
: :> Command 1.02 and FP 40.
: :> 
: :> Anyone seen anything similar?  I very much like Process Commander - it's
: :> not the essential that it used to be, but I still miss it a lot.
: :> 
: :> Will
: :> cwr@crash.cts.com

: : No, not that one, but PC's replacement of some key system files
: : can cause problems elsewhere, with things like UniMaint's Desk-
: : top Reset feature (replaces the WarpCenter with garbage, dtop
: : does not repopulate, may screw up you video; you just have to
: : try to shutdown and Reset).  There are some backup issues -- 
: : can't recall everything right now.  Anyway, these problems were
: : supposedly corrected for Object Desktop, fairly recently, but
: : AFAIK have not been addressed yet with PC.

The first problem was the Process Commander version; 1.01 works, 1.02
doesn't, with any OS fixpack, and I was confused as to the PC version
I was running/testing.

That being said, PC won't install on FP 040, but it's just a dumb
installer.  If you patch DOSCALL1.DLL the way PC wants it, it runs
fine.  Thanks to whoever brought the 1.01/1.02 glitch to my notice.


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: jpedone_no_spam@flash.net                         03-Sep-99 23:22:10
  To: All                                               04-Sep-99 11:08:14
Subj: Re: AOL Instant Messenger for OS/2 ????

From: jpedone_no_spam@flash.net

In <nPjQEKcYsLZr-pn2-dLGUr6kOtgYH@DAGROE_OS2WS01>,
dagroe-nospam@messagehost.net (Dean Groe) writes:
>On Sat, 28 Aug 1999 00:10:48, donm@ftel.net (Don Morse) wrote:
>
> 
>> is there a new Java version????  I'm running the olderclient here as
detailed
>> below, but I'd love to try a newer version
>> 
>Does this mean that you have AIM for Java running with 1.1.7? I have 
>been trying like crazy to make it fly, but no luck. I was hoping that 
>I would not have to download the 1.1.8 that is currently available. I 
>think that it is only the full JDK right now. All I need is a JVM. 
>
I've run it with both 117 and 118.  If it helps, here is the cmd file I 
use:

set java_compiler=JAVAX
set CLASSPATH=AIM.jar;%CLASSPATH%
java.exe main.Oscar


Remember also that java is case sensitive...


 
J. Pedone
jpedone@flash.net
http://www.flash.net/~jpedone
 
You're throwing it all out the Windows!
But I forgot all about the Amnesia Conference!!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: srd@x.mcmail.com                                  04-Sep-99 01:27:02
  To: All                                               04-Sep-99 11:08:14
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: Steve Drewell <srd@x.mcmail.com>

On Thu, 02 Sep 1999 at 08:03 +1200, Craig Benbow
<benbowc@tui.lincoln.ac.nz> wrote:

>That would be fine but the damn thing is passworded to the ftp server! I
>have had to bitch about this to support before but as usual no action.
>You would think that if we are logged in to the devcon that we could be
>trusted with an ftp password!

>Craig

>Philip Nelson wrote:

>> If it fails use WGET with the -c option to restart the download.


Why not try AWget and use the entire http url of the file given on the IBM
web page? The download url will automatically get redirected to the ftp
site and if the ftp password changes whilst you're disconnected then on
reconnection move the url object from the AWget failed folder to the ToDo
folder. Download will continue from where it was previously stopped and
there's no need to manually think about passwords.

Cheers,
Steve
-- 
Steve Drewell             (Remove x. from address to reply)
_____________________________________________________________
Using IBM OS/2 Warp 4 running 25 processes with 132 threads.
Machine uptime is 2 days, 1 hour, 31 mins and 44 secs.
_____________________________________________________________


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: PGegen@UKans.nolospamare.edu                      04-Sep-99 02:31:13
  To: All                                               04-Sep-99 11:08:14
Subj: Re: Important News From Dan Porter of Innoval

From: PGegen@UKans.nolospamare.edu (Dr. Peter Gegenheimer)

On Mon, 30 Aug 1999 05:37:44, sdenbes1@san.rr.com (Steven C. Den Beste) wrote:

 How about more intelligent filtering? (Agent lets me use regular expressions
 on the subject line, but I'd like to be able to filter on the contents of a
 message, so that anything which contains the phrase "MLM" goes straight into
 the trash bin.) Automated responses to messages? ("I'm on vacation right
 now, but I'll get back to you in two weeks.")
 

Guess What?  Post Road Mailer 3.0 lets you do both of those things. Trivially. 

(It also can pull only your mail from a shared ISP account, which I need.)

o----------------------------------------------------------------------o
| Dr. Peter Gegenheimer       | Vox: 785-864-3939  FAX: 785-864-5321   |
| Department of               |   PGegen@UKans.nospam.edu              |
|   Molecular Biosciences     |   http://rnaworld.bio.ukans.edu/       |
|   & Dept. Evol Biology      |                                        |
| University of Kansas        |"When you have excluded the impossible, |
| 2045 Haworth Hall           |  whatever remains, however improbable, |
| Lawrence  KS  66045-2106    |  must be the truth."      S. Holmes    |
o_____________________________|________________________________________o

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Univ. Kansas (BCMB) (1:109/42)

+----------------------------------------------------------------------------+

From: wwiv@pppproject.org                               04-Sep-99 00:47:22
  To: All                                               04-Sep-99 11:08:14
Subj: Re: Swap File

From: "Dilbert Firestorm" <wwiv@pppproject.org>

RE: Re: Swap file
BY: doug.bissett"at"ibm.net (Doug Bissett)

>Yes, Netscape, and StarOffice are real memory hogs (imagine the amount
>of real memory you would need, if memory swapping didn't exist). 
>I have 64 meg, of memory, and I use a 70 meg swap file. I started with
>a 60 meg swap file, but found that it would grow sometimes (more often
>than I liked). The 70 meg swap seems to handle almost everything. 
>The performance ramifications are that if your swap file is too small,
>you will use excessive time managing the growth, and shrinkage (if it 
>will shrink). You are far better off to have a swap file that is too 
>large, than to have one that is too small. 
>The trick is to figure out an optimum size for your specific system. 
>From what you have said (above), I would set the swap file to 70 meg. 
>Of course, that would depend a lot on how much disk space you have.

Doug,

Would not having a large swap file cause netscape/2 2.02 to have a memory
leak?

I had this program (memstat) that kept track  of three things, memory,
swapfile
and drive size.  I watched the memory usage decrease, and then the swap space
decreased in size.



Origin: Nuclear Wasteland * 504-394-0509


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nuclear Wasteland * 504-394-0509 (1:109/42)

+----------------------------------------------------------------------------+

From: horseman@ibm.net                                  03-Sep-99 10:04:25
  To: abacab@swissonline.ch                             04-Sep-99 11:08:14
Subj: Re: Problem defining mapping in Organizer

To: Francois Hurter <abacab@swissonline.ch>
From: Tony Wright <horseman@ibm.net>

Francois Hurter wrote:

> Hi,
> When I'm exporting addresses from the Organizer and using the "All Fields"
mapping,
> everything is ok.
> As soon as I'm defining my own mapping, I get an
> Error 23 (Ox17) ERROR_CRC Data error (cyclic redundancy check) occured on
"".
> Has anybody seen this ?
> Regards
> Francois

 Known problem (also seen in several Win versions over the years!)
already reported to Lotus although personally I'm unable to confirm
and/or ascertain a trouble ticket number from others who have also
"allegedly" reported it....  :-(
I kludge it by not exporting in CSV but "stage" via DBF export(and not
attempting any custom mapping) and manipulate required fields in say
Approach, then export from that......
Perhaps others have a more elegant(less tedious) work-around?.
--
Rgds Tony W   Email: horseman@ibm.net

"humanum est errare: To err is human
.... and to fail is to be a Project Manager...
...but to foul things up completely needs a computer!"


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Equi-Tek CompCon (1:109/42)

+----------------------------------------------------------------------------+

From: ctodd@magiclink.com                               04-Sep-99 02:34:03
  To: All                                               04-Sep-99 11:08:15
Subj: Re: Can't type in DOS box after 50 days

From: "Chuck Todd" <ctodd@magiclink.com>

On Fri, 03 Sep 1999 10:56:28 -0500, Jim Lewis wrote:

>Joerg Tiemann wrote:
>
>> On Tue, 31 Aug 1999 12:38:54 -0500, Jim Lewis <jklewis@nospam.com> wrote:
>> >  Has anyone seen this problem? After about 50 days uptime my DOS
>> > Windowed sessions do not allow any keys to be typed. The Num Lock and
>> > Caps Lock lights don't even come on. This only happens in the DOS
>> > Window, the rest of the machine is fine including DOS Full Screen
>> > sessions. It doesn't matter if I open new DOS Windows or how I open
>> > them. A reboot of course "fixes" this problem for another 50 days.
>>
>>   I have OS/2 2.1 installed on an old 386sx notebook. Current uptime is
>> 123 days, no problem with DOS windows here. As for OS/2 Warp - well,
>> never tried that 'protectonly=no' thingy! ;-)
>>
>> --
>> tiemannj@gmx.de
>
>
>  I must be doing something strange on both machines for this to be
>happening only to me. My Memory Status app does have a kludge in it to get
>around the uptime-at-49-days-wraparound bug but I can't imagine how that
>could effect a DOS box. Too weird.
>
> You say your 2.1 box shows an uptime of 123 days? What program are you
>using to get that info? Does 2.1 not have the uptime wrap bug?
>
>
>--
>
>Jim Lewis
>Not speaking for IBM.
>Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis
>
>

I don't have any problem with Dos windows, or OS/2 windows or FS.  I am not
sure how long my 
machine has been up.  A Distributed Net Cracker Session has 59 + day
currently.  A uptime 
program which worked the last time I tried it now displays Negative Uptime??


 2-25-96   7:39p     78357           0  UPTIME.EXE

This machine's uptime is -20d -7h -52m -8s & -897 milliseconds.
Send your comments to: tomkat@feldspar.com.
Greetings to: Vip, Recoil, Mandie, Lucien, Dandaman, and whoever else
That felt very c=64`ish.    - Dave Minogue

This machine's uptime is -20d -7h -52m -2s & -678 milliseconds.
This is a very simple program, it tells you how long it has been since you
last
rebooted your system. In short your uptime.
This software is freeware, public domain, as in I don't care what you do with
it.  If you have any problems with this program mail me, and I will see what
I can do.  Mail me if you find it useful(I like mail).

This machine's uptime is -20d -7h -51m -58s & -928 milliseconds.
Uptime v1.0 by Dave Minogue
---------------------------

The only parameters available right now are:
-? * Which is what you are looking at currently.
-v * Product Information
-h * History of program
-i * Author Information

This machine's uptime is -20d -7h -51m -51s & -655 milliseconds.


Well if this is any help!



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://extra.newsguy.com (1:109/42)

+----------------------------------------------------------------------------+

From: no-one@nospam                                     04-Sep-99 12:30:09
  To: All                                               04-Sep-99 11:08:15
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: no-one@nospam

On 1 Sep 1999 01:29:14 GMT, chili@ibm.net (Gerry Chilibeck) wrote:

>When I installed fp11 6 weeks ago...I began to lose sight of the mail
>folders in PRMailer V3.0.  The folders and files still exist, the
>folders just disappear in the application.   Several others reported
>the same problem.

Hmmm, a similar thing has recently happened to me with PMMail and I
also have fp11.    This the culprit here as well ??

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: stephen@midac.splat.spam.com.au                   04-Sep-99 20:24:27
  To: All                                               04-Sep-99 11:08:15
Subj: Re: Communicator Startup Bug

From: stephen@midac.splat.spam.com.au (stephen)

This is busted in 4.61 beta 2, although it worked in Beta 1. I 
understand it is being attended to so should work in future versions.

On Tue, 31 Aug 1999 10:47:52, Jeremy Bowen <JeremyB@clear.net.nz> 
wrote:

> 
> Can anyone point me to a reference to the Communicator 4.61 command
> line options. I wish to create Icons on the desktop for different
> users and have it startup using the correct profile.
> 
> I seem to remember from older versions something of the form 
> "netscape -mail -p Jeremy" which would startup in the mail view
> using my profile.
> 
> When I try this now, I get:
> 'Communicator cannot use the profile "-mail", because the directory 
> containing the profile has been moved or deleted'
> 
> -- 
>  /----------------------------------------------------------\   o@C>-  
> |  <Jeremy Bowen> | "It's a question of intelligence         |  __/___  
> |   JeremyB@clea  |  so your opinion has very little         | {_XX_(_@=
> |     r.net.nz    |  relevance" . . . Avon  Blake's 7        | o@C>-    
>  \----------------------------------------------------------/    o@C>-

Regards,

Stephen

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: INIAccess Internet (1:109/42)

+----------------------------------------------------------------------------+

From: gczerw@home.No-Spam.com                           04-Sep-99 13:59:11
  To: All                                               04-Sep-99 16:39:02
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: gczerw@home.No-Spam.com (George Czerw)

I've been informed that the "connect" edition is for "Warp 3", better 
known as "OS/2 Connect".  Why didn't I think of that?  Guess I have a 
habit of ignoring the obvious... 8-)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: pasnak@delete.cableregina.com                     04-Sep-99 08:48:18
  To: All                                               04-Sep-99 16:39:02
Subj: PGPro Scripts

From: pasnak@delete.cableregina.com (J.P. Pasnak)

Does anyone know where I can find Rexx scripts for PhotoGraphics Pro?


J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: mcbrides@erols.com                                04-Sep-99 12:23:26
  To: All                                               04-Sep-99 20:09:00
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: mcbrides@erols.com (Jerry McBride)

In article <cnaqcvozarg.fhhim70.pminews@news2.ibm.net>,
"Philip Nelson" <pandpATibm.net> wrote:
>You can use it as a database (standalone) but not as a server (with remote
>clients).
>

Not even via JDBC? It's a nice offering, but a bit worthless then.


>The purpose (I guess) is to encourage more people to develop DB2 applications
>and / or gain DB2 skills, which should in turn lead to more sales of DB2
>Workgroup and Enterprise Editions (i.e. the servers).
>

Great. But how would one test it without remote access? It's a shame, but very
understandable.... I think...


--

*******************************************************************************

*            Sometimes, the BEST things in life really ARE free...           
*
*       Get a FREE copy of NetRexx 1.150 for your next java project at:      
*
*                     http://www2.hursley.ibm.com/netrexx                    
*
*******************************************************************************


/----------------------------------------\
| From the desktop of: Jerome D. McBride |
|         mcbrides@erols.com             |
\----------------------------------------/

--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TEAM-NETREXX (1:109/42)

+----------------------------------------------------------------------------+

From: obie@shadow.net                                   04-Sep-99 18:11:29
  To: All                                               04-Sep-99 20:09:00
Subj: Checker for Broken Links in Website

From: obie@shadow.net

I am looking for an OS/2 program that can spider my
Web site and find broken links. If you know of one please
email me: obie@shadow.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           04-Sep-99 19:25:07
  To: All                                               04-Sep-99 20:09:01
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Sat, 4 Sep 1999 16:23:53, mcbrides@erols.com (Jerry McBride) wrote:

> In article <cnaqcvozarg.fhhim70.pminews@news2.ibm.net>,
> "Philip Nelson" <pandpATibm.net> wrote:
> >You can use it as a database (standalone) but not as a server (with remote
> >clients).
> >
> 
> Not even via JDBC? It's a nice offering, but a bit worthless then.
> 
> 
> >The purpose (I guess) is to encourage more people to develop DB2
applications
> >and / or gain DB2 skills, which should in turn lead to more sales of DB2
> >Workgroup and Enterprise Editions (i.e. the servers).
> >
> 
> Great. But how would one test it without remote access? It's a shame, but
very
> understandable.... I think...
> 

If you write a Java program (using JDBC) that runs on the same 
machine that the Personal Edition of DB2 is installed on, and 
invoke that program through the Java RMI api's from another Java
program you can access the DB2 database from remote machines.

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: khr128@usa.net                                    04-Sep-99 19:31:29
  To: All                                               04-Sep-99 20:09:01
Subj: StarOffice and erratic mouse behavior

From: khr128 <khr128@usa.net>

Hi, everybody!

  After installing SO 5.1 I found that my mouse sometimes jumps all over
the desktop.
Sometimes it gets frozen, and only reboot gets it unstuck.

 Is there a fix for this problem?

Best,
Dmitri.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: madodel@ptdprolog.net                             04-Sep-99 20:46:13
  To: All                                               05-Sep-99 04:16:02
Subj: Re: PGPro Scripts

From: madodel@ptdprolog.net (Mark Dodel)

Try http://www.tstonramp.com/~freiheit/PGPro_Scripts_30.zip



On Sat, 4 Sep 1999 16:48:36, pasnak@delete.cableregina.com (J.P. 
Pasnak) wrote:

-)Does anyone know where I can find Rexx scripts for PhotoGraphics Pro?
-)
-)
-)J.P. Pasnak
-)Warped Systems
-)******************
-)http://members.xoom.com/Warped/every/everything.html
-)http://members.xoom.com/Warped/every/dirmap.html
-)http://clubs.yahoo.com/clubs/warpedusers
-)*******************


//---------------------------------------------------------
// From the Desk of: Mark Dodel, RN, BSN, MBA
//             Healthcare Computer Consultant
//                   madodel@ptdprolog.net
//    http://home.ptd.net/~madodel
//
//  For a VOICE in the future of OS/2
//             http://www.os2voice.org/index.html
//---------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PenTeleData http://www.ptd.net (1:109/42)

+----------------------------------------------------------------------------+

From: judithr@primenet.com                              04-Sep-99 14:15:15
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Checker for Broken Links in Website

From: judithr@primenet.com

Try Templeton  (tton* at Hobbes).  It has a demo period.  Major use
is downloading entire web sites for later viewing but it includes
html - browser-viewable output for broken links.  Also has an html
checker, I think. Not as fancy as something like Windows' LinkBot,
doesn't cost $250, either. 

I've been using it for 2+, it's in continual development/improvment.
Not dead-end software. 

>I am looking for an OS/2 program that can spider my
>Web site and find broken links. If you know of one please email me:
>obie@shadow.net


Judith Russell       
judithr@primenet.com                    
Saugus Web Coordinator
http://www.hart.k12.ca.us/saugus


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: steve53_remove_this@earthlink.net                 04-Sep-99 14:27:06
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Any experience with "TAME"?

From: steve53_remove_this@earthlink.net

In <7q6rkq$1cr$4@coranto.ucs.mun.ca>, on 08/27/99 
   at 08:15 PM, jdc0014@InfoNET.st-johns.nf.ca (John Hong) said:

>	I'm afraid it doesn't really do much with Win-OS/2, at least none  that
>I have seen.  I mean, with Win-OS/2 that is essentially running two 
>enviornments, back to back.  First OS/2 loads up the DOS VDM, and then 
>run's Windows 3.1 inside it.  Tame doesn't do much good with Windows.  
>It's mainly a DOS thing.

Not entirely true.  Most Win apps don't need it.  However, I used it to
tame QPWin 6.0's desire to poll and peg the systems.  Eventually, WPCorp
released a fix and the polling went away.

Steven

--
---------------------------------------------------------------
Steven Levine <steve53removethis@earthlink.net>  MR2/ICE #10183 Warp4/FP11
---------------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              04-Sep-99 14:32:06
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Swap file

From: "J. R. Fox" <jr_fox@earthlink.net>

seth berk wrote:
> 
> On Wed, 01 Sep 1999 23:22:58 +0100 (BST), Trevor Hemsley wrote:
> 
> >On Wed, 01 Sep 1999 13:07:36 -0400, J. R. Fox wrote:
> >
> >->I have 256M Ram, but never
> >->changed my swapfile from its default, which I think is around
> >->2M.  Would I gain anything by bumping that up to say 10 or 20M?
> >
> >Check the size of swapper.dat in the directory pointed to by swappath= in
> >config.sys. If it's larger than the default then make the default as large
> >(at least) as the file is.

It's been 3 days since I last checked the newsgroup, so I'm not
sure if it was Trevor or someone else who wrote the above 
reply.  (Some stuff has usually scrolled.  I'm reading this in
NS 2.02.)  But, anyway, I do check out the Swapper.Dat file 
from time to time.  It never seems to grow beyond its default
setting.  If there is no real downside, I could easily increase
the Swapper size by x 10, which would then only hit around 20M.

> Also....  If you have more than one partition, check around >for other
SWAPPER.DAT files.  I have put my Swap File on a 
> non-boot partition,

Several other partititions, but no other Swapper.Dat files.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              04-Sep-99 14:46:28
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Swap file

From: "J. R. Fox" <jr_fox@earthlink.net>

Craig Benbow wrote:
> 
>I'm intrigued!  How the heck do you get away with that?  In my >experience
you need a pretty decent sized swapfile if you run >many programs.  Especially 
apps like NS & VAJ.

I have no idea, not being at all technically minded in regard 
to this stuff; I was not the one who initially set up my 
system, although I have plugged in some suggestions from more
accomplished users, along the way.  The defaults and the 
results are as I stated, but I can't account for it.

> A note to those using NT (YUK!) don't attempt to set your >swapfile smaller
than 1.5*Physical mem size!
>IT WILL DIE AN AGONISINGLY SLOW DEATH!!!!!
 
Hmmm . . .  then maybe I'm getting away with it twice !  Physi-
cal RAM is at 256M, Pagefile.Sys is set at 279M, and the free
space remaining on the NT OS partition currently stands at 
540M.  The latter figure keeps shrinking, though, as it's 
damn near impossible to keep the install of NT bloatware (er,
I mean s/w) from dumping *TONS* of crap into \SYSTEM32. 

That boot seems to run as well as NT is likely to run . . . 
given that you never know what's going to cause a big problem
next.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    04-Sep-99 21:57:05
  To: All                                               05-Sep-99 04:16:02
Subj: SANE Tips Wanted

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

	Anyone got this going?  I'm sort of stuck with it seeing as the 
documentation is sort of bare.  How did you get it installed and how did 
you get it to scan?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              04-Sep-99 15:01:29
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Process Commander and DOS box.

From: "J. R. Fox" <jr_fox@earthlink.net>

Will Rose wrote:

>I've never had any problems with Unimaint, which I've used as >long as I've
used Process Commander (but this is under Warp >3.0) nor any backup issues.  I 
don't use Object Desktop (or >any desktop enhancer).  AFAIK the only files
changed are >DOSCALL1.DLL (patched), KBDBASE.SYS (replaced) and PMSHELL.EXE
>(the PROTSHELL in CONFIG.SYS).

Yes, those sound like the files in question.  I must plead 
temporary brainlock on one thing: it wasn't backup issues, BUT

>Now that I know where to look, I'll start with a base 3.0
>system and add a few fixpacks and see what happens.

FixPack issues !  Always revert to a PC-less setup *before*
you apply a fixpack, otherwise you could have some problems.
I don't recall the specifics, but this has been discussed on 
Compuserve OS/2 fora.  Because of some key differences between
the respective DOSCALL.DLLs and PMSHELLs, I maintain an alter-
nate CONFIG.SYS, called NO-PC.SYS.  I always boot with this
active before doing certain things, like applying a Fixpack,
or running the UniMaint functions that can get tripped up by
Process Cmdr.  I think there's an ALT-F1 (?) facility for using
other versions of CONFIG.SYS, but I just rename 'em and shuttle
them around.  There are times when I may want to boot up without certain
other components, too.

> No, I goofed; I'm using 1.01.

There _should have_ been another one, since '97.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: alex@eddie.cis.uoguelph.ca                        05-Sep-99 00:16:15
  To: All                                               05-Sep-99 04:16:02
Subj: [VIM] Looking for gvim binaries for...

From: alex@eddie.cis.uoguelph.ca (Alex Taylor)

OS/2 Warp.  

Vim has a very nice port to OS/2, however I can only find the console-mode
version.  Is there a 5.x port of the GUI version (gvim) for OS/2 anywhere?

'twould make my cutting & pasting a fair bit easier.

Thanks...

[crossposted in comp.editors and comp.os.os2.apps]

-----------------------------------------------------------------
 Alex Taylor                  BA - CIS - University of Guelph
 alex@eddie.cis.uoguelph.ca   http://eddie.cis.uoguelph.ca/~alex
-----------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: pandpATibm.net                                    04-Sep-99 18:37:08
  To: All                                               05-Sep-99 04:16:02
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: "Philip Nelson" <pandpATibm.net>

Not true - 

DB2 Connect is the product which allows you to access data on DB2 mainframe
database.  It used to be called DDCS.  It comes in two flavours - Personal
Edition (the one here) and Enterprise Edition (which is a gateway which can
be used by multiple clients).

You'll find more information about it on the IBM web site -

http://www.software.ibm.com/data/db2/

Phil

On Sat, 04 Sep 1999 13:59:23 GMT, George Czerw wrote:

>
>I've been informed that the "connect" edition is for "Warp 3", better 
>known as "OS/2 Connect".  Why didn't I think of that?  Guess I have a 
>habit of ignoring the obvious... 8-)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        05-Sep-99 00:46:09
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: dboultr@spamfree.erols.com

On Sat, 4 Sep 1999 12:30:18, no-one@nospam wrote:

> >When I installed fp11 6 weeks ago...I began to lose sight of the mail
> >folders in PRMailer V3.0.  The folders and files still exist, the
> >folders just disappear in the application.   Several others reported
> >the same problem.
>  
> Hmmm, a similar thing has recently happened to me with PMMail and I
> also have fp11.    This the culprit here as well ??

Yes, this happened to me as well.  It occurs with versions 2.1 and 
3.0.  This is particularly unfortunate as Innoval has just stopped 
support of the product.  Perhaps this was the straw that broke the 
camel's back?

Since it applies to both versions of PRM, I'm almost positive it's 
Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file 
before reinstalling, so it has to be an outside influence.  As I'm 
unwilling to back out FP 11, I'm looking for a new mail reader.

Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: wayne@SPAM.tkb.att.ne.jp                          05-Sep-99 09:57:23
  To: All                                               05-Sep-99 04:16:03
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: "Wayne Bickell" <wayne@SPAM.tkb.att.ne.jp>

On Fri, 03 Sep 1999 17:59:02 +1100 (EDT), Gerard Holden wrote:

:>Australia gets a 10% GST in July 2000. Sounds like next year we'll be
:>having the same sort of fun that you are having now. I wonder what the
:>S&H is to Australia. I'll check out the Sun site.
:>
:>--
:>
:>Gerard Holden
:>gholden(at)pcug(dot)org(dot)au

The S&H to me here in Japan was the maximum 24.50. We also
have a 3% sales tax but I don't usually have to pay anything on
imported CDs. Actually, I've even ordered hardware and never
had to pay any duties.

Cheers

Wayne

******************************************************
Wayne Bickell
Tokyo, Japan
wayne@tkb.att.ne.jp
******************************************************
           Posted with PMINews 2 for OS/2
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@sancoatjpsdotnet.void                      04-Sep-99 18:33:08
  To: All                                               05-Sep-99 04:16:03
Subj: Re: PGPro Scripts

From: nospam@sancoatjpsdotnet.void (Sander Nyman)

On 09/04/99 at 08:48 AM, pasnak@delete.cableregina.com (J.P. Pasnak) said:

>Does anyone know where I can find Rexx scripts for PhotoGraphics Pro?


J.P., PGPro Scripts v3.0  by: Don Eitner can be found on Hobbes.  You can
also contact him at:

freiheit@tstonramp.com

Another set of scripts can be found at:

http://www.geocities.com/SiliconValley/Vista/7567/graphics/english/index.html

Regards,  
Sander Nyman

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: pasnak@cableregina.com                            05-Sep-99 01:41:12
  To: All                                               05-Sep-99 05:27:07
Subj: Re: PGPro Scripts

From: Linegod <pasnak@cableregina.com>

Tks.  I also found the updated
http://www.tstonramp.com/~freiheit/PGPro_Scripts_40.zip

In article <yRNWO1cJ1gUw-pn2-6kLVWVWGUxCq@toshiba>,
  madodel@ptdprolog.net wrote:
> Try http://www.tstonramp.com/~freiheit/PGPro_Scripts_30.zip
>
> On Sat, 4 Sep 1999 16:48:36, pasnak@delete.cableregina.com (J.P.
> Pasnak) wrote:
>
> -)Does anyone know where I can find Rexx scripts for PhotoGraphics
Pro?
> -)
> -)
> -)J.P. Pasnak
> -)Warped Systems
> -)******************
> -)http://members.xoom.com/Warped/every/everything.html
> -)http://members.xoom.com/Warped/every/dirmap.html
> -)http://clubs.yahoo.com/clubs/warpedusers
> -)*******************
>
> //---------------------------------------------------------
> // From the Desk of: Mark Dodel, RN, BSN, MBA
> //             Healthcare Computer Consultant
> //                   madodel@ptdprolog.net
> //    http://home.ptd.net/~madodel
> //
> //  For a VOICE in the future of OS/2
> //             http://www.os2voice.org/index.html
> //---------------------------------------------------------
> 
>

--
"The pumps don't work, cuz the vandals took the handles"


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: icedancer-zamboni@ibm-zamboni.net                 05-Sep-99 02:03:08
  To: All                                               05-Sep-99 05:27:07
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: icedancer-zamboni@ibm-zamboni.net (Ken Walter)

On Sun, 5 Sep 1999 00:46:18, dboultr@spamfree.erols.com wrote:

>On Sat, 4 Sep 1999 12:30:18, no-one@nospam wrote:
>
>> >When I installed fp11 6 weeks ago...I began to lose sight of the mail
>> >folders in PRMailer V3.0.  The folders and files still exist, the
>> >folders just disappear in the application.   Several others reported
>> >the same problem.
>>  
[...]
>Since it applies to both versions of PRM, I'm almost positive it's 
>Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file 
>before reinstalling, so it has to be an outside influence.  As I'm 
>unwilling to back out FP 11, I'm looking for a new mail reader.

FP11 started changing file attributes on directories when they were 
modified.
Many programs assume there is only the D flag so they do not find
directories with A flags.  They should a searched for the D flag with
don't cares for the others.


Ken Walter

Remove -zamboni to reply
All the above is hearsay and the opinion of no one in particular

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Solution Technology (1:109/42)

+----------------------------------------------------------------------------+

From: JeremyB@clear.net.nz                              05-Sep-99 14:39:02
  To: All                                               05-Sep-99 05:27:08
Subj: Re: Communicator Startup Bug

From: Jeremy Bowen <JeremyB@clear.net.nz>

stephen@midac.splat.spam.com.au (stephen) writes:

> This is busted in 4.61 beta 2, although it worked in Beta 1. I 
> understand it is being attended to so should work in future
> versions.

Thanks for that. I'll look for it when the next release goes live.

-- 
 /----------------------------------------------------------\   o@C>-  
|  <Jeremy Bowen> | "It's a question of intelligence         |  __/___  
|   JeremyB@clea  |  so your opinion has very little         | {_XX_(_@=
|     r.net.nz    |  relevance" . . . Avon  Blake's 7        | o@C>-    
 \----------------------------------------------------------/    o@C>-

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CLEAR Net New Zealand (1:109/42)

+----------------------------------------------------------------------------+

From: pasnak@delete.cableregina.com                     04-Sep-99 23:57:06
  To: All                                               05-Sep-99 10:23:20
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: pasnak@delete.cableregina.com (J.P. Pasnak)

I'll order one CD then, and check the license agreement.  If there are
no 'gotchas', I can burn a copy for about $3-4 ($2-3 for a CD 
depending on what brand, and where I get them, and it's about $1 to 
snail mail a CD).

Let me know if your interested.

On Thu, 2 Sep 1999 16:38:50, "seth berk" <snberk@ibm.net> woke up with
a head full of whiskey and wrote:

> As a guide... I recently ordered the WarpUp! CD from Indelible Blue
> (which worked fabulously!)   I paid US$19 for the CD, and US$15 for
> the shipping.  GST was CDN$1.99 (on the after-exchange US$19) and
> CDN$5 handling to collect the GST.  **BUT** no customs duty.  I
> believe that software maybe covered under NAFTA and therefore tarriff
> free.  Shipping 10 CDs would certainly spead the shipping and
> "handling" fee out, but why can't we just make some copies here?  I
> admit I don't have the licence agreement here (if I did I wouldn't
> need the CD), but they are *giving*  the thing away.  I would
> register and get the key though the Sun/Star Division web site as if
> I had downloaded it.  
> 
> Some one in Vancouver has offered to lend me their CD (to which I say
> Thank You) but neither of us has a CD burner, and I would like to
> have a copy to archive.
> 
> Thanks
> 
> 
> On 2 Sep 1999 06:01:56 -0800, J.P. Pasnak wrote:
> 
> >On Wed, 1 Sep 1999 17:19:52, "seth berk" <snberk@ibm.net> woke up with
> >a head full of whiskey and wrote:
> >
> >> Anyone in Canada want to sell me a copy of their StarOffice CD?  I
> >> would love to save the shipping and handling costs.  (To our US
> >> friends, Canada Customs will assess a 7% GST (a sales tax) on the $16
> >> ( a little over a dollar) and *then* add a $5.00 handling fee to
> >> cover the cost of collecting the $1.12!!!! [smiley thing with the
> >> tongue sticking out])
> >> 
> >> So... if any fellow citizen of the great white north wants to contact
> >> me ... I'm in Vancouver, where we are having a terrific sale on
> >> passenger ships from overseas, only used once!
> >> 
> >> seth
> >> snberk@ibm.net 
> >> 
> >> 
> >
> >I thought there might be a way around this, but it seems Sun Canada is
> >temporarily offline. (see below).  I wonder what the total cost would 
> >be if I ordered 10 CDs from the states?  GST is something we have to 
> >live with, but I wonder what other 'import' taxes Customs would add?
> >
> >J.P. Pasnak
> >Warped Systems
> >******************
> >http://members.xoom.com/Warped/every/everything.html
> >http://members.xoom.com/Warped/every/dirmap.html
> >http://clubs.yahoo.com/clubs/warpedusers
> >*******************
> >
> >from Sun Shop (Canada Style)
> >
> >                 August 16, 1999
> >                 Sun Microsystems of Canada
> >                 Electronic Store Customers and Visitors
> >
> >                 Re: SunStore Notification
> >
> >                 In preparation for the opening of a new enhanced 
> >Web/Internet
> >                 Electronic Store, we will temporarily suspend 
> >activities on the current
> >                 site beginning late August, 1999. 
> >
> >                 A specific launch date for re-opening has not yet 
> >been identified
> >                 however we anticipate services will commence within a
> >reasonable
> >                 timeframe.
> >
> >                 Sun Canada's objective is to increase our level of 
> >service to customers
> >                 and we apologize for any inconvenience this may 
> >cause. 
> >
> >                 This letter will also be e-mailed to recent SunStore 
> >Site Customers
> >                 and Visitors.
> >
> >                 Until further notice please contact Sun Online at 
> >800-786-0404. 
> >
> >                 Michael Walsh,
> >                 Director of Marketing,
> >                 Sun Microsystems of Canada Inc.
> 
> 
> 

J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   05-Sep-99 02:40:10
  To: All                                               05-Sep-99 10:23:21
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: Kris Kadela <kris@dgraph.com>

I will confirm that. FP11 definitely screws more things than it fixes.
Even TCP/IP 4.1+ has problems when running in conjunction with FP11 (at
least on my 3 Warp 4 PCs).

Ken Walter wrote:
> 
> On Sun, 5 Sep 1999 00:46:18, dboultr@spamfree.erols.com wrote:
> 
> >On Sat, 4 Sep 1999 12:30:18, no-one@nospam wrote:
> >
> >> >When I installed fp11 6 weeks ago...I began to lose sight of the mail
> >> >folders in PRMailer V3.0.  The folders and files still exist, the
> >> >folders just disappear in the application.   Several others reported
> >> >the same problem.
> >>
> [...]
> >Since it applies to both versions of PRM, I'm almost positive it's
> >Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file
> >before reinstalling, so it has to be an outside influence.  As I'm
> >unwilling to back out FP 11, I'm looking for a new mail reader.
> 
> FP11 started changing file attributes on directories when they were
> modified.
> Many programs assume there is only the D flag so they do not find
> directories with A flags.  They should a searched for the D flag with
> don't cares for the others.
> 
> Ken Walter
> 
> Remove -zamboni to reply
> All the above is hearsay and the opinion of no one in particular

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: never@tvol.it                                     05-Sep-99 09:44:01
  To: All                                               05-Sep-99 10:23:21
Subj: QuickCam VC USB

From: never@tvol.it (Zamp)

Hi

Did you know any app. support for subj ?

Conoscete se qualche applicazione supporta la Quickcam USB ?

Thanks.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Centro Servizi Interbusiness (1:109/42)

+----------------------------------------------------------------------------+

From: Thomas.Billert@rz.uni-jena.de                     05-Sep-99 09:57:16
  To: All                                               05-Sep-99 10:23:21
Subj: Re: EPM TeX question

From: Thomas.Billert@rz.uni-jena.de (Thomas Billert)

Hi John,

On 2 Sep 1999 02:14:36 GMT, John Holt wrote in 
comp.os.os2.apps:

>I am using EPM TeX and am trying to use the "User" menu items to add
>GhostView.  Unfortunately, the macros have a slight error and can not
>recognize the existance of file with a two character file extension. 
>Has anyone already fixed this??
>

try Walter Schmidt's EPM TeX frontend, which is IMHO based on EPM TeX.
It doesn't have such a limitation.

Get it from:

ftp://ftp.dante.de/tex-archive/systems/os2/epmtfe/

Hope this helps,

regards, Billy.
-- 
Thomas Billert using OS/2 Warp 4   *   Thomas.Billert@rz.uni-jena.de
http://www.uni-jena.de/~c5thbi     *   Thomas.Billert@t-online.de
                                   *   PGP public keys available on my
OS/2-Usergroup Jena und Umgebung:  *               website
http://www.uni-jena.de/~c5thbi/os2jena.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: davek@clark.net                                   05-Sep-99 10:18:19
  To: All                                               05-Sep-99 10:23:21
Subj: Re: [VIM] Looking for gvim binaries for...

From: davek@clark.net (David Kunz)

Alex Taylor (alex@eddie.cis.uoguelph.ca) wrote:                       

: OS/2 Warp.                                                          

: Vim has a very nice port to OS/2, however I can only find the 
: console-mode version.  Is there a 5.x port of the GUI version 
: (gvim) for OS/2 anywhere?                                           

: 'twould make my cutting & pasting a fair bit easier.                

I couldn't find it so I opted for elvis -- another enhanced vi port
that's available for linux, sun, and OS/2 (the systems that I use) as
well as others...

--
David Kunz
Operator error.  Replace operator and strike any key to continue...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: david.paisley@nospam                              05-Sep-99 12:11:09
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: david.paisley@nospam (David Paisley)

On Sun, 5 Sep 1999 07:57:12, pasnak@delete.cableregina.com (J.P. 
Pasnak) wrote:

> I'll order one CD then, and check the license agreement.  If there are
> no 'gotchas', I can burn a copy for about $3-4 ($2-3 for a CD 
> depending on what brand, and where I get them, and it's about $1 to 
> snail mail a CD).
> 
> Let me know if your interested.

<snip>

I hope that I am not nosing in here, but I would be very interested as
well. I don't order CDs from out of Canada sources because of the 
hassles involved as well.

thanks,

David Paisley
Toronto, Ontario, Canada

Warp 4 FP 11

anti spam replace "nospam" with "sympatico.ca"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sympatico (1:109/42)

+----------------------------------------------------------------------------+

From: bgoody@ibm.net                                    05-Sep-99 08:41:20
  To: All                                               05-Sep-99 14:48:26
Subj: PalmPilot and StarOffice

From: Brian Goodyear <bgoody@ibm.net>

Did anyone figure out how to syncronize the PalmPilot Addressbook 
categories with the StarOffice addressbook?  There doesn't seem to be 
any equivalent of these categories in the StarOffice addressbook.
Thanks,
Brian



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               05-Sep-99 14:49:28
  To: All                                               05-Sep-99 14:48:26
Subj: Innoval Web Watch Willy setup problem

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Hi all!

Has anyone had success in setting up the now freeware program Web Watch
Willy from Innoval? It uses your Browser to access
http://www.webwilly.com, but this server seems to be down.
Is there any other way to configure WebWatchWilly? Otherwise the program
would be useless.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: windows.from.your.harddisk.arnol...               05-Sep-99 13:05:24
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Swap file

Message sender: windows.from.your.harddisk.arnoldvanovereem@iname.com

From: windows.from.your.harddisk.arnoldvanovereem@iname.com (Arnold van
Overeem)

On Fri, 3 Sep 1999 00:06:45, Craig Benbow <benbowc@tui.lincoln.ac.nz> wrote:

>  
> A note to those using NT (YUK!) don't attempt to set your swapfile smaller
than
> 1.5*Physical mem size!
> IT WILL DIE AN AGONISINGLY SLOW DEATH!!!!!
>  
> 
What abeautiful payload for a new version of the melissa virus ...

remove windows from your harddisk to reply
==========================================
Arnold van Overeem
==========================================
Let's make the difference/2

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET-NL (http://www.nl.uu.net) (1:109/42)

+----------------------------------------------------------------------------+

From: never@tvol.it                                     05-Sep-99 13:04:22
  To: All                                               05-Sep-99 14:48:26
Subj: QuickCam USB

From: never@tvol.it (Zamp)

Hi
 
Did you know any app. support for subj ?
 
Conoscete se qualche applicazione supporta la Quickcam USB ?
 
Thanks.
 
 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Centro Servizi Interbusiness (1:109/42)

+----------------------------------------------------------------------------+

From: postmaster@[127.0.0.1]                            05-Sep-99 08:55:26
  To: All                                               05-Sep-99 14:48:26
Subj: Re: PalmPilot and StarOffice

From: postmaster@[127.0.0.1]

In <19990905.8414093@mis.configured.host>, on 09/05/99 
   at 08:41 AM, Brian Goodyear <bgoody@ibm.net> said:

>Did anyone figure out how to syncronize the PalmPilot Addressbook 
>categories with the StarOffice addressbook?  There doesn't seem to be  any
>equivalent of these categories in the StarOffice addressbook. Thanks,
>Brian

I'm careful with the SO/PalmPilot integration.  The last time I
synchronized them, SO erased my categories in the PalmPilot.  I didn't lose
any data, but the categories went back to the originals.




--
GK
            
FrodoJRR at Interaccess dot com
OS/2 Version 4.00 FixPack 11 
There are 30 Processes with 115 Threads.
This machine's uptime is 1d 9h 34m 17s 257ms.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          05-Sep-99 13:58:21
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Sun, 5 Sep 1999 00:46:18, dboultr@spamfree.erols.com a crit dans un 
message:

> On Sat, 4 Sep 1999 12:30:18, no-one@nospam wrote:
> 
> > >When I installed fp11 6 weeks ago...I began to lose sight of the mail
> > >folders in PRMailer V3.0.  The folders and files still exist, the
> > >folders just disappear in the application.   Several others reported
> > >the same problem.
> >  
> > Hmmm, a similar thing has recently happened to me with PMMail and I
> > also have fp11.    This the culprit here as well ??
> 
> Yes, this happened to me as well.  It occurs with versions 2.1 and 
> 3.0.  This is particularly unfortunate as Innoval has just stopped 
> support of the product.  Perhaps this was the straw that broke the 
> camel's back?

If true, another piece of the argument FOR Open Sourcing this stuff before 
they quit the field.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: lhadley@nospam.net                                05-Sep-99 14:40:03
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: lhadley@nospam.net

And people (governments) wonder why there is such a big underground
economy!

In <37cf75a0$1$xfhayrl$mr2ice@news.sk.sympatico.ca>, on 09/03/99 
   at 01:14 AM, Skree@stubble.jumpers said:

>In <37ce49a5$1$jzzbeebj$mr2ice@news.flash.net>, on 09/02/99 
>   at 09:55 AM, bill.m@no.spam.net said:

>Q}Is this the Canadian Governments definition of "Free Trade" between
>Q}Canada, US, and Mexico? or does that only apply to corporate level and
>Q}individuals still have a (Gov.) hand in their pockets?

>Is there such a thing as a govt that doesn't have its hand it the
>citizen's pockets.

>NOOOOOOOO



"Just another tragic case of terminal kinetic energy poisoning."
  - Dr. Buen-Scheuk


-- DLH  AIM id "SirKrustin"      In order of preference
  lhadley1@home.net, lhadley@peterboro.net

  homepage:  http://sirkrustin-online.iwarp.com    
== Last updated 8/28/1999 =======================================

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Work Internet powered by @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: patrickstump@my-deja.com                          05-Sep-99 14:37:11
  To: All                                               05-Sep-99 14:48:26
Subj: Re: TouchStone PCMCIA driver ti1220 and 3com nic card

From: patrickstump@my-deja.com

I have the ti1220 on my dell insprion 7000.  I am trying o use a 3com
3c589b nic card, but so far it will just show it as memory.  Can anyone
help me with the switches.  I also have invested serveral hours.
I think I jsut need the correct switches.

I have also played with the reserve.sys command.  No luck there either.

Thanks
Patrick

In article <37c4ce20$3$ecrgrefr$mr2ice@nntp.ix.netcom.com>,
  Randy Petersen <rpeterse@ix.netcom.com> wrote:
> In <gE9QtwxbB80C-pn2-YWpPtePbwJdX@localhost>, on 08/23/99
>    at 10:35 AM, sznever@usa.net (Zamp) said:
>
> >Hi.
>
> >Still no way to work on my MITAC 6133 (TI1225) PCMCIA modem :(((
> >Drivers correctly read during boot my chipset (TI1225) and IO
address
> >(3E0)
> >but doesn't assign ANY memory address NOR any IRQ.
> >Instead driver SS2INTEL.SYS assign memory address (D0000, lenght
1000)
> >according to rmview and/or Hardware Manager but doesn't assign ANY
IRQ
> >and not see my modem.
>
> I think you need a modem card specific enabler.
> IBM's PC Card Direcotr and PLAYWILL use a script to enable the modem
cards.
> Not that it works for my modem card (it doesn't).
>
> How is their tech support?
>
> >I have lost many DAYS to try various configuration, but without any
> >success.
>
> >I'm desperate, i've paid 108DM for this driver :(((
>
> >PS: Someone have sent me SS2INTEL.SYS driver, but i doesn't remember
> >who is.
>
> If your socket services driver sees the cards inserted/removed, then
it's
> most likely the correct driver to use.  You just need to get your
specific
> PCMCIA cards enabled (turned on/correct voltages/correct
port,memory,irq,etc).
>
> >Thanks.
>
>
/*---------------------------------------------------------------------
-*
>   Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
>   Please also email replies to: Randy Petersen
<rpeterse@ix.netcom.com>
>   Now Very Happily Warping along with Warp 3.0 Connect at fixpack
#40.
>   SPAMMERS don't bother me, I direct them to the void at /dev/nul.
>
*----------------------------------------------------------------------
*/
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          05-Sep-99 14:46:28
  To: All                                               05-Sep-99 14:48:27
Subj: Alternate CONFIGs 

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Sat, 4 Sep 1999 19:01:59, "J. R. Fox" <jr_fox@earthlink.net> a crit 
dans un message:

> Will Rose wrote:
> 
> >I've never had any problems with Unimaint, which I've used as >long as I've 
used Process Commander (but this is under Warp >3.0) nor any backup issues.  I 
don't use Object Desktop (or >any desktop enhancer).  AFAIK the only files
changed are >DOSCALL1.DLL (patched), KBDBASE.SYS (replaced) and PMSHELL.EXE
>(the PROTSHELL in CONFIG.SYS).
> 
> Yes, those sound like the files in question.  I must plead 
> temporary brainlock on one thing: it wasn't backup issues, BUT
> 
> >Now that I know where to look, I'll start with a base 3.0
> >system and add a few fixpacks and see what happens.
> 
> FixPack issues !  Always revert to a PC-less setup *before*
> you apply a fixpack, otherwise you could have some problems.
> I don't recall the specifics, but this has been discussed on 
> Compuserve OS/2 fora.  Because of some key differences between
> the respective DOSCALL.DLLs and PMSHELLs, I maintain an alter-
> nate CONFIG.SYS, called NO-PC.SYS.  I always boot with this
> active before doing certain things, like applying a Fixpack,
> or running the UniMaint functions that can get tripped up by
> Process Cmdr.  I think there's an ALT-F1 (?) facility for using
> other versions of CONFIG.SYS, but I just rename 'em and shuttle
> them around.  There are times when I may want to boot up without certain
> other components, too.


This is very simple to do. And very useful, in my opinion. 

1. Place your alternate CONFIG.SYS in \OS2\BOOT and rename it, we'll say, 
to CONFIG.B (for Buddy?).

2. On any reboot, you can Alt-F1 to the choices screen and then hit the key
B, and you'll now be booting with .\OS2\BOOT\CONFIG.B instead of 
.\CONFIG.SYS, for just this one time. (The screen does not have to tell you
that you have this choice for it to work.)

The "reserved" keynames are 1, 2, 3, M, V, and X. If you're using Dennis 
Bareis very handy ARCHIVE utility, which allows creation of up to nine 
different desktops, then don't use anything but letters. (I've never tried 
it with other characters like \ or / or `, but neither can I imagine 
running out of alphabet letters.)

If your memory is bad and you want to remind yourself each time what your 
choices are, and what they do, you'll want to edit \OS2\BOOT\ALTF1BOT.SCR 
(IBM says) with a text editor to add a line for B and include a 
description. See OS/2 Command Ref Help for "Displaying Your CONFIG.? 
Choices".

That said, I prefer editing ALTF1TOP.SCR, because I don't think OS/2 ever 
messes with that one, and if you do it too you might want to remove a 
couple of the blank lines on that page to make more room.

OS/2 Help also talks about making Batch files to help with this, but you 
don't need them. Maybe it applies to an older version of Warp?


I've got 4 alternates: one that loads nearly zero drivers (Z); one that 
loads CMD.EXE as the COMSPEC (T) instead of 4OS2.EXE or vice versa (4); and
one that simply forces an Autocheck on every partition (A). You do have to 
be careful to update these versions with any other changes that get made to
your base CONFIG.SYS. (That's the biggest problem I've run into, when I 
need one of the alternates it is slightly out of date for something or 
other.)


By the way, there's another very nifty utility (freeware now) called 
BOOTSET that works a little differently, being called at the completion of 
your normal CONFIG.SYS, but it can accomplish the same thing if you read 
the docs. I've used it for a long time and recommend it for its own sake, 
but won't go into it here.



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          05-Sep-99 15:06:10
  To: All                                               05-Sep-99 14:48:27
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Sun, 5 Sep 1999 07:57:12, pasnak@delete.cableregina.com (J.P. Pasnak) a 
crit dans un message:

> I'll order one CD then, and check the license agreement.  If there are
> no 'gotchas', I can burn a copy for about $3-4 ($2-3 for a CD 

By the way I just noticed yesterday that Office Depot has their Imation 
CD-R special back on, 10 for $15 (US). 

(I haven't had to pay more than this price, and I'm averaging about a 
dollar by looking around a lot and by buying in bulk.)


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: anancoz@interport.net                             04-Sep-99 12:06:18
  To: All                                               05-Sep-99 14:48:27
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: "Andre Nancoz" <anancoz@interport.net>

On Sat, 04 Sep 1999 12:30:18 GMT, no-one@nospam wrote:

:>On 1 Sep 1999 01:29:14 GMT, chili@ibm.net (Gerry Chilibeck) wrote:
:>
:>>When I installed fp11 6 weeks ago...I began to lose sight of the mail
:>>folders in PRMailer V3.0.  The folders and files still exist, the
:>>folders just disappear in the application.   Several others reported
:>>the same problem.
:>
:>Hmmm, a similar thing has recently happened to me with PMMail and I
:>also have fp11.    This the culprit here as well ??
:>
I saw a note somewhere that FP11 is setting both the Directory AND the
Archive attribute bit when a new directory is created. This causes some
programs problems. Try looking at the attributes of the directory
(folder) you created and turn off the Archive bit.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Interport Communications Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: rogprov@aol.com                                   05-Sep-99 16:05:16
  To: All                                               05-Sep-99 14:48:27
Subj: Re: SANE Tips Wanted

From: rogprov@aol.com (Rogprov)

In article <7qs4jm$2vg$1@coranto.ucs.mun.ca>, jdc0014@InfoNET.st-johns.nf.ca
(John Hong) writes:

>	Anyone got this going?  I'm sort of stuck with it seeing as the 
>documentation is sort of bare.  How did you get it installed and how did 
>you get it to scan?

I use PMSANE which is a GUI front end for SANE. 

http://www.quasarbbs.com/yuri/sane2.html

I have used this with Microtex, Epson and HP flatbeds with great success.

Good luck.

Regards
Roger Provins
Gloucester
England

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AOL, http://www.aol.co.uk (1:109/42)

+----------------------------------------------------------------------------+

From: pasnak@delete.cableregina.com                     05-Sep-99 10:33:14
  To: All                                               05-Sep-99 14:48:27
Subj: Re: PGPro Scripts

From: pasnak@delete.cableregina.com (J.P. Pasnak)

On Sat, 4 Sep 1999 22:33:17, nospam@sancoatjpsdotnet.void (Sander 
Nyman) woke up with a head full of whiskey and wrote:

> On 09/04/99 at 08:48 AM, pasnak@delete.cableregina.com (J.P. Pasnak) said:
> 
> >Does anyone know where I can find Rexx scripts for PhotoGraphics Pro?
> 
> 
> J.P., PGPro Scripts v3.0  by: Don Eitner can be found on Hobbes.  You can
> also contact him at:
> 
> freiheit@tstonramp.com
> 
> Another set of scripts can be found at:
> 
>
http://www.geocities.com/SiliconValley/Vista/7567/graphics/english/index.html
> 
> Regards,  
> Sander Nyman
> 

Tks.  It's a slow trickle, but once I found one set of scripts, it's 
leading to more and more.

J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: rjfreem@ibm.net                                   05-Sep-99 10:53:13
  To: All                                               06-Sep-99 04:16:14
Subj: Re: SANE Tips Wanted

From: rjfreem@ibm.net

In <7qs4jm$2vg$1@coranto.ucs.mun.ca>, on 09/04/99 
   at 09:57 PM, jdc0014@InfoNET.st-johns.nf.ca (John Hong) said:

>	Anyone got this going?  I'm sort of stuck with it seeing as the 
>documentation is sort of bare.  How did you get it installed and how did 
>you get it to scan?

I do not recall having to do anything other than the change the grey
setting. For me it works better than applause or CFW. RJF


-- 
-----------------------------------------------------------
rjfreem@ibm.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: say@sfu.ca                                        05-Sep-99 17:54:20
  To: All                                               06-Sep-99 04:16:14
Subj: Re: BestOfOS2 and Hobbes daily report

From: Daniel Say <say@sfu.ca>

Gilbert Saint-flour <gsf@ibm.net> wrote:
: These URLs stopped working a while ago.  Any idea if the Hobbes Daily
: Report is available somewhere else?  Thanks.

:  http://www.bestofos2.com/

:  http://www.aescon.com/bestofos2/hobbes.htm

------
	The webmaster of aescon.com told me a month
	ago that the person responsible for these
	sites wanted them taken off.  (Innoval?)

	Now I use :

#Linkname: [hobbes.nmsu.edu] Directory of /pub/new
http://hobbes.nmsu.edu/
http://hobbes.nmsu.edu/pub/new
#
#Link below withdrawn August 1999
#lynx http://www.aescon.com/bestofos2/hobbes.htm

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Simon Fraser University (1:109/42)

+----------------------------------------------------------------------------+

From: brpms@earthlink.net                               05-Sep-99 10:21:07
  To: All                                               06-Sep-99 04:16:14
Subj: Re: OS2 & Lexmark

From: brpms@earthlink.net

In <slrn7sd3ii.n7c.stefand@ferrari.lcam.u-psud.fr>, on 08/27/99 at 12:03
PM,
   stefand@lcam.u-psud.fr (Stefan A. Deutscher) said:

>On Fri, 27 Aug 1999 08:09:50 +0100 (BST), Brian Morrison
><news@fenrir.demon.co.uk> wrote:
>>On Mon, 23 Aug 1999 20:31:57 -0700 (PDT), Nick Danger wrote:
>>>I had the same experience with the 3200 I bought this weekend.  Works
>>>great, but does hog the machine when it's printing.  But for a $99
>>>1200dpi color printer? It's wonderful.
>>
>>If you don't install bidi and update the port driver (parallel.pdr in
>>\os2\dll) you will get this behaviour. My 5770 prints without slowing
>>down the whole machine. The load occurs while the driver is processing
>>the job, not when it is sitting in the spool queue being printed.

Yes, and it's a very long time for me.  Is there a way to reduce the
priority for the printer driver so that it doesn't totally wipeout
multitasking?

>Okay, so where does one find the latest parallel.pdr? Will it be in Warp
>4 fp11, or in the device driver fp 1, or where?

> Cheers,              Stefan

I'll try any suggestions [and, yes, I did back level to the parallel.pdr
that came with bidi package].

Paul

-- 
-----------------------------------------------------------
pms@mail.dotcom.fr
brpms@earthlink.net
-----------------------------------------------------------

pgp public key sent on request


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: RCWright@Texas.Net                                05-Sep-99 14:04:09
  To: All                                               06-Sep-99 04:16:14
Subj: DB2 v6 - having problems with userid/password

From: Richard Wright <RCWright@Texas.Net>

Having read the buzz in this newsgroup about the DB2 offer, I
think I'm in the right place.
I was actually able to download pecmn.zip and peen.zip. through
my browser with only one crash (probably because I was trying
download 5 files at one time - oh well!).

Thought that I would try these components out before I went much
further so unpacked them and ran the install.

During the install, I filled in the userid/password control.

After everything installed and I rebooted, DB2 tried to start.
The first thing it asked for was the userid/password. Nothing
that I tried worked.

I tried User Profile Management but again couldn't get passed the
userid/password.

Anybody got any ideas?

And just which of the other modules do I need - I figure on
getting the extensions, but am not sure about the connect
version.

Thanks,
Richard Wright

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Giganews.Com - Premium News Outsourcing (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  05-Sep-99 19:04:29
  To: All                                               06-Sep-99 04:16:14
Subj: DB2 installation

From: prather@infi.net (Jerry Prather)

Hi all,

I finally got both parts of the free DB2 (pecmn.zip and peen.zip)
downloaded, unzipped, and installed.  But I think I've done
something wrong 'cause I can't start the First Steps.

I have a stand-alone machine, not connected to any networks, but
when I try to start DB2, I get asked for a user name and
password.  I enter what I entered during the installation
procedure, but the entries are rejected and I'm thrown out of the
program.  Because of some language in the rejection, I decided
that maybe it needed to have TCPIP installed and tried to do
that.  I probably messed that up as well, knowing me.

So, is TCPIP required?  Does this version of DB2 work with Java
1.1.8?  The latest error message mentions having the loopback
enabled on the TCPIP control panel.  I can't find a TCPIP control
panel.  When I was asked what elements I wanted to install, I was
rather uncertain which were applicable to a stand-alone scenario.
 What should I try?  I'd like to uninstall DB2 and try again, but
I can't find an UNINSTALL command anywhere.

Obviously I'm lost.  Has anyone got a road map?

Thanks,

Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                05-Sep-99 12:48:13
  To: All                                               06-Sep-99 05:58:21
Subj: StarOffice 5.1 - Statistics

From: John M Price PhD <jmprice@calweb.com>

Am I correct in my looking at this and finding there are no advanced stat
functions?  Indeed, maybe no stat functions?

Through help, the Statistical gets not a thing, nor does Add-ins.

Regression tools, trend, growth, etc. would be great.  The various means,
Arithmetic, Geometric, Harmonic are also important.

TIA.



-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

Ginsberg's Theorem:
        (1) You can't win.
        (2) You can't break even.
        (3) You can't even quit the game.

Freeman's Commentary on Ginsberg's theorem:
        Every major philosophy that attempts to make life seem
        meaningful is based on the negation of one part of Ginsberg's
        Theorem.  To wit:

        (1) Capitalism is based on the assumption that you can win.
        (2) Socialism is based on the assumption that you can break
            even.
        (3) Mysticism is based on the assumption that you can quit the
            game.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: repps@flash.net                                   05-Sep-99 20:07:11
  To: All                                               06-Sep-99 05:58:21
Subj: Re: OS2 & Lexmark

From: repps@flash.net

In <37d29915$1$oeczf$mr2ice@news.earthlink.net>, brpms@earthlink.net writes:
>
>I'll try any suggestions [and, yes, I did back level to the parallel.pdr
>that came with bidi package].
>
>Paul
>

rem PRINTMONBUFSIZE=134,134,134
PRINTMONBUFSIZE=2048,134,134

These are a couple of lines from my CONFIG.SYS that made a world of 
difference with my Lexmark 5700.

Richard

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    05-Sep-99 20:26:16
  To: All                                               06-Sep-99 05:58:22
Subj: Microsoft Word 5.5b Download

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

http://officeupdate.microsoft.com/downloadDetails/Wd55eng.htm

Microsoft is giving Word 5.5b away as a complimentary upgrade for Word 5.0
for DOS users.  Some will find out however that this was one of the few
Microsoft titles that worked natively for OS/2.  The executable (word.exe)
can be run from either DOS or OS/2.  Microsoft recommends that you upgrade
before December 31, 1999.  (I take it something bad happens :-). 

This is a 16-bit OS/2 text application, made during the OS/2 1.x days.  I 
checked to see if they did the same with the older version of Microsoft 
Excel, but so far, no go.


http://officeupdate.microsoft.com/downloadDetails/Wd55ben.htm

This is for the international english.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: whonea@codenet.net                                05-Sep-99 14:39:29
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: whonea@codenet.net (Will Honea)

On Sun, 5 Sep 1999 02:03:16, icedancer-zamboni@ibm-zamboni.net (Ken 
Walter) wrote:

> On Sun, 5 Sep 1999 00:46:18, dboultr@spamfree.erols.com wrote:
> 
> >On Sat, 4 Sep 1999 12:30:18, no-one@nospam wrote:
> >
> >> >When I installed fp11 6 weeks ago...I began to lose sight of the mail
> >> >folders in PRMailer V3.0.  The folders and files still exist, the
> >> >folders just disappear in the application.   Several others reported
> >> >the same problem.
> >>  
> [...]
> >Since it applies to both versions of PRM, I'm almost positive it's 
> >Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file 
> >before reinstalling, so it has to be an outside influence.  As I'm 
> >unwilling to back out FP 11, I'm looking for a new mail reader.
> 
> FP11 started changing file attributes on directories when they were 
> modified.
> Many programs assume there is only the D flag so they do not find
> directories with A flags.  They should a searched for the D flag with
> don't cares for the others.

Just reset the directory attributes to clear the archive bit and the 
problem goes away for a bit.  I just inserted a small command file to 
do this after every mail check.  PITA, but it works.

Will Honea <whonea@codenet.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: tim.timmins@bcs.org.uk                            05-Sep-99 21:41:25
  To: All                                               06-Sep-99 05:58:22
Subj: Re: DB2 v6 - having problems with userid/password

From: Tim Timmins <tim.timmins@bcs.org.uk>

Did you try 'userid' and 'password' ?

Richard Wright wrote:

> Having read the buzz in this newsgroup about the DB2 offer, I
> think I'm in the right place.
> I was actually able to download pecmn.zip and peen.zip. through
> my browser with only one crash (probably because I was trying
> download 5 files at one time - oh well!).
>
> Thought that I would try these components out before I went much
> further so unpacked them and ran the install.
>
> During the install, I filled in the userid/password control.
>
> After everything installed and I rebooted, DB2 tried to start.
> The first thing it asked for was the userid/password. Nothing
> that I tried worked.
>
> I tried User Profile Management but again couldn't get passed the
> userid/password.
>
> Anybody got any ideas?
>
> And just which of the other modules do I need - I figure on
> getting the extensions, but am not sure about the connect
> version.
>
> Thanks,
> Richard Wright

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: aludwig@ErzETT.uni-potsdam.de                     05-Sep-99 18:04:28
  To: All                                               06-Sep-99 05:58:22
Subj: Re: BestOfOS2 and Hobbes daily report

From: "Andreas Ludwig" <aludwig@ErzETT.uni-potsdam.de>

On Sun, 05 Sep 1999 15:34:33 GMT, Gilbert Saint-flour wrote:

>These URLs stopped working a while ago.  Any idea if the Hobbes Daily
>Report is available somewhere else?  Thanks.
>
> http://www.bestofos2.com/
>
> http://www.aescon.com/bestofos2/hobbes.htm

No idea. But hobbes itself as a really good incomming and new directory over
http (hobbes.nmsu.edu). It's even better than Hobbes report because it is
ALWAYS up to date ;-)

Bye!

Andreas



--

Andreas Ludwig
from the beautiful town of POTSDAM (Germany)
using my good old PC and OS/2 WARP 4 !

(remove the BIG letters to reply)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UNI Potsdam (1:109/42)

+----------------------------------------------------------------------------+

From: t@keen.net                                        05-Sep-99 17:23:23
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Innoval Web Watch Willy setup problem

From: "Willy Wonka" <t@keen.net>

Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de> wrote in message
news:37D266F5.49B408DC@ruhr-uni-bochum.de...
> Hi all!
>
> Has anyone had success in setting up the now freeware program Web Watch
> Willy from Innoval? It uses your Browser to access
> http://www.webwilly.com, but this server seems to be down.
> Is there any other way to configure WebWatchWilly? Otherwise the program
> would be useless.

You get what you pay for. Imagine all those poor folks who paid for this
stuff.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ameritech.Net www.ameritech.net  Complaints: abus
(1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  05-Sep-99 21:25:20
  To: All                                               06-Sep-99 05:58:22
Subj: Re: DB2 v6 - having problems with userid/password

From: prather@infi.net (Jerry Prather)

In message <37D2D58E.82588C8E@bcs.org.uk> - Tim Timmins
<tim.timmins@bcs.org.uk> writes:
:>
:>Did you try 'userid' and 'password' ?
:>
Bingo!  At least it got me past the password problem...

Thanks much,

Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    05-Sep-99 23:05:18
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Innoval Web Watch Willy setup problem

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Willy Wonka (t@keen.net) wrote:

: > Has anyone had success in setting up the now freeware program Web Watch
: > Willy from Innoval? It uses your Browser to access
: > http://www.webwilly.com, but this server seems to be down.
: > Is there any other way to configure WebWatchWilly? Otherwise the program
: > would be useless.

: You get what you pay for. Imagine all those poor folks who paid for this
: stuff.

	The main problem with Web Willy was that it simply was not 
needed.  I mean, most people do not have their children over to surf the 
'net on the latest greatest OS/2 web browser and kickass plugins. ;-)
	Where the main dominence of OS/2 users are bankers, business 
people, enterpreneurs, office workers and ATM machines, I really gotta 
wonder if Innoval thought this one out properly.  Even the Win95/NT version 
was not going to do much since the market there is huge (ie. Net Nanny, 
Cyber Patrol, etc).  Even in spite of the fact that there never was any 
software like that for the OS/2 end, there simply was never that big need 
of it for most of us.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: ctompset@7cities.net                              05-Sep-99 18:31:29
  To: All                                               06-Sep-99 05:58:22
Subj: Re: TouchStone PCMCIA driver ti1220 and 3com nic card

From: "Clark Tompsett" <ctompset@7cities.net>

Use basedev=reserve.sys /mem=ca00,2000
This must be the first line in the config.sys

Clark.



On Sun, 05 Sep 1999 14:37:22 GMT, patrickstump@my-deja.com wrote:

:>I have the ti1220 on my dell insprion 7000.  I am trying o use a 3com
:>3c589b nic card, but so far it will just show it as memory.  Can anyone
:>help me with the switches.  I also have invested serveral hours.
:>I think I jsut need the correct switches.
:>
:>I have also played with the reserve.sys command.  No luck there either.
:>
:>Thanks
:>Patrick
:>
:>In article <37c4ce20$3$ecrgrefr$mr2ice@nntp.ix.netcom.com>,
:>  Randy Petersen <rpeterse@ix.netcom.com> wrote:
:>> In <gE9QtwxbB80C-pn2-YWpPtePbwJdX@localhost>, on 08/23/99
:>>    at 10:35 AM, sznever@usa.net (Zamp) said:
:>>
:>> >Hi.
:>>
:>> >Still no way to work on my MITAC 6133 (TI1225) PCMCIA modem :(((
:>> >Drivers correctly read during boot my chipset (TI1225) and IO
:>address
:>> >(3E0)
:>> >but doesn't assign ANY memory address NOR any IRQ.
:>> >Instead driver SS2INTEL.SYS assign memory address (D0000, lenght
:>1000)
:>> >according to rmview and/or Hardware Manager but doesn't assign ANY
:>IRQ
:>> >and not see my modem.
:>>
:>> I think you need a modem card specific enabler.
:>> IBM's PC Card Direcotr and PLAYWILL use a script to enable the modem
:>cards.
:>> Not that it works for my modem card (it doesn't).
:>>
:>> How is their tech support?
:>>
:>> >I have lost many DAYS to try various configuration, but without any
:>> >success.
:>>
:>> >I'm desperate, i've paid 108DM for this driver :(((
:>>
:>> >PS: Someone have sent me SS2INTEL.SYS driver, but i doesn't remember
:>> >who is.
:>>
:>> If your socket services driver sees the cards inserted/removed, then
:>it's
:>> most likely the correct driver to use.  You just need to get your
:>specific
:>> PCMCIA cards enabled (turned on/correct voltages/correct
:>port,memory,irq,etc).
:>>
:>> >Thanks.
:>>
:>>
:>/*---------------------------------------------------------------------
:>-*
:>>   Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
:>>   Please also email replies to: Randy Petersen
:><rpeterse@ix.netcom.com>
:>>   Now Very Happily Warping along with Warp 3.0 Connect at fixpack
:>#40.
:>>   SPAMMERS don't bother me, I direct them to the void at /dev/nul.
:>>
:>*----------------------------------------------------------------------
:>*/
:>>
:>
:>
:>Sent via Deja.com http://www.deja.com/
:>Share what you know. Learn what you don't.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  05-Sep-99 18:50:11
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: Chuck McKinnis <mckinnis@ibm.net>

This is a multi-part message in MIME format.
--------------E842C0AB973EFB57B445559B
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit

Some else thought that this might be IDE driver related, but I have all
SCSI, and I see the same problems.  I have attached my little cmd
utility that I run with the "all" parameter to clean up all of my fixed
drives.

Will Honea wrote:
> 
> On Sun, 5 Sep 1999 02:03:16, icedancer-zamboni@ibm-zamboni.net (Ken
> Walter) wrote:
> 
> > On Sun, 5 Sep 1999 00:46:18, dboultr@spamfree.erols.com wrote:
> >
> > >On Sat, 4 Sep 1999 12:30:18, no-one@nospam wrote:
> > >
> > >> >When I installed fp11 6 weeks ago...I began to lose sight of the mail
> > >> >folders in PRMailer V3.0.  The folders and files still exist, the
> > >> >folders just disappear in the application.   Several others reported
> > >> >the same problem.
> > >>
> > [...]
> > >Since it applies to both versions of PRM, I'm almost positive it's
> > >Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file
> > >before reinstalling, so it has to be an outside influence.  As I'm
> > >unwilling to back out FP 11, I'm looking for a new mail reader.
> >
> > FP11 started changing file attributes on directories when they were
> > modified.
> > Many programs assume there is only the D flag so they do not find
> > directories with A flags.  They should a searched for the D flag with
> > don't cares for the others.
> 
> Just reset the directory attributes to clear the archive bit and the
> problem goes away for a bit.  I just inserted a small command file to
> do this after every mail check.  PITA, but it works.
> 
> Will Honea <whonea@codenet.net>

-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)
--------------E842C0AB973EFB57B445559B
Content-Type: text/plain; charset=us-ascii;
 name="dirfix.cmd"
Content-Transfer-Encoding: 7bit
Content-Disposition: inline;
 filename="dirfix.cmd"

/*
dirfix.cmd - reset archive attribute on directories
Copyright 1999 by Chuck McKinnis,  Sandia Park, NM (USA)
mckinnis@ibm.net
*/

Trace 'N'

Parse Upper Arg parms

Call Setup

If parms = 'ALL' Then parms = SysDriveMap(, 'LOCAL')

Do i = 1 To Words(parms)
   Parse Value SysDriveInfo(Word(parms, i)) With drive used total .
   Say drive 'Used=' || used 'Total=' || total
   If used = total | used = '' | used = 0 Then Iterate
   drive = drive || '\'
   rc = SysFileTree(drive, 'dirs.', 'DSO', '++***', '-****')
   If dirs.0 = 1 Then Say dirs.0 'directory cleared on' drive
   Else Say dirs.0 'directories cleared on' drive
End
Call Cleanup
Return

Cleanup:
 Procedure Expose sysfuncs. 
 Do i = 1 To sysfuncs.0
    If sysfuncs.i <> '' Then Call RxFuncDrop(sysfuncs.i)
 End
 Return

Setup:
 sysfuncs.1 = 'SysFileTree'
 sysfuncs.2 = 'SysDriveMap'
 sysfuncs.3 = 'SysDriveInfo'
 sysfuncs.0 = 3
 Do i = 1 To sysfuncs.0
    If RxFuncQuery(sysfuncs.i) Then Call RxFuncAdd sysfuncs.i, 'RexxUtil',
sysfuncs.i
    Else sysfuncs.i = ''
 End
 Return

--------------E842C0AB973EFB57B445559B--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        06-Sep-99 00:51:20
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Innoval Web Watch Willy setup problem

From: dboultr@spamfree.erols.com

On Sun, 5 Sep 1999 12:49:57, Christian Hennecke 
<christian.hennecke@ruhr-uni-bochum.de> wrote:

> Has anyone had success in setting up the now freeware program Web Watch
> Willy from Innoval? It uses your Browser to access
> http://www.webwilly.com, but this server seems to be down.
> Is there any other way to configure WebWatchWilly? Otherwise the program
> would be useless.

Depends on what you mean by configure.  If you want to download a list
of sites to avoid, which is what I presume the web site did, you're 
out of luck.  It won't configure.

If, on the other hand, you just want the upgraded version of NetExtra 
that is part of WebWillyWatch, and you can't get past the 
configuration startup, that problem is solveable.

First, don't try to change the path to your web browser.  Once the 
program is configured, you can go back in the properties and change it
then.  Just keep hitting the "next" button and it will get past the 
configuration screens.  I believe that's what worked for me.

NetExtra was a really nice program in its day and well worth what I 
paid for it.  Even now, WebWillyWatch gives you a far greater 
capability to store all the URLs you've visited than Netscape does.  
The biggest problem I can identify with it now (aside from the asinine
name and the stupid dog icon) is that it gets confused when you run 
multiple browsers (versions of Netscape) and requires a whole lot of 
tweaking to record the history as you would prefer it be recorded.  In
fact, I'm still playing with it and can't yet be sure it works 
properly.  And then of course it's no longer supported by Innoval.  

Better, I think, to make your peace with Communicator and its more 
limited capabilities than come to rely on something the next fixpack 
or version of Communicator might break.

Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: tiemannj@gmx.de                                   05-Sep-99 04:56:28
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Can't type in DOS box after 50 days

From: Joerg Tiemann <tiemannj@gmx.de>

On Fri, 03 Sep 1999 10:56:28 -0500, Jim Lewis <jklewis@nospam.com> wrote:
>  You say your 2.1 box shows an uptime of 123 days? What program are you
> using to get that info? Does 2.1 not have the uptime wrap bug?

  I use UpdSig 1.* by Peter Engels. It uses an internal counter which
gets incremented each time the system counter overflows.  That way
uptimes up to 137 years can be measured. :-)  The programm output is
given as an update to an (signature) file which is of course free
configurable ...  UpdSig can be found on Peter's homepage:

	http://www.uni-bonn.de/~uzs0ad

PS: No, I don't use it (yet?) for signatures.  I just look into the 
specified file to see the uptime.
-- 
tiemannj@gmx.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Heinrich Heine Universitaet Duesseldorf (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        06-Sep-99 01:07:14
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: dboultr@spamfree.erols.com

On Sun, 5 Sep 1999 21:39:59, whonea@codenet.net (Will Honea) wrote:

> Just reset the directory attributes to clear the archive bit and the 
> problem goes away for a bit.  I just inserted a small command file to 
> do this after every mail check.  PITA, but it works.

Absolutely correct.  Removing the A archive bit makes the folder 
reappear.  I really wish they would have fixed this before they gave 
away the program, however.  I'm trying other alternatives for mail 
readers, but so far nothing appears to work any better for me than 
PRM.



Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        06-Sep-99 01:43:09
  To: All                                               06-Sep-99 05:58:22
Subj: MR/2 ICE

From: dboultr@spamfree.erols.com

As a refugee from PostRoadMailer, I've been trying out MR/s ICE which 
has been highly touted here over the years.  I know Nick has been a 
real supporter of OS/2 and very responsive to users of his program.  
Still, I'm finding that the version that I downloaded to try out 
(1.62) feels very much like an early beta.  I'm sure I'm missing 
something here.  Can anyone help?

1) Most of the help seems to have not yet been written.  Is this 
correct?  I saw reference under help to a manual online, but it seems 
to download a file called manual.exe to my hard drive.  That program 
will not run under OS/2 or DOS.  What am I missing here?  

2) I need the conversion utility for address books from PRM.  The link
on Nick's web site  says file not found.  Any ideas where I might get 
it?

3)  Is there any way to change the appearance of the Inbox page?  
There doesn't seem to be the ability to resize the columns.  Unless I 
use tiny font sizes, I can't see more than a word or two in each 
column.  ProNews handles this extremely well, and MR/2 doesn't seem to
handle it at all.

4)  Are taglines only possible with an add-in?

I really want to like this program.  I'm hoping that my feeling that 
it's a step back from ProNews is due to my unfamiliarity with it.




Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: SkidMARX@att.net                                  06-Sep-99 01:52:26
  To: All                                               06-Sep-99 05:58:22
Subj: Re: DB2 installation

From: SkidMARX@att.net

On Sun, 5 Sep 1999 19:04:59, prather@infi.net (Jerry Prather) wrote:

> Hi all,
> 
> I finally got both parts of the free DB2 (pecmn.zip and peen.zip)
> downloaded, unzipped, and installed.  But I think I've done
> something wrong 'cause I can't start the First Steps.
> 
> I have a stand-alone machine, not connected to any networks, but
> when I try to start DB2, I get asked for a user name and
> password.  I enter what I entered during the installation
> procedure, but the entries are rejected and I'm thrown out of the
> program.  Because of some language in the rejection, I decided
> that maybe it needed to have TCPIP installed and tried to do
> that.  I probably messed that up as well, knowing me.
> 
Jerry,

I had the same thing happen to me.  Did you by chance use lower case 
characters for the name/password combo ?

If so, somewhere on the IBM db2 website I found a help section where 
it stated that names/passwords must be in CAPS !!!

I haven't tried this fix yet myself but give it a shot and report back
;-)

Gregory L. Marx
SkidMARX@att.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: pasnak@delete.cableregina.com                     05-Sep-99 20:34:25
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: pasnak@delete.cableregina.com (J.P. Pasnak)

On Sun, 5 Sep 1999 15:06:20, donnelly@tampabay.rr.com (Buddy Donnelly)
woke up with a head full of whiskey and wrote:

> On Sun, 5 Sep 1999 07:57:12, pasnak@delete.cableregina.com (J.P. Pasnak) a 
> crit dans un message:
> 
> > I'll order one CD then, and check the license agreement.  If there are
> > no 'gotchas', I can burn a copy for about $3-4 ($2-3 for a CD 
> 
> By the way I just noticed yesterday that Office Depot has their Imation 
> CD-R special back on, 10 for $15 (US). 
> 
> (I haven't had to pay more than this price, and I'm averaging about a 
> dollar by looking around a lot and by buying in bulk.)
> 
> 

The best price I've come across is $39CDN for 20 (after GST and PST), 
so this is a pretty decent price, since I pay almost the same for 
labels and inserts :-)

J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          06-Sep-99 04:15:03
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 6 Sep 1999 04:34:51, pasnak@delete.cableregina.com (J.P. Pasnak) a 
crit dans un message:

snpt
> > By the way I just noticed yesterday that Office Depot has their Imation 
> > CD-R special back on, 10 for $15 (US). 
> > 
> > (I haven't had to pay more than this price, and I'm averaging about a 
> > dollar by looking around a lot and by buying in bulk.)
> 
> The best price I've come across is $39CDN for 20 (after GST and PST), 
> so this is a pretty decent price, since I pay almost the same for 
> labels and inserts :-)

We don' need no steenkeen' labels here. Got a good black Sharpie that does 
the job. And the insert that "comes with" can be turned around and written 
on the blank white back if we want to get fancy.

What's the $CDN-$US rate right now, anyway? Must be fairly sad because I 
haven't seen any of my Canadian neighbours down here this year.



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: jdb@juliand.com                                   05-Sep-99 23:50:26
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: Julian Dominic <jdb@juliand.com>

The program works great.  I was not only experiencing problems with PRM, but
WordPro as
well.  WordPro would not recognize my user directories.

Chuck McKinnis wrote:

> Some else thought that this might be IDE driver related, but I have all
> SCSI, and I see the same problems.  I have attached my little cmd
> utility that I run with the "all" parameter to clean up all of my fixed
> drives.
>
> Will Honea wrote:
> >
> > On Sun, 5 Sep 1999 02:03:16, icedancer-zamboni@ibm-zamboni.net (Ken
> > Walter) wrote:
> >
> > > On Sun, 5 Sep 1999 00:46:18, dboultr@spamfree.erols.com wrote:
> > >
> > > >On Sat, 4 Sep 1999 12:30:18, no-one@nospam wrote:
> > > >
> > > >> >When I installed fp11 6 weeks ago...I began to lose sight of the
mail
> > > >> >folders in PRMailer V3.0.  The folders and files still exist, the
> > > >> >folders just disappear in the application.   Several others reported
> > > >> >the same problem.
> > > >>
> > > [...]
> > > >Since it applies to both versions of PRM, I'm almost positive it's
> > > >Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file
> > > >before reinstalling, so it has to be an outside influence.  As I'm
> > > >unwilling to back out FP 11, I'm looking for a new mail reader.
> > >
> > > FP11 started changing file attributes on directories when they were
> > > modified.
> > > Many programs assume there is only the D flag so they do not find
> > > directories with A flags.  They should a searched for the D flag with
> > > don't cares for the others.
> >
> > Just reset the directory attributes to clear the archive bit and the
> > problem goes away for a bit.  I just inserted a small command file to
> > do this after every mail check.  PITA, but it works.
> >
> > Will Honea <whonea@codenet.net>
>
> --
> Chuck McKinnis
> Senior Systems Engineer
> Denver Solutions Group, Inc.
> IBM Business Partner
> IBM Senior Systems Engineer (retired)
>
>   ------------------------------------------------------------------------
> /*
> dirfix.cmd - reset archive attribute on directories
> Copyright 1999 by Chuck McKinnis,  Sandia Park, NM (USA)
> mckinnis@ibm.net
> */
>
> Trace 'N'
>
> Parse Upper Arg parms
>
> Call Setup
>
> If parms = 'ALL' Then parms = SysDriveMap(, 'LOCAL')
>
> Do i = 1 To Words(parms)
>    Parse Value SysDriveInfo(Word(parms, i)) With drive used total .
>    Say drive 'Used=' || used 'Total=' || total
>    If used = total | used = '' | used = 0 Then Iterate
>    drive = drive || '\'
>    rc = SysFileTree(drive, 'dirs.', 'DSO', '++***', '-****')
>    If dirs.0 = 1 Then Say dirs.0 'directory cleared on' drive
>    Else Say dirs.0 'directories cleared on' drive
> End
> Call Cleanup
> Return
>
> Cleanup:
>  Procedure Expose sysfuncs.
>  Do i = 1 To sysfuncs.0
>     If sysfuncs.i <> '' Then Call RxFuncDrop(sysfuncs.i)
>  End
>  Return
>
> Setup:
>  sysfuncs.1 = 'SysFileTree'
>  sysfuncs.2 = 'SysDriveMap'
>  sysfuncs.3 = 'SysDriveInfo'
>  sysfuncs.0 = 3
>  Do i = 1 To sysfuncs.0
>     If RxFuncQuery(sysfuncs.i) Then Call RxFuncAdd sysfuncs.i, 'RexxUtil',
sysfuncs.i
>     Else sysfuncs.i = ''
>  End
>  Return



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: tennisfan888@my-deja.com                          06-Sep-99 04:52:23
  To: All                                               06-Sep-99 10:36:18
Subj: AOL limitations

From: tennisfan888@my-deja.com

anybody know if AOL can be used to chat to people viewing the same page
as i am, without giving them the address....that is, is there a plug-in
i could use to view a page simultaneously as i chat to people on the
same page???

thanks,

the FaN


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: tom@NOSPAMsteensoft.hobby.nl                      05-Sep-99 18:23:19
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Innoval Web Watch Willy setup problem

From: "T.J.Steen" <tom@NOSPAMsteensoft.hobby.nl>

Hi,

I had the same experience.

I will try it on monday again, maybe the server is only down in the weekend.

Tom


On Sun, 05 Sep 1999 14:49:57 +0200, Christian Hennecke wrote:

:> Hi all!
:> 
:> Has anyone had success in setting up the now freeware program Web Watch
:> Willy from Innoval? It uses your Browser to access
:> http://www.webwilly.com, but this server seems to be down.
:> Is there any other way to configure WebWatchWilly? Otherwise the program
:> would be useless.
:> 
:> Christian Hennecke
:> -- 
:> Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

Greetings,

T.J. Steen

---------------------------------------------------
e-mail : tom@steensoft.hobby.nl
                t.steen@hccnet.nl

Website Europe : http://www.hobby.nl/~steensoft/
Website USA      : http://www.os2ss.com/users/tjsteen/
---------------------------------------------------



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET-NL (http://www.nl.uu.net) (1:109/42)

+----------------------------------------------------------------------------+

From: compgeek13@my-deja.com                            06-Sep-99 05:25:23
  To: All                                               06-Sep-99 10:36:18
Subj: Re: AOL limitations

From: compgeek13@my-deja.com

FAN,

Here is the problem with AOL...there is NO plugin that allows
simultaneous viewing of a webpage AND chat to someone on that page.
Also, AOL doesn't let you transfer files.  Here is my recommendation.  I
did a 9 engine search and came up with only ZADU (http://www.zadu.com).
This company makes a holistic client program that allows people on the
SAME webpage to talk/transfer files/view other webpages together.

Try it and tell me what you think.

compgk



In article <7qvhar$ve$1@nnrp1.deja.com>,
  tennisfan888@my-deja.com wrote:
> anybody know if AOL can be used to chat to people viewing the same
page
> as i am, without giving them the address....that is, is there a
plug-in
> i could use to view a page simultaneously as i chat to people on the
> same page???
>
> thanks,
>
> the FaN
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: ircdeus13@my-deja.com                             06-Sep-99 07:22:00
  To: All                                               06-Sep-99 10:36:18
Subj: Re: AOL limitations

From: ircdeus13@my-deja.com

i agree w/ the geek on this one...there is only one company that i know
of that makes what ZADU did (http://www.zadu.com).  drop the AOL and
ZADU will grant every wish you ever wanted (ok, maybe not, but it will
allow you to meet people with the same interests...and what could be
better than that???)

ircdeus13


In article <7qvhar$ve$1@nnrp1.deja.com>,
  tennisfan888@my-deja.com wrote:
> anybody know if AOL can be used to chat to people viewing the same
page
> as i am, without giving them the address....that is, is there a
plug-in
> i could use to view a page simultaneously as i chat to people on the
> same page???
>
> thanks,
>
> the FaN
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: ron.beernink@paradise.net.nz                      06-Sep-99 20:01:22
  To: All                                               06-Sep-99 10:36:18
Subj: Limitation to no. of OS/2 processes?

From: "Ron Beernink" <ron.beernink@paradise.net.nz>

Does anyone know of an OS/2 (Warp Server) limitation that would explain why
some of our systems fail when they get to around 150-160 processes?

Regards

Ron Beernink
Technical Designer
Electronic Business
NZ Post
Wellington, New Zealand


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Paradise Net Ltd. Customer (1:109/42)

+----------------------------------------------------------------------------+

From: jakey925@my-deja.com                              06-Sep-99 07:50:26
  To: All                                               06-Sep-99 10:36:18
Subj: Re: AOL limitations

From: jakey925@my-deja.com

fan,

visit ZADU (http://www.zadu.com).  this will allow you to look at a
webpage like (http://www.usopen.org) AND find out who else is on that
page---and talk to them!!!

seeya.



In article <7qvhar$ve$1@nnrp1.deja.com>,
  tennisfan888@my-deja.com wrote:
> anybody know if AOL can be used to chat to people viewing the same
page
> as i am, without giving them the address....that is, is there a
plug-in
> i could use to view a page simultaneously as i chat to people on the
> same page???
>
> thanks,
>
> the FaN
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: miji2@efnet.irc                                   06-Sep-99 07:50:25
  To: All                                               06-Sep-99 10:36:18
Subj: Re: StarOffice 5.1 - Statistics

From: Simon <miji2@efnet.irc>

John M Price PhD wrote:
> 
> Am I correct in my looking at this and finding there are no advanced stat
> functions?  Indeed, maybe no stat functions?

Well, there are (some) stat functions included .. maybe you did not do a full
install of that part of SO ? My 5.1 install shows about 80 statistical
functions available. That's under Insert -> Function List
 
> Through help, the Statistical gets not a thing, nor does Add-ins.

The main problem with SO is that the help is _very_ lacking. 

> Regression tools, trend, growth, etc. would be great.

You mean on plots? Or via functions?

> The various means, Arithmetic, Geometric, Harmonic are also important.

Arithmetic 
=AVERAGE(number) 

Geometric
=GEOMEAN(number)

Harmonic
=HARMEAN(number)

> John M. Price, PhD                                     jmprice@calweb.com

Good luck!



Simon
--
In the future, everyone will work for Microsoft ...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: tennisfan888@my-deja.com                          06-Sep-99 08:17:28
  To: All                                               06-Sep-99 10:36:18
Subj: Re: AOL limitations

From: tennisfan888@my-deja.com

THANKS!!!

i nailed the ZADU page (http://www.zadu.com) and found it exactly what i
needed.  soon, i'll be able to download the client and talk to people
that visit the same webpages as i do.

thanks again :::)))

In article <7qvhar$ve$1@nnrp1.deja.com>,
  tennisfan888@my-deja.com wrote:
> anybody know if AOL can be used to chat to people viewing the same
page
> as i am, without giving them the address....that is, is there a
plug-in
> i could use to view a page simultaneously as i chat to people on the
> same page???
>
> thanks,
>
> the FaN
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: C.J.@btsoftware.com                               06-Sep-99 12:45:24
  To: All                                               06-Sep-99 10:36:18
Subj: check out  File Commander/2

From: "C.J." <C.J.@btsoftware.com>

 File Commander/2
************************

File Manager

File Commander is a 32 bit text mode file manager and shell that allows you
to locate, copy, move, delete, view, edit and execute your files in a quick,
convenient and customizable manner.

Versions for windows 95/98/NT and OS2 are available.

Check it out and download File Commander/2 for a free trial period from:
	http://www.btsoftware.com/os2/filecmdr.htm




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: C.J. (1:109/42)

+----------------------------------------------------------------------------+

From: J.vandenHorn@fibre.a2000.nl                       06-Sep-99 12:00:27
  To: All                                               06-Sep-99 14:34:06
Subj: Re: Limitation to no. of OS/2 processes?

From: J.vandenHorn@fibre.a2000.nl (Jeroen van den Horn)

Ron,

Check your 'THREADS=xxx' statement in the CONFIG.SYS. By default this 
is set to 1024 and specifies the number of thread slots the kernel 
reserves at IPL. Every process has at least one thread, but most OS/2 
apps have many many more. Probably you're hitting the 1024 threads by 
starting that many processes.

Jeroen

On Mon, 6 Sep 1999 08:01:45, "Ron Beernink" 
<ron.beernink@paradise.net.nz> wrote:

> Does anyone know of an OS/2 (Warp Server) limitation that would explain why
> some of our systems fail when they get to around 150-160 processes?
> 
> Regards
> 
> Ron Beernink
> Technical Designer
> Electronic Business
> NZ Post
> Wellington, New Zealand
> 
> 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A2000 Kabeltelevisie en Telecommunicatie (1:109/42)

+----------------------------------------------------------------------------+

From: jan.hartman@fil.lu.se                             06-Sep-99 14:20:02
  To: All                                               06-Sep-99 14:34:06
Subj: Question about quality of pdf-files from ghostscript

From: "Jan Hartman" <jan.hartman@fil.lu.se>

Hi!

In the process of sending a manuscript for a book to a publisher,
I was told that they wanted a pdf-file, not a postscript file as I
earlier
was led to believe. However, even though I can create a postscript
file
which is 1200x1200 dpi, I can only get ghostview/script to make a
pdf-file which is 300x300 dpi. This is not good enough. Any ideas
about
how to make a highquality pdf-file?

I use DeScribe word processor, and I do not want to get Acrobat
destiller
or some other software to do this.

Thanks for all help,

/ Jan 
===================================================
Jan Hartman
Filosofiska institutionen/Department of Philosophy
Lunds Universitet/Lund University                                       
Kungshuset, Lundagrd                                  +46-(0)46 2223253
S-222 22 Lund                                              fax +46-(0)46
2224424
Sweden
E-mail: Jan.Hartman@fil.lu.se


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Lund University (1:109/42)

+----------------------------------------------------------------------------+

From: dcurren@ibm.net                                   06-Sep-99 06:38:06
  To: All                                               06-Sep-99 14:34:06
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: "Dale Curren" <dcurren@ibm.net>

>Since it applies to both versions of PRM, I'm almost positive it's 
>Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file 
>before reinstalling, so it has to be an outside influence.  As I'm 
>unwilling to back out FP 11, I'm looking for a new mail reader.

We're having a lot of fun with jstreet.  A fellow named Paul VanKeep is fixing 

many of the little problems and it's becoming quite wonderful.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: van.enckevort@hccnet.nl                           06-Sep-99 11:44:19
  To: All                                               06-Sep-99 14:34:06
Subj: Re: Limitation to no. of OS/2 processes?

From: "D.J. van Enckevort" <van.enckevort@hccnet.nl>

On Mon, 6 Sep 1999 20:01:45 +1200, Ron Beernink wrote:

>Does anyone know of an OS/2 (Warp Server) limitation that would explain why
>some of our systems fail when they get to around 150-160 processes?
>
If I recall correctly a standard OS/2 setup has a maximum of 256 threads, but
this can be set to upto 4095. Look for the line threads=xxxx in your
config.sys. For a system with 150-160 processes you would at least set it to
640 (an average 4 threads per process). OS/2 always allocates one memory page
(4kb) per thread so you shouldn't set it to high either.
Ciao,
   David

-- 
David van Enckevort

homepage: http://huizen.dds.nl/~enckevor
          http://home.hccnet.nl/van.enckevort



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://home.hccnet.nl/van.enckevort (1:109/42)

+----------------------------------------------------------------------------+

From: david.paisley@nospam                              06-Sep-99 13:00:14
  To: All                                               06-Sep-99 14:34:06
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: david.paisley@nospam (David Paisley)

On Mon, 6 Sep 1999 04:15:06, donnelly@tampabay.rr.com (Buddy Donnelly)
wrote:

> haven't seen any of my Canadian neighbours down here this year.
> 
<snip>

The Canadian dollar, affectionally known as the Loonie , has been 
sitting around .66-.67 US all summer. My wife works in the airline 
industry, and the rate used there is criminal.

Another recent escalating cost to Canadians has been insurance. 
Ontario's medical insurance, (and I am sure other provinces,) have 
been trying to cut costs during the nineties.They have been cutting 
back on long term out of country coverage, plus capping payouts. You 
can't take insurance for granted any more.

thanks,

David Paisley
Toronto, Ontario, Canada

Warp 4 FP 11

anti spam replace "nospam" with "sympatico.ca"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sympatico (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  06-Sep-99 13:11:16
  To: All                                               06-Sep-99 14:34:06
Subj: Re: DB2 installation

From: prather@infi.net (Jerry Prather)

In message
<1bMmtd7zwYPT-pn2-dRCp79ddL4fW@237.pittsburgh-03-04rs.pa.dial-acc
ess.att.net> - SkidMARX@att.net writes:
:>
:>Jerry,
:>
:>I had the same thing happen to me.  Did you by chance use lower case 
:>characters for the name/password combo ?
:>
:>If so, somewhere on the IBM db2 website I found a help section where 
:>it stated that names/passwords must be in CAPS !!!
:>
:>I haven't tried this fix yet myself but give it a shot and report back
:>;-)

You are absolutely correct.  When installing DB2 I did enter the
userid and password in lower case.  I got past the login by using
USERID and PASSWORD.  However, I've had to (try to) blow away DB2
and my (failed) attempts to install TCPIP - which has loused
everything up; I can't even get InJoy to start anymore!

I'll remember your tip when I make another effort to install DB2.
Thanks for the help!

Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: raphaelt@netnews.worldnet.att.net                 06-Sep-99 10:37:28
  To: All                                               06-Sep-99 14:34:07
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum)

"Dale Curren" <dcurren@ibm.net> wrote:

>>Since it applies to both versions of PRM, I'm almost positive it's 
>>Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file 
>>before reinstalling, so it has to be an outside influence.  As I'm 
>>unwilling to back out FP 11, I'm looking for a new mail reader.
>
>We're having a lot of fun with jstreet.  A fellow named Paul VanKeep is
fixing 
>many of the little problems and it's becoming quite wonderful.

Now, that sounds interesting.  Mind telling us a little
more?  A url maybe?

-- 
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: rappleby@cadvision.com                            06-Sep-99 09:00:19
  To: All                                               06-Sep-99 14:34:07
Subj: Re: Swap file

From: rappleby@cadvision.com (Ray Appleby)

On Sat, 4 Sep 1999 18:32:13, "J. R. Fox" <jr_fox@earthlink.net> wrote:

> > >->I have 256M Ram, but never
> > >->changed my swapfile from its default, which I think is around
> > >->2M.  Would I gain anything by bumping that up to say 10 or 20M?
> > >

With 256Mb of RAM, your system would rarely need to increase the size 
of your swap file beyond the initial 2Mb because it is able to use 
availble RAM instead of having to swap pieces of memory to disk.  
Leave it at 2Mb - if the system needs to, it will expand the swap file
all by itself without any user intervention.

Best Regards,
Ray Appleby                     rappleby@cadvision.com
[Team OS/2]                 Multitasking at OS/2 Warp4 Speed.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CADVision Development Corporation (http://www.cad
(1:109/42)

+----------------------------------------------------------------------------+

From: rappleby@cadvision.com                            06-Sep-99 09:06:25
  To: All                                               06-Sep-99 14:34:07
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: rappleby@cadvision.com (Ray Appleby)

On Sat, 4 Sep 1999 16:06:36, "Andre Nancoz" <anancoz@interport.net> 
wrote:

> I saw a note somewhere that FP11 is setting both the Directory AND the
> Archive attribute bit when a new directory is created. This causes some
> programs problems. Try looking at the attributes of the directory
> (folder) you created and turn off the Archive bit.

There was a recent post in one of the other OS/2 newsgroups where IBM 
has acknowleged this problem and since most programs assume that the 
archive bit on directories is never changed, they have indicated that 
it will be changed back to pre-FP11 behaviour in the next fixpack.  
Until then, you can just reset the archive attribute to get your 
folder(s) back.

Best Regards,
Ray Appleby                     rappleby@cadvision.com
[Team OS/2]                 Multitasking at OS/2 Warp4 Speed.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CADVision Development Corporation (http://www.cad
(1:109/42)

+----------------------------------------------------------------------------+

From: josepach@meganet.net                              06-Sep-99 16:00:20
  To: All                                               06-Sep-99 14:34:07
Subj: Re: Innoval Web Watch Willy setup problem

From: josepach@meganet.net (Joseph Pacheco)

I think NetExtra/WebWilly is a useful program aside from the porn 
filtering. The ability to search thorugh a log of all the urls you 
visited is priceless. It has a significant site list which allows you 
to view and quickly jump to a site you visited most in the past 
week/month/year. There are so many options and awesome features that 
it is deserved of a complete 5 page article review.

If you haven't purchased this program, I highly recommend it. Even 
though it is free, I actaully sent in a donation of $50.00 because 
this is what I feel the program is worth. I like it a lot.

-JP 

I was offered a chance to see God; 
but I declined--my faith in God, 
is enough. Born twice; will die once.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jhimmel@i-2000.com                                06-Sep-99 16:13:23
  To: All                                               06-Sep-99 14:34:07
Subj: Netscape and Win16 Plug-ins???

From: jhimmel@i-2000.com (James Himmelman)

I have not been able to get ANY Win16 Plug-in to show up in Help-About
Plugins in any version of Netscape since v4.04. There is no indication
of Win16 Plug-in support whatsoever on my version. Un-installing and 
re-installing has not helped. What am I missing?

[[[ James Himmelman - jhimmel@i-2000.com ]]]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: horseman@ibm.net                                  06-Sep-99 11:49:21
  To: All                                               06-Sep-99 14:34:07
Subj: Re: Alternate CONFIGs 

From: Tony Wright <horseman@ibm.net>

Buddy Donnelly wrote:

> On Sat, 4 Sep 1999 19:01:59, "J. R. Fox" <jr_fox@earthlink.net> a ?crit
> dans un message:
>
>  I think there's an ALT-F1 (?) facility for using
> > other versions of CONFIG.SYS, but I just rename 'em and shuttle
> > them around.  There are times when I may want to boot up without certain
> > other components, too.
>
> This is very simple to do. And very useful, in my opinion.
>
> 1. Place your alternate CONFIG.SYS in \OS2\BOOT and rename it, we'll say,
> to CONFIG.B (for Buddy?).
>
> 2. On any reboot, you can Alt-F1 to the choices screen and then hit the key
> B, and you'll now be booting with .\OS2\BOOT\CONFIG.B instead of
> \CONFIG.SYS, for just this one time. (The screen does not have to tell you
> that you have this choice for it to work.)
>
> The "reserved" keynames are 1, 2, 3, M, V, and X. If you're using Dennis
> Bareis very handy ARCHIVE utility, which allows creation of up to nine
> different desktops, then don't use anything but letters. (I've never tried
> it with other characters like \ or / or `, but neither can I imagine
> running out of alphabet letters.)
>
> If your memory is bad and you want to remind yourself each time what your
> choices are, and what they do, you'll want to edit \OS2\BOOT\ALTF1BOT.SCR
> (IBM says) with a text editor to add a line for B and include a
> description. See OS/2 Command Ref Help for "Displaying Your CONFIG.?
> Choices".
>
> That said, I prefer editing ALTF1TOP.SCR, because I don't think OS/2 ever
> messes with that one, and if you do it too you might want to remove a
> couple of the blank lines on that page to make more room.
>
> OS/2 Help also talks about making Batch files to help with this, but you
> don't need them. Maybe it applies to an older version of Warp?

and there again....maybe it doesn't(exclusively)<g>?Depends on what you want
to do/achieve?
Do you want to emulate a "restore" as in retrieving the Archives 1,2,3 or X, M 
which is "hardcoded" into the "arcrecov" exe to copy over the existing
files(using keys.$$$ to index appropriate files)?
If so then you would need a "batch file" to do this otherwise it would just
"load" the "optional" config files and leave say original  \config.sys as is.

You (ideally) need to reproduce ALTF1.cmd and ALTF1BOT.SCR (or TOP if you're
that way inclined<g>) to elucidate on exactly what you're doing versus what
your end objective is?

No point in me appending my actual cmd file here(it confuses the h*ll out of
me<g>) but a more simple derivative is the one shipped:
ALTF1.CMD
==========
@ECHO OFF
REM
REM         Make sure at least one parameter was passed
REM
IF @%1==@ goto end
REM
REM         If a V or v is passed, call SETVGA
REM
IF V==%1 GOTO setvga
IF v==%1 GOTO setvga
REM
REM         If an M or m is passed, call SETVGA
REM
IF M==%1 GOTO setvga
IF m==%1 GOTO setvga
REM
REM         Otherwise, assume its a restore of an archive
REM
arcrecov %1
GOTO end
:setvga
setvga
:end


ALTF1BOT.SCR:
==============
      D = Docked(NewDasd CDROM + MO + SCSI)
      P = Portable/Undocked
      E = Emergency (no Process Commander)
      R = Recover to original

So in this scenario I would have config.D  (Docked) *.P (portable) *.E
(emergency) and
something else possibly (?) which would allow "archiver" to load the
appropriate relevant configs but not actually copy them over the originals(as
in your examples as well presumably?).

Oh what the hell - let's make this interactively educational(I just know I'm
going to regret this again<g>) -
Now your mission Mr Donelly (should you wish to accept it) is to modify
ALTF1.CMD above so that you achieve following:
1.Select any of above first 3 options
2.Provide some mechanism such that existing config/autoexec etc are preserved
3.Provide for batch cmds to copy over both these(and other?) files
4.IE Additionally backup and copy alternate OS2???.ini's and desktop structure
5.Provide the "smarts" so that the 4th option  restores everything as was
before you embarked on this lunacy.

However, I won't insult you by suggesting we "mark" the homework and award
"Florida oranges" for your best solutions<vbg>

But you could get additional credits for defining the mechanism to
(optionally) provide the permutations to:
1. Not invoke alternate desktop(s)
2. Not copy over originals
on any of the above.....(thus you would have spotted the necessity for option
1-4 to perhaps be a little more "smarter" than you first  thought?).

and for an "honors" you would need to specify how to programmatically flip the 
Desktop archive flag and create/backup the OS2.key files as well.

> I've got 4 alternates: one that loads nearly zero drivers (Z); one that
> loads CMD.EXE as the COMSPEC (T) instead of 4OS2.EXE or vice versa (4); and
> one that simply forces an Autocheck on every partition (A). You do have to
> be careful to update these versions with any other changes that get made to
> your base CONFIG.SYS. (That's the biggest problem I've run into, when I
> need one of the alternates it is slightly out of date for something or
> other.)

Perhaps if you were really clever then you'd have a "base" config and
"changes" file and dynamically create the required configs from ALTF1.CMD so
you wouldn't have so much problems keeping them "up-to-date"?<g>...or perhaps
you wouldn't...    :-(

> By the way, there's another very nifty utility (freeware now) called
> BOOTSET that works a little differently, being called at the completion of
> your normal CONFIG.SYS, but it can accomplish the same thing if you read
> the docs. I've used it for a long time and recommend it for its own sake,
> but won't go into it here.
>
> Good luck,
>
> Buddy
>
> Buddy Donnelly
> donnelly@tampabay.rr.com


--
Rgds Tony W   Email: horseman@ibm.net

"humanum est errare: To err is human
.... and to fail is to be a Project Manager...
...but to foul things up completely needs a computer!"




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Equi-Tek CompCon (1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                06-Sep-99 09:22:01
  To: All                                               06-Sep-99 14:34:07
Subj: Re: StarOffice 5.1 - Statistics

From: John M Price PhD <jmprice@calweb.com>

In comp.os.os2.apps article <37D37706.A26FF7E8@efnet.irc> Simon
<miji2@efnet.irc> wrote:
: John M Price PhD wrote:
:> 
:> Am I correct in my looking at this and finding there are no advanced stat
:> functions?  Indeed, maybe no stat functions?

: Well, there are (some) stat functions included .. maybe you did not do a
full
: install of that part of SO ? My 5.1 install shows about 80 statistical
: functions available. That's under Insert -> Function List

Yes, a poster pointed me there in email.  Pretty clumsy, but I can get
used to it.  In other spreadsheets it's in Tools or Data or ....

:> Through help, the Statistical gets not a thing, nor does Add-ins.

: The main problem with SO is that the help is _very_ lacking. 

Yep.

:> Regression tools, trend, growth, etc. would be great.

: You mean on plots? Or via functions?

Well, I looked, and I must say that SO is no QuattroPro, nor Excel.
That's for sure.  Especially regarding Excel's regression tool, for
instance.

I also note that the FTEST is pretty simplistic.  Two way ANOVA is pretty
common these days in a spreadsheet, but perhaps that is in matrix, where I
found the multiple regression stuff.


-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

"God has no place within these
 walls, just as facts have no
 place within organised religion."
      - The Simpsons, #100. 1994

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: coville@localnet.com                              06-Sep-99 16:43:26
  To: All                                               06-Sep-99 14:34:07
Subj: Re: Important News From Dan Porter of Innoval

From: coville@localnet.com (Brian)

Now if there was only a way to still purchase the spellguard for PRM 
product.  That was only offered by Innoval, I checked w/ the author of
spellguard.

	Brian

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  06-Sep-99 11:01:24
  To: All                                               06-Sep-99 16:46:13
Subj: FP11 and the little archive bit problem in directory entries

From: Chuck McKinnis <mckinnis@ibm.net>

This is a multi-part message in MIME format.
--------------42017342A083949D9FA392C5
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit

Want to help me test this one?  I have tidied up dirfix and added a
"test" option.

Did a search in IBMLink and got 4 hits on this problem dated 1993-1997.

They all involve what happens when a program issues a DosFindFirst with
the MUST_HAVE_DIRECTORY option or does a compare against attribute bits
instead of a test.  It appears that the real description of the
MUST_HAVE_DIRECTORY API option is that ONLY the Directory attribute bit
must be set.  If a DosFindFirst call is made 
with the MUST_HAVE_DIRECTORY option, only those directories with ONLY
the Directory attribute bit set will be returned.

In all but one case , the real problem was in the application code and
not the OS/2 file system.  It appears to me that FP11 changes the way
that OS/2 maintains the archive attribute on directories, and we now
have a bunch of applications out there with incorrect coding.  The case
that involved an IBM fix dealt with HPFS386 setting the 
Archive bit when it did an update to the ACL or EA of a directory entry.

Pursuing this thread, I decided to replace the FP11 HPFS.IFS and
UHPFS.DLL with the corresponding modules from FP10.  Don't know what I
may have broken, but I have been running for almost 2 hours, and "dirfix
all test" doesn't show any Archive bits set in directory entries.

If you come up with the same results that I am getting, I will start
posting this little tip to the OS/2 community.


-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)
--------------42017342A083949D9FA392C5
Content-Type: text/plain; charset=us-ascii;
 name="dirfix.cmd"
Content-Transfer-Encoding: 7bit
Content-Disposition: inline;
 filename="dirfix.cmd"

/*
dirfix.cmd - reset archive attribute on directories
Copyright 1999 by Chuck McKinnis,  Sandia Park, NM (USA)
mckinnis@ibm.net
*/

Trace 'N'

Parse Upper Arg parms

test = Pos('TEST', parms) <> 0

If test Then
   Parse Var parms . 'TEST' parms
   If parms = '' Then
      Parse Var parms parms 'TEST' 

If parms = '' Then
   Do
      Say 'Report on and reset directory entries'
      Say '   that have the archive bit set on'
      Say ''
      Say 'Usage - dirfix x: | all [test]'
      Say '   test - just report the findings'
      Return
   End

Call Setup

If parms = 'ALL' Then
   parms = SysDriveMap(, 'LOCAL')
Else
   If Lastpos(':', parms) <> Length(parms) Then
      parms = parms || ':'

tst_attrib = '++***'
chg_attrib = '-****'

if test Then
   chg_attrib = '*****'

Do i = 1 To Words(parms)
   Parse Value SysDriveInfo(Word(parms, i)) With drive free total . 
   If free = total | free = '' | free = 0 Then
      Iterate i
   drive = drive || '\'
   rc = SysFileTree(drive, 'dirs.', 'DSO', tst_attrib, chg_attrib)
   If dirs.0 > 0 Then
      Do i = 1 To dirs.0
         Say 'Archive bit set on in' dirs.i
      End
   Else
      Say 'No archive bits found set in directories on' drive
   If \test Then
      Do
         If dirs.0 = 1 Then
            Say dirs.0 'directory cleared on' drive
         Else
            Say dirs.0 'directories cleared on' drive
      End
End
Call Cleanup
Return

Cleanup:
 Procedure Expose sysfuncs. 
 Do i = 1 To sysfuncs.0
    If sysfuncs.i <> '' Then
       Call RxFuncDrop(sysfuncs.i)
 End
 Return

Setup:
 Procedure Expose sysfuncs.
 sysfuncs.1 = 'SysFileTree'
 sysfuncs.2 = 'SysDriveMap'
 sysfuncs.3 = 'SysDriveInfo'
 sysfuncs.0 = 3
 Do i = 1 To sysfuncs.0
    If RxFuncQuery(sysfuncs.i) Then
       Call RxFuncAdd sysfuncs.i, 'RexxUtil', sysfuncs.i
    Else
       sysfuncs.i = ''
 End
 Return

--------------42017342A083949D9FA392C5--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  06-Sep-99 11:04:21
  To: All                                               06-Sep-99 16:46:13
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: Chuck McKinnis <mckinnis@ibm.net>

See FP11 and the little archive bit problem ...

Ray Appleby wrote:
> 
> On Sat, 4 Sep 1999 16:06:36, "Andre Nancoz" <anancoz@interport.net>
> wrote:
> 
> > I saw a note somewhere that FP11 is setting both the Directory AND the
> > Archive attribute bit when a new directory is created. This causes some
> > programs problems. Try looking at the attributes of the directory
> > (folder) you created and turn off the Archive bit.
> 
> There was a recent post in one of the other OS/2 newsgroups where IBM
> has acknowleged this problem and since most programs assume that the
> archive bit on directories is never changed, they have indicated that
> it will be changed back to pre-FP11 behaviour in the next fixpack.
> Until then, you can just reset the archive attribute to get your
> folder(s) back.
> 
> Best Regards,
> Ray Appleby                     rappleby@cadvision.com
> [Team OS/2]                 Multitasking at OS/2 Warp4 Speed.

-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: postmaster@[127.0.0.1]                            06-Sep-99 12:07:01
  To: All                                               06-Sep-99 16:46:13
Subj: Re: Innoval Web Watch Willy setup problem

From: postmaster@[127.0.0.1]

In <q9YupCd3R6kG-pn2-EP5SjKdl1v2w@dial-AA-p2-195.bos.ma.meganet.net>, on
09/06/99 
   at 04:00 PM, josepach@meganet.net (Joseph Pacheco) said:

>I think NetExtra/WebWilly is a useful program aside from the porn 
>filtering. The ability to search thorugh a log of all the urls you 
>visited is priceless. It has a significant site list which allows you  to
>view and quickly jump to a site you visited most in the past 
>week/month/year. There are so many options and awesome features that  it
>is deserved of a complete 5 page article review.

>If you haven't purchased this program, I highly recommend it. Even  though
>it is free, I actaully sent in a donation of $50.00 because  this is what
>I feel the program is worth. I like it a lot.

This is fine, except I am unable to initiate the program at all because
their server is down.  Over a year ago I tried this program also and I was
unable to initialize it because I could not get through to their server.

Any ideas on setting it up?

--
GK
            
FrodoJRR at Interaccess dot com
OS/2 Version 4.00 FixPack 11 
There are 31 Processes with 116 Threads.
This machine's uptime is 0d 4h 47m 14s 890ms.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  06-Sep-99 11:30:11
  To: All                                               06-Sep-99 16:46:13
Subj: Re: FP11 and the little archive bit problem in directory entries

From: Chuck McKinnis <mckinnis@ibm.net>

This is a multi-part message in MIME format.
--------------5F2BCBE64B94FA43403F00A3
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit

Sorry, had a minor problem parsing the argument in dirfix.
-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)
--------------5F2BCBE64B94FA43403F00A3
Content-Type: text/plain; charset=us-ascii;
 name="dirfix.cmd"
Content-Transfer-Encoding: 7bit
Content-Disposition: inline;
 filename="dirfix.cmd"

/*
dirfix.cmd - reset archive attribute on directories
Copyright 1999 by Chuck McKinnis,  Sandia Park, NM (USA)
mckinnis@ibm.net
*/

Trace 'N'

Parse Upper Arg drives test .

If drives = 'TEST' Then
   Parse Upper Arg test drives .

If Abbrev(test, 'TEST') Then
   test = 1
Else
   test = 0

If drives = '' Then
   Do
      Say 'Report on and reset directory entries'
      Say '   that have the archive bit set on'
      Say ''
      Say 'Usage - dirfix x: | all [test]'
      Say '   test - just report the findings'
      Return
   End

Call Setup

If drives = 'ALL' Then
   drives = SysDriveMap(, 'LOCAL')
Else
   If Lastpos(':', drives) <> Length(drives) Then
      drives = drives || ':'

tst_attrib = '++***'
chg_attrib = '-****'

if test Then
   chg_attrib = '*****'

Do i = 1 To Words(drives)
   Parse Value SysDriveInfo(Word(drives, i)) With drive free total . 
   If free = total | free = '' | free = 0 Then
      Iterate i
   drive = drive || '\'
   rc = SysFileTree(drive, 'dirs.', 'DSO', tst_attrib, chg_attrib)
   If dirs.0 > 0 Then
      Do i = 1 To dirs.0
         Say 'Archive bit set on in' dirs.i
      End
   Else
      Say 'No archive bits found set in directories on' drive
   If \test Then
      Do
         If dirs.0 = 1 Then
            Say dirs.0 'directory cleared on' drive
         Else
            Say dirs.0 'directories cleared on' drive
      End
End
Call Cleanup
Return

Cleanup:
 Procedure Expose sysfuncs. 
 Do i = 1 To sysfuncs.0
    If sysfuncs.i <> '' Then
       Call RxFuncDrop(sysfuncs.i)
 End
 Return

Setup:
 Procedure Expose sysfuncs.
 sysfuncs.1 = 'SysFileTree'
 sysfuncs.2 = 'SysDriveMap'
 sysfuncs.3 = 'SysDriveInfo'
 sysfuncs.0 = 3
 Do i = 1 To sysfuncs.0
    If RxFuncQuery(sysfuncs.i) Then
       Call RxFuncAdd sysfuncs.i, 'RexxUtil', sysfuncs.i
    Else
       sysfuncs.i = ''
 End
 Return

--------------5F2BCBE64B94FA43403F00A3--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: aboritz@cybernex.net                              06-Sep-99 08:43:07
  To: All                                               06-Sep-99 16:46:13
Subj: Re: Important News From Dan Porter of Innoval

From: aboritz@cybernex.net (Alan Boritz)

In article <LoEFmgJJ9ecw-pn2-7suB9UNyBqut@agave.bitranch.com>,
esther@bitranch.com (Esther Schindler) wrote:
>Buddy, you might like it if Innoval posted the source. But your
>quibble doesn't take into account that the company may have very good
>reasons to *not* do so?

Buddy knows the value of intellectual property, even if he didn't happen to
write about it in that particular piece.

>Don't look gift horses in the mouth.

A foolish suggestion, but I'll assume you have more experience with horses.
<g>

>They could have said, "Screw you,
>we're cancelling all product support."

Innoval already DID that, only they just didn't bother telling anyone.  Their
email and web site have been inactive for tech support for months.  Every
customer who bought an Innoval product within the past couple of years,
thinking that it was a contemporary, supported product, was cheated.

>Instead, they gave the OS/2 community a gift.

It's not much of a gift.  It's broken software, only now we're not paying to
subsidize the buglist, and we KNOW that there's no one to call to get it
fixed.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Dyslexics UNTIE (1:109/42)

+----------------------------------------------------------------------------+

From: whonea@codenet.net                                06-Sep-99 11:39:15
  To: All                                               06-Sep-99 16:46:13
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: whonea@codenet.net (Will Honea)

On Mon, 6 Sep 1999 01:07:28, dboultr@spamfree.erols.com wrote:

> On Sun, 5 Sep 1999 21:39:59, whonea@codenet.net (Will Honea) wrote:
> 
> > Just reset the directory attributes to clear the archive bit and the 
> > problem goes away for a bit.  I just inserted a small command file to 
> > do this after every mail check.  PITA, but it works.
> 
> Absolutely correct.  Removing the A archive bit makes the folder 
> reappear.  I really wish they would have fixed this before they gave 
> away the program, however.  I'm trying other alternatives for mail 
> readers, but so far nothing appears to work any better for me than 
> PRM.

If I ever get time - and annoyed enough - I'll see if I can hack the 
executable to make the directory fetch call with the appropriate 
attributes.  Since it's a constant argument being passed it should be 
doable.  Just takes time to feret out the call in the code.

Will Honea <whonea@codenet.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  06-Sep-99 13:38:27
  To: All                                               06-Sep-99 16:46:13
Subj: Re: MR/2 ICE

From: mchasson@ibm.net

In
<sXnyXDNIUu65-pn2-dQTd9hhpYkDU@207-172-44-48.s48.tnt3.brd.va.dialup.rcn.com>,
on 09/06/99 at 01:43 AM,
   dboultr@spamfree.erols.com said:

>As a refugee from PostRoadMailer, I've been trying out MR/s ICE which 
>has been highly touted here over the years.  I know Nick has been a  real
>supporter of OS/2 and very responsive to users of his program.   Still,
>I'm finding that the version that I downloaded to try out  (1.62) feels
>very much like an early beta.  I'm sure I'm missing  something here.  Can
>anyone help?

>1) Most of the help seems to have not yet been written.  Is this 
>correct?  I saw reference under help to a manual online, but it seems  to
>download a file called manual.exe to my hard drive.  That program  will
>not run under OS/2 or DOS.  What am I missing here?  

>2) I need the conversion utility for address books from PRM.  The link on
>Nick's web site  says file not found.  Any ideas where I might get  it?

>3)  Is there any way to change the appearance of the Inbox page?   There
>doesn't seem to be the ability to resize the columns.  Unless I  use tiny

BIG DEAL

>font sizes, I can't see more than a word or two in each  column.  ProNews
>handles this extremely well, and MR/2 doesn't seem to handle it at all.

>4)  Are taglines only possible with an add-in?

>I really want to like this program.  I'm hoping that my feeling that 
>it's a step back from ProNews is due to my unfamiliarity with it.

Mostly this seems to be a matter of taste and appearance rather than
functionality.

You really have a lot of balls to scream about looking like a Beta when it
works great and is one of the few pieces of shareware that is still being
actively supported by the author.  Give us a break.  If you cant run a
simple program without a help file get onto Linux.


>Doug Boulter

>To reply by e-mail, remove the obvious spam traps from the address

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    06-Sep-99 17:58:19
  To: All                                               06-Sep-99 16:46:13
Subj: Re: Microsoft Word 5.5b Download

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

	Some people may experience a black screen trap pointing towards 
POINTER$$ or something like that.  It is the POINTDD.SYS file that is 
where Microsoft Word 5.5b goes nuts with.  At the time I was using the 
DDPAK01's POINTDD.SYS, so I backleveled that to the default Warp 3 one 
(10-03-94).  Works fine with the DDPAK01'd MOUSE.SYS and what not.  I 
don't see any difference.
	This seems to be agreeable with Word 5.5b.  No trap's...yet.  
After playing around with this, it isn't a wonder that Word 5.5 could not 
beat WordPerfect 5.1 during its day.  It's not bad, but it does lack some of 
the features that WP5.1 had.  No endnote capability (does do footnotes, 
though).  The one that I really could not understand was the lack of a 
zoom capability during print preview.  Ick.  One thing that I did like 
was the graphical display, but the thing is, you can not use the mouse 
which sort of made the thing pointless.  One thing that I will give 
credit for, which seems to reflect the majority of Microsoft programs is 
that they made Word 5.5b, simple.  So I can see why Word 5.x users refuse 
to move onto the newer versions of Word.  This must have been the main 
reason why Microsoft let Word 5.5b go as a freebie for the existing Word 
5.0 users.
	No sign of a free Excel version for DOS users.  I guess during 
that time, Lotus 1-2-3 pretty much had the market lock stock and barrel.  
Probably no demand for Excel for DOS.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               06-Sep-99 20:37:01
  To: All                                               06-Sep-99 16:46:14
Subj: Re: Netscape and Win16 Plug-ins???

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

James Himmelman schrieb:
> 
> I have not been able to get ANY Win16 Plug-in to show up in Help-About
> Plugins in any version of Netscape since v4.04. There is no indication
> of Win16 Plug-in support whatsoever on my version. Un-installing and
> re-installing has not helped. What am I missing?

Let me guess... you have installed Communicator in a directory that's
not in the root, i.e. g:\Net_things\NETSCAPE etc. Accessing the plug-ins
only works if Communicator IS installed in a directory like g:\Netscape
or g:\Comm404.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               06-Sep-99 20:21:03
  To: All                                               06-Sep-99 16:46:14
Subj: Re: Innoval Web Watch Willy setup problem

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

postmaster@[127.0.0.1] schrieb:

> This is fine, except I am unable to initiate the program at all because
> their server is down.  Over a year ago I tried this program also and I was
> unable to initialize it because I could not get through to their server.
> 
> Any ideas on setting it up?

I am having the same problem. Recently I I got the tip to enter nothing
into the entry fields for the browsers and skip that part of the setup.
The rest should work fine, you only won't get a list of sites to block
then.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: dagroe-nospam@messagehost.net                     06-Sep-99 19:43:12
  To: All                                               06-Sep-99 19:51:14
Subj: Re: AOL Instant Messenger for OS/2 ????

From: dagroe-nospam@messagehost.net (Dean Groe)

On Fri, 3 Sep 1999 04:33:57, raphaelt@netnews.worldnet.att.net 
(Raphael Tennenbaum) wrote:

> 
> One thing: you need to be sure the cmd file you use to start
> AIM-Java is in the same subdirectory as AIM.jar and all the
> other things that unzip out of aim_generic.zip in the
> distribution (i.e., in the /AIM subdirectory).  Once I fixed
> this, it worked fine with 1.1.7.
>  
OK, I am using the icon object "optional properties" field to pass the
parameters. The working directory is set to the AIM directory. 

IOW, the "path and file name" is c:\java11\bin\java.exe, and the 
-classpath (paths) and main.Oscar statements are in the "optional 
properties" field.  I will try creating a CMD instead and see what 
happens.

Thanks

Dean

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: raphaelt@netnews.worldnet.att.net                 06-Sep-99 15:34:08
  To: All                                               07-Sep-99 03:24:05
Subj: Re: Microsoft Word 5.5b Download

From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum)

jdc0014@InfoNET.st-johns.nf.ca (John Hong) wrote:

>das schnip>
>

>One thing that I will give 
>credit for, which seems to reflect the majority of Microsoft programs is 
>that they made Word 5.5b, simple.  So I can see why Word 5.x users refuse 
>to move onto the newer versions of Word.  This must have been the main 
>reason why Microsoft let Word 5.5b go as a freebie for the existing Word 
>5.0 users.

Nah, I think they've finally had a change of heart and are
reaching out to OS/2 users.

Heh heh

>	No sign of a free Excel version for DOS users.  I guess during 
>that time, Lotus 1-2-3 pretty much had the market lock stock and barrel.  
>Probably no demand for Excel for DOS.

Yeah, I poked around looking for that as well -- that would
be a real prize.  (Is it just me, or are MS pages the
slowest to load on the whole web, not to mention poorly
organized?  Well, except maybe for Lotus.)

-- 
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: maxikins@os2bbs.com                               06-Sep-99 19:46:12
  To: All                                               07-Sep-99 05:46:02
Subj: Re: Netscape and Win16 Plug-ins???

From: maxikins@os2bbs.com (Mark Klebanoff)

On Mon, 6 Sep 1999 18:37:02, Christian Hennecke 
<christian.hennecke@ruhr-uni-bochum.de> wrote:


> Let me guess... you have installed Communicator in a directory that's
> not in the root, i.e. g:\Net_things\NETSCAPE etc. Accessing the plug-ins
> only works if Communicator IS installed in a directory like g:\Netscape
> or g:\Comm404.
> 
> Christian Hennecke

I have 4.04 installed in g:\netscap4\program  and it works fine.  I 
have the np??16.dll files in \netsc4\program\win16\plugins

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: dpeterso@halcyon.com                              06-Sep-99 13:12:00
  To: All                                               07-Sep-99 05:46:02
Subj: Re: check out  File Commander/2

From: Dennis Peterson <dpeterso@halcyon.com>

This is the most-used application I have ever purchased. I would guess
that nearly 90% of all non-email text I've created over the last several
years and virtually all html I've created was done with this tool. It is
also my most used tool when I'm stuck using Windows, too. The recursive
zip viewer, editor, file viewer, file finder, hot-key change dir, and
some much more have assured this will always be on my system. Do I
recommend it? Hell, yes! I would even consider using it on my Unix
systsems if there were such a thing.

dp

"C.J." wrote:
> 
>  File Commander/2
> ************************
> 
> File Manager
> 
> File Commander is a 32 bit text mode file manager and shell that allows you
> to locate, copy, move, delete, view, edit and execute your files in a quick,
> convenient and customizable manner.
> 
> Versions for windows 95/98/NT and OS2 are available.
> 
> Check it out and download File Commander/2 for a free trial period from:
>         http://www.btsoftware.com/os2/filecmdr.htm

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: I'm not organized at all (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  06-Sep-99 14:25:01
  To: All                                               07-Sep-99 05:46:02
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: Chuck McKinnis <mckinnis@ibm.net>

Will, the problem is not just with Post Road Mailer.  Visit
http://www.os2ss.com/users/mckinnis for my discussion of the issues.

Will Honea wrote:
> 
> On Mon, 6 Sep 1999 01:07:28, dboultr@spamfree.erols.com wrote:
> 
> > On Sun, 5 Sep 1999 21:39:59, whonea@codenet.net (Will Honea) wrote:
> >
> > > Just reset the directory attributes to clear the archive bit and the
> > > problem goes away for a bit.  I just inserted a small command file to
> > > do this after every mail check.  PITA, but it works.
> >
> > Absolutely correct.  Removing the A archive bit makes the folder
> > reappear.  I really wish they would have fixed this before they gave
> > away the program, however.  I'm trying other alternatives for mail
> > readers, but so far nothing appears to work any better for me than
> > PRM.
> 
> If I ever get time - and annoyed enough - I'll see if I can hack the
> executable to make the directory fetch call with the appropriate
> attributes.  Since it's a constant argument being passed it should be
> doable.  Just takes time to feret out the call in the code.
> 
> Will Honea <whonea@codenet.net>

-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: ecmille@ibm.net                                   06-Sep-99 20:39:11
  To: All                                               07-Sep-99 05:46:02
Subj: Re: Netscape and Win16 Plug-ins???

From: ecmille@ibm.net (Ted Miller)

In message <uprsNDlpp0Dh-pn2-OHo4JF7ykT1P@f01-207-41-174-43.i-2000.net> -
jhimmel@i-2000.com (James Himmelman)Mon, 06 Sep 1999 16:13:46 GMT writes:
:>
:>I have not been able to get ANY Win16 Plug-in to show up in Help-About
:>Plugins in any version of Netscape since v4.04. There is no indication
:>of Win16 Plug-in support whatsoever on my version. Un-installing and 
:>re-installing has not helped. What am I missing?
:>
:>[[[ James Himmelman - jhimmel@i-2000.com ]]]



Hello James

I am currently using Netscape 4.61 and at first I couldn't get Netscape to
recognize my Win16 plugins either(Shockwave and Realplayer). Before I go any
further here are readouts of my relevant plugin directoties:

Directory of E:\NETSCAPE\PROGRAM\WIN16\PLUGINS

10-29-98   8:23p     <DIR>           0  .
10-29-98   8:23p     <DIR>           0  ..
 8-16-99   7:24p     <DIR>           0  np16dsw
10-29-97   4:54a      5728           0  NP16DSW.DLL
11-22-97   8:48p     22720           0  NPRA16.DLL
 4-21-98  12:49p    204944           0  Npswf16.dll
10-02-97   7:25p      5673           0  SWReadMe.htm
        7 file(s)     239065 bytes used
                   828356096 bytes free

and:

Directory of E:\NETSCAPE\PROGRAM\PLUGINS

 8-30-99   7:41p     <DIR>           0  .
 8-30-99   7:41p     <DIR>           0  ..
 8-10-99   5:34p      3158          61  DUMYPLUG.DLL
 8-21-99   6:08p      3158          61  NP16DSW.DLL
 1-14-98   4:49p     51333           0  npbamba.dll
10-20-98   5:36p     82629           0  NPFI.DLL
 8-09-99   4:25p    197728           0  NPNULOS2.DLL
 8-10-99   5:33p      2116           0  NPOS2AUD.DLL
 8-10-99   5:33p      2116           0  NPOS2MID.DLL
 8-10-99   5:33p      2116           0  NPOS2VID.DLL
 5-16-97   1:09a    106711           0  nppdfos2.dll
 8-10-99   5:33p     83048           0  NPPROXY.DLL
 8-21-99   6:08p      3158          61  NPRA16.DLL
 8-21-99   6:08p      3158          61  Npswf16.dll
 8-10-99   5:34p     93752          61  XLATE.DLL
       15 file(s)     634181 bytes used
                   828355584 bytes free

Notice the different sizes of np16dsw.dll,npra16.dll, and npswf16.dll in the
two directories. When Netscape wasn't recognizing the plugins, the relevant
files in e:\netscape\program\plugins were exactly the same as in 
E:\NETSCAPE\PROGRAM\WIN16\PLUGINS. I then deleted the three files in
e:\netscape\program\plugins and presto the plugins were recognized and
Netscape recreated the files each 3158 bytes long.

I hope what worked for me can be of some help to you.

Ted Miller
ecmille@ibm.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: rjlockie@home.com                                 06-Sep-99 22:35:18
  To: All                                               07-Sep-99 05:46:03
Subj: Re: QuickCam VC USB

From: rjlockie@home.com (Bob Lockie)

In message <VKgw72RDdCmL-pn2-f4LwuF0b9dn1@dmb24.tvol.it> - never@tvol.it
(Zamp)5 Sep 1999 09:44:02 GMT writes:
:>
:>Hi
:>
:>Did you know any app. support for subj ?
:>
:>Conoscete se qualche applicazione supporta la Quickcam USB ?

There is no USB version of the driver.

OS/2 and WinNT support the parallel version only.

http://www.shadow.net/~senja/qv2indx.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            06-Sep-99 22:42:13
  To: All                                               07-Sep-99 05:46:03
Subj: Re: Important News From Dan Porter of Innoval

From: mike.luther@ziplog.com

In <zRQeOedqx8Di-pn2-gdeEn62jU2ti@localhost>, coville@localnet.com (Brian)
writes:
>Now if there was only a way to still purchase the spellguard for PRM 
>product.  That was only offered by Innoval, I checked w/ the author of
>spellguard.
>
>	Brian

Yes .. I paid for it and never got it.  I want it now, but have, as yet,
not been able to find even the downloadable module for which I have the
paid-for key ... :(


--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               07-Sep-99 01:23:26
  To: All                                               07-Sep-99 05:46:03
Subj: Re: Netscape and Win16 Plug-ins???

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Mark Klebanoff schrieb:

> I have 4.04 installed in g:\netscap4\program  and it works fine.  I
> have the np??16.dll files in \netsc4\program\win16\plugins

So your installation conforms to the way I described earlier. The
NETSCAPE directory that contains all other Communicator files and
directories is in root.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: cfrank@rumms.uni-mannheim.de                      06-Sep-99 23:27:03
  To: All                                               07-Sep-99 05:46:03
Subj: Copying CD with audio and data tracks with cdrecord

From: cfrank@rumms.uni-mannheim.de (Carsten Frank)

I would like to copy a cd whis has audio and data tracks on it. How 
can i copy such a cd with cdrecord?

Thanks

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        06-Sep-99 23:38:07
  To: All                                               07-Sep-99 05:46:03
Subj: Re: MR/2 ICE

From: dboultr@spamfree.erols.com

On Mon, 6 Sep 1999 01:43:18, dboultr@spamfree.erols.com wrote:

> 2) I need the conversion utility for address books from PRM.  The link
> on Nick's web site  says file not found.  Any ideas where I might get 
> it?

I'll answer my own question on this one.   On Nick's page 

http://nick.secant.com/mr2ice.htm

the link under "Utility List" to PRMtoMR2.zip is indeed broken, tho I 
can't say why when looking at the html code.  However, if you go to 
the page

http://cartman.secant.com/nick/

you'll have a list of the available files, from which PRMtoMR2.zip can
be downloaded.

Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        06-Sep-99 23:43:07
  To: All                                               07-Sep-99 05:46:03
Subj: Re: MR/2 ICE

From: dboultr@spamfree.erols.com

On Mon, 6 Sep 1999 17:38:54, mchasson@ibm.net wrote:

> You really have a lot of balls to scream about looking like a Beta when it
> works great and is one of the few pieces of shareware that is still being
> actively supported by the author.  Give us a break.  If you cant run a
> simple program without a help file get onto Linux.

I'm sure Nick will be extremely grateful for your assistance in 
helping convince me to send him my $30.  With friends like you, he 
certainly needs no enemies. 

Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jhimmel@i-2000.com                                07-Sep-99 00:10:22
  To: All                                               07-Sep-99 05:46:03
Subj: Re: Netscape and Win16 Plug-ins???

From: jhimmel@i-2000.com (James Himmelman)

On Mon, 6 Sep 1999 18:37:02, Christian Hennecke 
<christian.hennecke@ruhr-uni-bochum.de> wrote:

> James Himmelman schrieb:
> > 
> > I have not been able to get ANY Win16 Plug-in to show up in Help-About
> > Plugins in any version of Netscape since v4.04. There is no indication
> > of Win16 Plug-in support whatsoever on my version. Un-installing and
> > re-installing has not helped. What am I missing?
> 
> Let me guess... you have installed Communicator in a directory that's
> not in the root, i.e. g:\Net_things\NETSCAPE etc. Accessing the plug-ins
> only works if Communicator IS installed in a directory like g:\Netscape
> or g:\Comm404.
> 
> Christian Hennecke
> -- 
> Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

No, it is in F:\NETSCAPE\...

[[[ James Himmelman - jhimmel@i-2000.com ]]]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jvarela@mind-spring.com                           07-Sep-99 00:04:10
  To: All                                               07-Sep-99 05:46:03
Subj: Re: StarOffice 5.1 - Statistics

From: jvarela@mind-spring.com (John Varela)

On Mon, 6 Sep 1999 16:22:03, John M Price PhD <jmprice@calweb.com> 
wrote:

> In comp.os.os2.apps article <37D37706.A26FF7E8@efnet.irc> Simon
<miji2@efnet.irc> wrote:

> : install of that part of SO ? My 5.1 install shows about 80 statistical
> : functions available. That's under Insert -> Function List
> 
> Yes, a poster pointed me there in email.  Pretty clumsy, but I can get
> used to it.  In other spreadsheets it's in Tools or Data or ....

In Excel 5.1 it's under Insert/Function.  I know nothing about current
versions of Excel, but I imagine it's Excel's menu structure that's 
being imitated.

--
John Varela
to e-mail, remove - between mind and spring

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: jsjones.@ibm.net                                  07-Sep-99 00:32:12
  To: All                                               07-Sep-99 05:46:03
Subj: Re: AOL Instant Messenger for OS/2 ????

From: jsjones.@ibm.net

There's an easier way:

Create a URL object for the page that starts the AIM Java applet. 
Open the Java folder (most likely in Programs folder).
Drag the AIM object and drop it on the Java Applet Viewer from URL object
(icon).

AIM should start up nicely in its own window.

You can do this with any web page that launches a single applet 
(and doesn't requre a password, etc, to launch.) Applets tend to be much
better 
behaved when running outside a browser. The browser is much more stable, as
well.

In <nPjQEKcYsLZr-pn2-8Kd1Z554dv1y@DAGROE_OS2WS01>,
dagroe-nospam@messagehost.net (Dean Groe) writes:
>On Fri, 3 Sep 1999 04:33:57, raphaelt@netnews.worldnet.att.net 
>(Raphael Tennenbaum) wrote:
>
>> 
>> One thing: you need to be sure the cmd file you use to start
>> AIM-Java is in the same subdirectory as AIM.jar and all the
>> other things that unzip out of aim_generic.zip in the
>> distribution (i.e., in the /AIM subdirectory).  Once I fixed
>> this, it worked fine with 1.1.7.
>>  
>OK, I am using the icon object "optional properties" field to pass the
>parameters. The working directory is set to the AIM directory. 
>
>IOW, the "path and file name" is c:\java11\bin\java.exe, and the 
>-classpath (paths) and main.Oscar statements are in the "optional 
>properties" field.  I will try creating a CMD instead and see what 
>happens.
>
>Thanks
>
>Dean
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: maxikins@os2bbs.com                               06-Sep-99 23:55:05
  To: All                                               07-Sep-99 10:47:25
Subj: Re: Netscape and Win16 Plug-ins???

From: maxikins@os2bbs.com (Mark Klebanoff)

On Mon, 6 Sep 1999 23:23:52, Christian Hennecke 
<christian.hennecke@ruhr-uni-bochum.de> wrote:

> Mark Klebanoff schrieb:
> 
> > I have 4.04 installed in g:\netscap4\program  and it works fine.  I
> > have the np??16.dll files in \netsc4\program\win16\plugins
> 
> So your installation conforms to the way I described earlier. The
> NETSCAPE directory that contains all other Communicator files and
> directories is in root.
> 
> Christian Hennecke
> -- 
OK, I guess I misunderstood

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: postmaster@[127.0.0.1]                            06-Sep-99 20:34:14
  To: All                                               07-Sep-99 10:47:25
Subj: Re: MR/2 ICE

From: postmaster@[127.0.0.1]

In
<sXnyXDNIUu65-pn2-j0RuWoT9qlLO@207-172-54-42.s42.tnt16.brd.va.dialup.rcn.com>,
on 09/06/99 
   at 11:43 PM, dboultr@spamfree.erols.com said:

>I'm sure Nick will be extremely grateful for your assistance in  helping
>convince me to send him my $30.  With friends like you, he  certainly
>needs no enemies. 

Let me just say that ICE is excellent.  Best shareware I ever bought.

Really.

--
GK
            
FrodoJRR at Interaccess dot com
OS/2 Version 4.00 FixPack 11 
There are 28 Processes with 110 Threads.
This machine's uptime is 0d 6h 23m 1s 406ms.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          07-Sep-99 01:48:27
  To: All                                               07-Sep-99 10:47:25
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 6 Sep 1999 23:43:14, dboultr@spamfree.erols.com a crit dans un 
message:

> On Mon, 6 Sep 1999 17:38:54, mchasson@ibm.net wrote:
> 
> > You really have a lot of balls to scream about looking like a Beta when it
> > works great and is one of the few pieces of shareware that is still being
> > actively supported by the author.  Give us a break.  If you cant run a
> > simple program without a help file get onto Linux.
> 
> I'm sure Nick will be extremely grateful for your assistance in 
> helping convince me to send him my $30.  With friends like you, he 
> certainly needs no enemies. 

Heh. Must be a new concept in Shareware. The 
Share-or-Die-Die-Die-you-scumbucket-bastard-Ware concept. 

Marketing attitude enhanced by Idi Amin?  Or Micro$oft. Or the Internal 
Revenue Service.


I missed the beginning of this but if somebody else is complaining about 
the appearance of folder indexes in MR2Ice I'll chime in. Having 
information lines running off past vertical divider lines that aren't 
draggable or scrollable is pretty bush league, to my eye. You have to drag 
WarpSans to the page to see as many characters as you can, but that makes 
it pretty difficult to read overall.


But I think the answer is, it's too complicated for Nick to bother fixing 
it at this late date?



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: raphaelt@netnews.worldnet.att.net                 06-Sep-99 20:12:25
  To: All                                               07-Sep-99 15:25:23
Subj: Re: AOL Instant Messenger for OS/2 ????

From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum)

dagroe-nospam@messagehost.net (Dean Groe) wrote:

>On Fri, 3 Sep 1999 04:33:57, raphaelt@netnews.worldnet.att.net 
>(Raphael Tennenbaum) wrote:
>
>> 
>> One thing: you need to be sure the cmd file you use to start
>> AIM-Java is in the same subdirectory as AIM.jar and all the
>> other things that unzip out of aim_generic.zip in the
>> distribution (i.e., in the /AIM subdirectory).  Once I fixed
>> this, it worked fine with 1.1.7.
>>  
>OK, I am using the icon object "optional properties" field to pass the
>parameters. The working directory is set to the AIM directory. 
>
>IOW, the "path and file name" is c:\java11\bin\java.exe, and the 
>-classpath (paths) and main.Oscar statements are in the "optional 
>properties" field.  I will try creating a CMD instead and see what 
>happens.
>
>Thanks
>
>Dean
>

You've probably already gotten this far, but here's what my
aim.cmd looks like:

set java_compiler=JAVAX
set CLASSPATH=AIM.jar;M:\Java11\lib\classes.zip;%CLASSPATH%
java.exe main.Oscar
exit

Again, it *has* to be in the subdirectory \aimjava\aim.

I hardly ever use OS/2 object-settings for Java progs, cause
the paths are so touchy, and it's just easier to edit a
plain-text cmd file and run it till it works ok.

Send an IM to "achurl" if you get it working!




-- 
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          07-Sep-99 02:06:07
  To: All                                               07-Sep-99 15:25:23
Subj: Re: Question about quality of pdf-files from ghostscript

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 6 Sep 1999 12:20:05, "Jan Hartman" <jan.hartman@fil.lu.se> a crit 
dans un message:

> In the process of sending a manuscript for a book to a publisher,
> I was told that they wanted a pdf-file, not a postscript file as I
> earlier was led to believe. However, even though I can create a postscript
> file which is 1200x1200 dpi, I can only get ghostview/script to make a
> pdf-file which is 300x300 dpi. This is not good enough. Any ideas
> about how to make a highquality pdf-file?

This is quite strange, and you should find out how they plan to use the PDF
file. 

1200x1200dpi is beyond "high" quality at your stage of the publishing 
process, and I would think they want to be able to send it directly to a 
filmsetter if they're calling for that spec.

But that's not the way publishers normally work, because they like to edit 
and add their own stuff first, as well as adjust layout, composition, 
typography, etc., and it's not that easy making such changes to PDF files 
themselves.

If you determine that they still want to be able to do editing, I'd offer 
them a PS file, which you can make with any Postscript printer driver 
printing to file. Or one of the other WP formats, which are much more 
editable.


But, the short answer is No. Right now GSView is limited to 300x300 for the
pdf printer driver. DeScribe printing to PS imported to GSView and printing
to PDF makes some very nice files, and they are completely readable no 
matter what they are printed on later. You could always scan printed pages 
at 1200dpi into a multipage format and convert *those* to PDF via GSView, I
guess.



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              06-Sep-99 19:41:19
  To: All                                               07-Sep-99 15:25:23
Subj: Re: Swap file

From: "J. R. Fox" <jr_fox@earthlink.net>

Ray Appleby wrote:
> 
>With 256Mb of RAM, your system would rarely need to increase >the size of
your swap file beyond the initial 2Mb because it >is able to use availble RAM
instead of having to swap pieces >of memory to disk.  Leave it at 2Mb - if the 
system needs to, >it will expand the swap file all by itself without any user
>intervention.

Sounds good to me . . .  and I guess that's why the results
have been as noted.  Thanx.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               07-Sep-99 02:51:29
  To: All                                               07-Sep-99 15:25:23
Subj: Re: MR/2 ICE

From: esther@bitranch.com (Esther Schindler)

On Mon, 6 Sep 1999 23:43:14, dboultr@spamfree.erols.com wrote:
| I'm sure Nick will be extremely grateful for your assistance in 
| helping convince me to send him my $30.  With friends like you, he 
| certainly needs no enemies. 

Fortunately, Doug, most MR/2 ICE users are much more civil. <smile>

I haven't chimed in to answer your questions because... well, I've 
been using MR/2 ICE for so long that I've forgotten how to solve the 
problems.

It's not perfect; there are features that I'd like to see. But I'm 
comfortable with MR/2 ICE,  the way I snuggle into a comfy sweater. I 
like it, even though the feature charts for other products might have 
a lot more check-marks.

I'm sure that someone will help you figure out the problems. But I 
assure you that they're solveable.

--Esther


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              06-Sep-99 19:55:15
  To: All                                               07-Sep-99 15:25:23
Subj: Re: Alternate CONFIGs 

From: "J. R. Fox" <jr_fox@earthlink.net>

{from my earlier reply}:

>>I think there's an ALT-F1 (?) facility for using other 
>>versions of CONFIG.SYS, but I just rename 'em and shuttle
>>them around.  There are times when I may want to boot up >>without certain
other components, too.

> This is very simple to do. And very useful, in my opinion.
> 
> 1. Place your alternate CONFIG.SYS in \OS2\BOOT and rename >it, we'll say,
to CONFIG.B (for Buddy?).
> 
> 2. On any reboot, you can Alt-F1 to the choices screen and then hit the key
B, and you'll now be booting with 
>\OS2\BOOT\CONFIG.B instead of .\CONFIG.SYS, for just this one >time. 

Thanks for systematizing this.  I'll print it out and put it 
into practice.
 
>I've got 4 alternates: one that loads nearly zero drivers (Z); >one that
loads CMD.EXE as the COMSPEC (T) instead of 4OS2.EXE >or vice versa 

Took a different tack with that, making 4OS2 its own separate
session and Tray Object.  I like having choices, preferably
with all options available at the same time.
 
>By the way, there's another very nifty utility (freeware now) >called BOOTSET 
that works a little differently, being called >at the completion of your
normal CONFIG.SYS, but it can >accomplish the same thing 

Good to know.

Best,

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@nowhere.com                                07-Sep-99 03:10:17
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Microsoft Word 5.5b Download

From: nospam@nowhere.com

I do not believe there was ever an Excel for DOS.  The M$ DOS spreadsheet
was Multiplan -- a very excellent product -- but it had no graphics
support.  The compute engine in Excel was basically the old Multiplan
engine.  The graphics support in the DOS environment was from another
product, though I forget its name.  The two together would be an Excel.

I have what I believe is the last M$ Multiplan for DOS: 4.2.  Sadly, it has
very serious Y2K problems, which has finally forced me to look for an
alternate.  At this point, I do not regard StarOffice as a viable
alternate.

In <5cB13oXf0P/C092yn@netnews.worldnet.att.net>,
raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum) writes:
>jdc0014@InfoNET.st-johns.nf.ca (John Hong) wrote:
[snip]
>>	No sign of a free Excel version for DOS users.  I guess during 
>>that time, Lotus 1-2-3 pretty much had the market lock stock and barrel.  
>>Probably no demand for Excel for DOS.
>
>Yeah, I poked around looking for that as well -- that would
>be a real prize.  (Is it just me, or are MS pages the
>slowest to load on the whole web, not to mention poorly
>organized?  Well, except maybe for Lotus.)
>
>-- 
>Ray Tennenbaum        '99 YZF-R6
>readme@ http://www.ray-field.com

-- Steve Myers

The E-mail addresses in this message are private property.  Any use of them
to  send  unsolicited  E-mail  messages  of  a  commerical  nature  will be
considered trespassing,  and the originator of the message will be  sued in
small claims court in Camden County,  New Jersey,  for the  maximum penalty
allowed by law.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              06-Sep-99 20:14:03
  To: All                                               07-Sep-99 15:25:24
Subj: Re: How to ...

From: "J. R. Fox" <jr_fox@earthlink.net>

Martin Racette wrote:
> 
> On Thu, 2 Sep 1999 17:52:09,
> jdc0014@InfoNET.st-johns.nf.ca (John
> Hong) wrote:
> 
> > Martin Racette (racette@cablevision.qc.ca) wrote:
> >
> > : I would like to know How to copy the
> > : content of an Audio cassette (music), to
> > : a CD-R while using RSJ
> >
> >       I don't think there is a way to do that directly onto a CDR
> > program.  Basically it would be a two-step process, get Digital Audio in
> > your Multimedia directory to store the song in .WAV file format first.
> > I've yet to try this, but you should be able to play the song on your
> > stereo and have it hooked up to your soundcard in the in-line plug and to
> > record with Digital Audio with the source being in-line.
> >
> >
> 
> So basicly I hvae to do it on a song per
> song ! :-/
> 
> //-------------------------

I don't really know what I'm talking about here, but you may
want to check out a shareware OS/2 program called TWAVE.  There
are a couple users on Compuserve who I think are using this to
put tracks from LPs and reel-to-reel tapes into digital form -- 
probably .WAV files on the h/d, which could then be converted
into MP3 format, or whatever.  I suspect that TWAVE works with
CDs too.  Of course, you'd then have to go from your h/d to a
new cd using RSJ.  I doubt you'll find a one-step solution.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    07-Sep-99 03:16:16
  To: All                                               07-Sep-99 15:25:24
Subj: (1/2) Backup & Defragmentation 3.1 (Sept. 7, 1999)

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

                  Backup & Defragmentation 3.1

     This is just a little primer drawn up in order to help OS/2
users to use common compression utilities such as PkZip for
backing up their OS/2 drives.
     Another use for this is also to fight against fragmentation.
OS/2's HPFS file system does not fragment like the way FAT drives
do, but it does become susceptible to it when the drive is almost
full.  So, the best remedy is to backup the data, format the
partition, then unarchive the backup back to the original
partition and you are back in business.
     Prior to doing this, be sure to create boot disks in order
to compress/uncompress the backup files.  You can use either the
Create Utility Diskettes option in OS/2's System Folder or (a
better option) use BootOS/2 in order to make them.  BootOS/2 in
particular is more advantageous since it would only need two 3.5"
1.44 MB diskettes over the three needed by OS/2 Warp 3 & Connect
and the four for OS/2 Warp 4.  Plus, one can also use LxLite
compression with BootOS/2 in order to save that little extra bit
of disk space necessary.  As well, you can probably use it for an
LS-120 or ZIP disk whereas the Utility Diskettes option would not
support it.  BootOS/2 can be found at the Hobbes OS/2 Archive
(http://hobbes.nmsu.edu).  LxLite can be found at LEO
(http://www.leo.org).
     EXTRA: It is a good idea to make your backups booting
through your bootdisks since there maybe locked files that won't
be compressed.  Locked files are files that are currently in use
by OS/2 and will not allow any kind of manipulation from the user
to take place.
     EXTRA EXTRA: Before making a backup, it maybe a good idea to
run CHKDSK from the bootable floppies first.  Another thing, make
sure you run CHKDSK (CHKDSK X: /F:2) twice in a row.  I picked up
this little tidbit from the "OS/2 Warp Unleashed" book by SAMS
Publishing (fine book, BTW).  It is found in Chapter 18, dealing
with troubleshooting on page 941:

     "Note that if you running HPFS, then you should
     periodically run CHKDSK C: /F:2 twice.  The first pass
     checks and cleans the primary HPFS structures, and the
     second pass checks and clears the secondary HPFS
     structures."

     BTW: When I say it was tested personally under an OS/2
system, it means that I had tested it under a bootable OS/2
partition and not just a partition with data on it.

     Updates:

     * Warp for e-Business
     * Windows 95 - FAT32

     To Do List:

     * Testing ARJ/2 2.6x once it gets out of beta
     


      *NEW*UPDATE* Warp for e-Business *UPDATE*NEW*

     Okay, now that you've seent this, I have read of a user
on Usenet trying to use RAR/2 2.50 in order to backup their
Warp for e-Business partition.  It didn't work, apparently
the EA's were trashed.  Possibly this may have something to
do with the new LVM and JFS.  I don't know since I do not have
Warp for e-Business, and thus have no way of verifying.  So at
this point in time it is best not to try using any of these
methods for backing up Warp for e-Business.


-----------------------------------------------------------------
Overall
-----------------------------------------------------------------
Compression    | Disk Spanning | Requires PM |  Recovery | EA's |
-----------------------------------------------------------------
PkZip/2 2.50   |      Yes      |     Yes     |    Yes    |  Yes |
Info-Zip 2.22  |       No      |      No     |    Yes    |  Yes |
RAR/2 2.50     |      Yes      |      No     |    Yes    |  Yes |
ARJ/2 2.62 Beta|      Yes      |      No     |    Yes    |   No |
-----------------------------------------------------------------
Disk Spanning: Ability to support multiple archives.  Basically
     once the disk or cartridge is full, it can ask the user to
     insert another disk or cartridge in order for it continue. 
     A Yes is good.
Requires PM: Does the compression program require the PM,
     Presentation Manager.  This is OS/2's GUI.  A no is a good
     answer since it would be impossible to boot OS/2 up with
     regular floppies with the PM (unless it was a ZIP/LS-120
     booting with A: drive).
Recovery: Ability to recover/fix a corrupt archive, ie. PkZipFix.
     A yes here is a good answer.  If the file is corrupt you can
     at least salvage something from it.
EA's: Ability to save OS/2's Extended Attributes.  A yes here is
     a must for OS/2.
-----------------------------------------------------------------


Info-Zip for OS/2 (v2.22)
http://www.cdrom.com/pub/infozip/

     Works very well under OS/2.  Use the following switches:

zip -rS$ (destination/name of backup) *

example:

zip -rS$ F:\BACKUP.ZIP *

     Stick unzip.exe onto your OS/2 bootdisks, to restore the
drive simply:

unzip (name of backup)

example:

C: (being where I want it unzipped)
unzip F:\BACKUP.ZIP

     Info-Zip is fine if you are just going to back it up to
another partition or have a removable media drive large enough to
fit it.  Currently, Info-Zip is not able to handle disk spanning.
It is a future feature to be added according to their home
webpage when 3.0 comes out.

Personally tested under a Warp 4 system (no FP's).

-----------------------------------------------------------------

PkZip for OS/2 (v2.50)
http://www.pkware.com

     Another that works well under OS/2.  Perhaps a little better
than Info-Zip since PkZip does handle disk spanning.  Use the
following switch:

pkzip /add /attr=all /dir=full /rec /volume=(drive letter)
     (destination/name of backup) *

example:

pkzip /add /attr=all /dir=full /rec /volume=C F:\BACKUP.ZIP *

     To enable disk spanning, add the /span switch before the
/volume one.
     Take note, use pkzip.exe, do not use pkzip2.cmd or else it
will simply fail and just zip up the volume label in a file
called "all.zip".

     Now to uncompress the archive, simply go:

pkzip /attr=all /dir=full /extract /mask=none /rec /volume=C
     (destination/name of backup)

example:

pkzip /attr=all /dir=full /extract /mask=none /rec /volume=C 
F:\BACKUP.ZIP C:

Personally tested under a Warp 4 system (no FP's).

     Extra Note: Apparently the geniuses at PkWare designed PkZip
for OS/2 needing the Presentation Manager.  So, using the boot
disks from the Create Utility Disks function will not work.  The
only way for BootOS/2 to get this to work is with the TYPE=PM
option.  This of course will require a bootable device large
enough to handle the extra data.  So really you are going to need
a bootable ZIP or LS-120 device in order to get this working. 
With that said, you can use unzip.exe in order to uncompress the
pkzipped files.  But, that has a problem too.  Currently UnZip
5.40 will not be able to unzip multiple archives (like Zip 2.22).
This is slated for the next major release (UnZip 6.00).

-----------------------------------------------------------------

RAR for OS/2 (v2.50)
http://www.rarsoft.com

     Easiest one to use due to its Norton Commander-like
interface.  Go into RAR's configuration (press F9, it is the
first item on the menu) and make sure the following are checked
on:

     X - Always Solid Archiving
     X - Put Recovery Record

     X - Read Only
     X - Hidden
     X - System
     X - Archive

     X - Save extended attributes

     It could also be a good idea to check on multimedia
compression in order to get better compression.  The rest is
merely of choice, especially the compression (six methods to
choose) whether to be for the best compression (slowest) or no
compression at all in simply storing the files (fastest).
     In order to backup your OS/2 drive, simply hit the "+" key
and push enter in order to highlight all the directories (or
select whichever one's you intend to backup).  Push F5 in order
to compress onto a disk/cart and use Autodetect method in order
to ensure spanning across disks/carts (or you can specify exactly
what size you want).  Very easy.

     Take Note: Do not use "UNRAR.EXE" to restore! 
     Otherwise you will get a "Desktop can not be found in
     OS2.INI file, attempting to create Temporary Desktop"
     error message, where the Temperary Desktop will also
     fail, leaving you sitting at the PM with one OS/2
     Window session.

     In order to restore, place RAR.EXE onto the OS/2 bootable
diskettes.  Start RAR.EXE up, now go to wherever you have the
file backed up to, enter it, this will allow you view the files
that are compressed inside the archived file.  Once that is done,
hit the "+" key and press enter in order to highlight all the
files.  Now, press ALT-F4 in order to restore by choosing the
destination.  Simply put in "C:" or wherever your original boot
partition was.  Once all of it extracted, there you go.  I think
we have a winner.

Personally tested under a Warp 4 system (no FP's) and a Warp 3
system (FP40 applied).


-----------------------------------------------------------------

ARJ/2 (v2.62)
http://hobbes.nmsu.edu

     I confess that I have not yet tested ARJ/2, but I wouldn't
recommend using it just yet since it is still in a beta stage,
and does not save EA's.  But you could use EAUTIL in order to do
this for you, but that is a bit of a chore especially since the
other compression utilities here can do this automatically.  So
what would be the point?
     To enable disk spanning for ARJ/2, use:

arj a -vxxxx

     xxxx = denotes the specific size you want it to be

-----------------------------------------------------------------

     Note: I only intend to write about currently supported
     compression utilities.  In otherwords, LHA and ZOO for
     instance I simply will ignore.  Neither one has been
     updated since 1989-1993, and are relatively old and
     obsolete given the others listed here.


Windows 95 - FAT32 (http://www.microsoft.com) - *NEW*

     So, you want to just dump OS/2 forever and head off into
merry merry Windows 95 land?  Well, I have not had the
opportunity to try this using Windows 95 on a VFAT partition,
but under FAT32, there is simply no way you can backup a
Windows 95 partition using stuff like PkZip for Windows or
WinRAR.  The problem is that there are certain locked files
at play.  PkZip for Windows did complete, but now you have the
even bigger problem of trying to restore it from a bootdisk.
Won't happen, I'm afraid.  When I tried this booting off of a
Windows 95 boot disk, running PkZip 2.50's PkUnZip utility, it
would not work because it complained of a lack of memory
(apparently the FAT32 support on the bootdisk takes up a lot
of memory as I'm always stuck with 542k conventional RAM).
The last hope was RAR for DOS, but that too also complained of
a lack of memory.  So, what's the point of using a Windows
compression utility in order to backup the entire Windows 95
partition if there is absolutely *NO* way of restoring it?
     Now, where exactly am I going with all this?  Simple,
thanks to the great FAT32 driver written by Henk Kelder, one
can actually follow the exact methods listed here with the
various compression utilities in order for OS/2 to backup
Windows 95 through OS/2!  Using RAR/2 in the identical manner
listed earlier will allow you to backup a Windows 95 partition.
Once backed up, you can boot up with the Windows 95 bootdisk
and then format the partition, re-boot back into OS/2 and use
RAR/2 in order to restore the Windows 95 partition back to
its previous state.  Now when you look at the disk with Norton
Speedisk or booting Windows 95 up with a bootdisk in order to
use ScanDisk (to see the entire disk information) you will see
all the clusters neatly arranged in perfect order.  No
fragmentation!  The advantage to using this method over using
programs like Microsoft Defrag or Norton Speedisk is that they
are not always perfect and can in fact at some times break
files.  My motivation in going to all of this trouble was
because after using Defrag, I found that one of my .WAV files
in my Multimedia Themes was broken and could not be accessible.
Imagine what else could break.
     I have not tried using Info-ZIP or PkZip for OS/2, but
I figure they would work with the same restrictions applied
(ie. Info-Zip no disk spanning, PkZip needing the Presentation
Manager).  In order to install Henk's FAT32 driver, I simply
followed the quicky instructions he had listed in the FAT32.TXT
file, using PARTFLT.FLT and not the OS2DASD.DMD file he had
modifyed (on my OS/2 box it trapped as a result).  On the
IFS=FAT32 line I did not have /EAS on (enabling Extended
Attribute support).
     So, do you *really* want to dump OS/2?  Didn't think
so.  A question...could this method work with Linux?  There
is a ext2 driver available for OS/2, that I know of.  Perhaps
that is something else for me to try and play with! ;-)


CONCLUSION

     The best compression program for backing up OS/2 with is
RAR/2, hands down.  Not only does it support disk spanning,
EA's, doesn't require the Presentation Manager, and can recover
from corrupt archives, but it is also easy to use due to the
text-based Norton Commander-like interface, so no messy command
line switches to are necessary.  A great piece of work, indeed! 
Capable of backing up OS/2 onto another partition or onto
multiple disks/cartridges making it right now, the emergency
disaster recovery solution of choice out of the current crop of
common compression utilities.
     There are a few more coming, the next major release of
Info-Zip (Zip 3.00 & UnZip 6.00) are being planned to support
multiple archives.  ARJ/2 2.6x, currently in beta, is another
possible choice to look at since it doesn't need the PM and
supports disk spanning and recovery from corrupt archives.


BOOTOS/2 Notes:
http://hobbes.nmsu.edu - latest version is 9.17

     There seems to be a problem with Warp Connect & FP39 when
trying to make a BootOS/2 TARGET=x TYPE=PM partition.  It creates
it fine, but when I boot it up, it freezes at the "OS/2" box that
appears on the top left-hand corner.  Weird.  I could not boot
to a PM partition (BOOTOS2 TARGET=x TYPE=PM) even when I was back
down in FP26!  Same symptom occurs, during bootup it just freezes
at the "OS/2" box on the top left-hand corner.  The samething
also occurs in FP40, BTW.
     Even making just the floppies seems to cause a small error

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    07-Sep-99 03:16:16
  To: All                                               07-Sep-99 15:25:24
Subj: (2/2) Backup & Defragmentation 3.1 (Sept. 7, 1999)

with Warp 3 & Connect.  Under FP40, for instance, upon making the
two disk system (BOOTOS2 2DISK=A) after loading up the first disk
it would give me a blank screen and stop dead in its tracks,
going no further.  The solution, copy SESMGR.DLL from your
x:\OS2\DLL onto your BOOTOS2 disk 1 (A:\OS2\DLL).  This also
happened under FP39, BTW.  If you do run into any other kind of
problem with the BOOTOS2 floppies, press ALT-F2 upon booting up
the diskettes just to see what happens.  On this occasion for
example, upon pressing ALT-F2, the screen said that SESMGR.DLL
was not installed in any of the LIBPATH directory statements on
the diskette.
     Warp 4 seems to have absolutely no issues whatsoever, either
a TYPE=PM or 2DISK=A under any of the FP's I have used (FP1, FP6,
& FP10).


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: dpeterso@halcyon.com                              06-Sep-99 21:29:04
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Microsoft Word 5.5b Download

From: Dennis Peterson <dpeterso@halcyon.com>


nospam@nowhere.com
wrote:
> 
> I do not believe there was ever an Excel for DOS.

There was
but it
required
the GUI
shell
known as
Windows
2.1 or a
Windows
2.1
runtime
environment.

[snip]

> I have what I believe is the last M$ Multiplan for DOS: 4.2.  Sadly, it has
> very serious Y2K problems, which has finally forced me to look for an
> alternate.  At this point, I do not regard StarOffice as a viable
> alternate.

Why? I'm
seeing
some
performance
problems
with it in
OS/2 but
it
performs
fine on my
Unix
systems.
Regardless,
it gets
the job
done so
far but
I've
steadfastly
avoided
mucking
with Excel
macros
since they
always
seem to
break in
the next
release.

I'm also
curious if
Excel for
PM has Y2K
problems
-- I
should
light it
off and
see...

dp

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: I'm not organized at all (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           07-Sep-99 01:26:24
  To: All                                               07-Sep-99 15:25:24
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <Z8vLRdP7nz3N-pn2-xHzRn4EjyvGc@yourmachine.yourlocaldomain.yourisp>, on
09/07/99 at 01:48 AM,
   donnelly@tampabay.rr.com (Buddy Donnelly) said:

> Heh. Must be a new concept in Shareware. The 
> Share-or-Die-Die-Die-you-scumbucket-bastard-Ware concept. 

> Marketing attitude enhanced by Idi Amin?  Or Micro$oft. Or the Internal 
> Revenue Service.

Were I Nick, I would tell you to go to hell. Since I'm not, I will anyway.
Your attitude is not worthy of anything but a Microsoft Lemming.

> I missed the beginning of this but if somebody else is complaining about
>  the appearance of folder indexes in MR2Ice I'll chime in. Having 
> information lines running off past vertical divider lines that aren't 
> draggable or scrollable is pretty bush league, to my eye. You have to
> drag  WarpSans to the page to see as many characters as you can, but
> that makes  it pretty difficult to read overall.

Anyone who makes such assinine claims must have one totally farkled system
and lack the ability to properly install/operate a computer. Why don't you
get your system fixed. No one else has the problems you claim with ICE
running off the screen, etc.

Frankly, I don't think you do either. I think you are a worthless liar.

> But I think the answer is, it's too complicated for Nick to bother
> fixing  it at this late date?

Unlike you, Nick is still working on, improving, adding features, etc. to
ICE. Thankfully, you appear to be one of a group of less than a dozen
assholes who complaint about it.


> Buddy

Buddy? The only human who would want to be your buddy would be Bill Gates.

 

--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: arjen@removethis.hacom.nl                         06-Sep-99 18:05:05
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Question about quality of pdf-files from ghostscript

From: "Arjen Meijer" <arjen@removethis.hacom.nl>

On Mon, 06 Sep 1999 14:20:05 +0200 (CDT), Jan Hartman wrote:

:>how to make a highquality pdf-file?

You have to specify a high quality printer. Do not know which one.

You to following command in gostscript to make in all os/2:

******start file*****
/* ps2pdf.cmd Convert PostScript to PDF on os/2 */
/* Written by Arjen Meijer */
/* 19 januari 1998 changed on 20 september 1998 and 5 april 1999*/

PS2PDFGS="C:\Program.map\gstools\gs5.50\gsos2.exe"
PS2PDFPARAMS="-q -dNOPAUSE -dBATCH -sDEVICE#pdfwrite"
PS2PDFOPT="-IC:\Program.map\gstools\gs5.50;C:\Program.map\gstools\gs5.50\font
s;c:\psfonts"

arg psfile pdffile tail                    /* get input file parameter */     

if psfile='' then do                                                        
        say 'Nothing to do. Start with a postscript file name. Hit enter to
end.' 
        pull enter                          
        exit                                                                  
end                            /* end Do */   
                               
if pdffile = "" then pdffile =left(psfile,LastPos(".",psfile)-1)".PDF"

address cmd PS2PDFGS PS2PDFPARAMS PS2PDFOPT tail"-sOutputFile#"pdffile" 
-c save pop -f "psfile
exit

*******endfile****


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sizzen en Dwan (1:109/42)

+----------------------------------------------------------------------------+

From: msuch@ibm.net                                     07-Sep-99 09:53:02
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Copying CD with audio and data tracks with cdrecord

From: "Michel SUCH" <msuch@ibm.net>

On 6 Sep 1999 23:27:06 GMT, Carsten Frank wrote:

>I would like to copy a cd whis has audio and data tracks on it. How 
>can i copy such a cd with cdrecord?
>
>Thanks

Hi,

In the latest versions of cdrecord/2, you will find a batch called
cdcopy.cmd that should do the trick.
Let me know if any problem.
You will need to download leech 1.20 from hobbes to be able to read the
audio tracks and, eventually the latest level of emxrt.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           07-Sep-99 08:06:28
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Swap File

From: doug.bissett"at"ibm.net (Doug Bissett)

On Sat, 4 Sep 1999 00:47:45, "Dilbert Firestorm" <wwiv@pppproject.org>
wrote:

> Doug,
>  
> Would not having a large swap file cause netscape/2 2.02 to have a memory
leak?
>  
> I had this program (memstat) that kept track  of three things, memory,
swapfile
> and drive size.  I watched the memory usage decrease, and then the swap
space
> decreased in size.
>  
>  
>  
> Origin: Nuclear Wasteland * 504-394-0509
> 

Well, NO. The swapper file does not cause memory leaks (unless there 
is a memory leak in the swapper file code). The swapper file may grow,
and not shrink again, if there is a memory leak in any program 
(including bits and pieces of OS/2) that is running. 

Swap space increases, if something requires more memory than what is 
available in real memory, and the current swap file.  It is supposed 
to shrink back to the default size when/if the program releases that 
memory.

A memory leak occures when a program asks for, and gets, memory 
allocated, and never releases that memory back to the system when it 
is supposed to.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: C.J.@btsoftware.com                               07-Sep-99 10:52:07
  To: All                                               07-Sep-99 15:25:24
Subj: Check Out  DCITU

From: "C.J." <C.J.@btsoftware.com>

DCITU 
*********

Digital Camera Image Transfer Utility.

This program allows images to be transferred from various digital cameras to
an OS/2-based computer. The transfer is accomplished using the standard
serial port  cable usually supplied with the camera. Currently supported
cameras include various
models from Kodak, Agfa, Epson, Olympus, Sanyo, Sierra and Toshiba. 
More information on the camera models is available from DCITU Beta
Information Page 

Check it out and download DCITU for a free trial period from:
http://www.btsoftware.com/os2/dcitu.htm


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: C.J. (1:109/42)

+----------------------------------------------------------------------------+

From: jknott@ibm.net                                    06-Sep-99 10:08:07
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Alternate CONFIGs

From: jknott@ibm.net (James Knott)

In article
<Z8vLRdP7nz3N-pn2-jdgfHf5LzBMI@yourmachine.yourlocaldomain.yourisp>,
donnelly@tampabay.rr.com (Buddy Donnelly) wrote:

Where'd you find BOOTSET?

tnx


>On Sat, 4 Sep 1999 19:01:59, "J. R. Fox" <jr_fox@earthlink.net> a crit 
>dans un message:
>
>> Will Rose wrote:
>> 
>> >I've never had any problems with Unimaint, which I've used as >long as
I've used Process Commander (but this is under Warp >3.0) nor any backup
issues.  I don't use Object Desktop (or >any desktop enhancer).  AFAIK the
only files changed are >DOSCALL1.DLL (patched), KBDBASE.SYS (replaced) and
PMSHELL.EXE >(the PROTSHELL in CONFIG.SYS).
>> 
>> Yes, those sound like the files in question.  I must plead 
>> temporary brainlock on one thing: it wasn't backup issues, BUT
>> 
>> >Now that I know where to look, I'll start with a base 3.0
>> >system and add a few fixpacks and see what happens.
>> 
>> FixPack issues !  Always revert to a PC-less setup *before*
>> you apply a fixpack, otherwise you could have some problems.
>> I don't recall the specifics, but this has been discussed on 
>> Compuserve OS/2 fora.  Because of some key differences between
>> the respective DOSCALL.DLLs and PMSHELLs, I maintain an alter-
>> nate CONFIG.SYS, called NO-PC.SYS.  I always boot with this
>> active before doing certain things, like applying a Fixpack,
>> or running the UniMaint functions that can get tripped up by
>> Process Cmdr.  I think there's an ALT-F1 (?) facility for using
>> other versions of CONFIG.SYS, but I just rename 'em and shuttle
>> them around.  There are times when I may want to boot up without certain
>> other components, too.
>
>
>This is very simple to do. And very useful, in my opinion. 
>
>1. Place your alternate CONFIG.SYS in \OS2\BOOT and rename it, we'll say, 
>to CONFIG.B (for Buddy?).
>
>2. On any reboot, you can Alt-F1 to the choices screen and then hit the key
>B, and you'll now be booting with .\OS2\BOOT\CONFIG.B instead of 
>\CONFIG.SYS, for just this one time. (The screen does not have to tell you
>that you have this choice for it to work.)
>
>The "reserved" keynames are 1, 2, 3, M, V, and X. If you're using Dennis 
>Bareis very handy ARCHIVE utility, which allows creation of up to nine 
>different desktops, then don't use anything but letters. (I've never tried 
>it with other characters like \ or / or `, but neither can I imagine 
>running out of alphabet letters.)
>
>If your memory is bad and you want to remind yourself each time what your 
>choices are, and what they do, you'll want to edit \OS2\BOOT\ALTF1BOT.SCR 
>(IBM says) with a text editor to add a line for B and include a 
>description. See OS/2 Command Ref Help for "Displaying Your CONFIG.? 
>Choices".
>
>That said, I prefer editing ALTF1TOP.SCR, because I don't think OS/2 ever 
>messes with that one, and if you do it too you might want to remove a 
>couple of the blank lines on that page to make more room.
>
>OS/2 Help also talks about making Batch files to help with this, but you 
>don't need them. Maybe it applies to an older version of Warp?
>
>
>I've got 4 alternates: one that loads nearly zero drivers (Z); one that 
>loads CMD.EXE as the COMSPEC (T) instead of 4OS2.EXE or vice versa (4); and
>one that simply forces an Autocheck on every partition (A). You do have to 
>be careful to update these versions with any other changes that get made to
>your base CONFIG.SYS. (That's the biggest problem I've run into, when I 
>need one of the alternates it is slightly out of date for something or 
>other.)
>
>
>By the way, there's another very nifty utility (freeware now) called 
>BOOTSET that works a little differently, being called at the completion of 
>your normal CONFIG.SYS, but it can accomplish the same thing if you read 
>the docs. I've used it for a long time and recommend it for its own sake, 
>but won't go into it here.
>
>
>
>Good luck,
>
>Buddy
>
>Buddy Donnelly
>donnelly@tampabay.rr.com
>

-- 
E-mail jknott@ca.ibm.com
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            07-Sep-99 09:10:15
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Microsoft Word 5.5b Download

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On 6 Sep 1999 17:58:38 GMT, John Hong <jdc0014@InfoNET.st-johns.nf.ca> wrote:
>
>	Some people may experience a black screen trap pointing towards 
>POINTER$$ or something like that.  It is the POINTDD.SYS file that is 
>where Microsoft Word 5.5b goes nuts with.  At the time I was using the 
>DDPAK01's POINTDD.SYS, so I backleveled that to the default Warp 3 one 
>(10-03-94).  Works fine with the DDPAK01'd MOUSE.SYS and what not.  I 
>don't see any difference.
>	This seems to be agreeable with Word 5.5b.  No trap's...yet.  
>After playing around with this, it isn't a wonder that Word 5.5 could not 
>beat WordPerfect 5.1 during its day.  It's not bad, but it does lack some of 
>the features that WP5.1 had.  No endnote capability (does do footnotes, 
>though).  The one that I really could not understand was the lack of a 
>zoom capability during print preview.  Ick.  One thing that I did like 
>was the graphical display, but the thing is, you can not use the mouse 

You can, at least with Word 5.0, if you run it in a DOS box rather than
as OS/2 app. It's bound, and even as OS/2 app you don't get long file
names. So, unless you run protectonly=yes you don't gain much from
running it as OS/2 app, but you loose the ability to use the mouse in
graphics mode.

>which sort of made the thing pointless.  One thing that I will give 
>credit for, which seems to reflect the majority of Microsoft programs is 
>that they made Word 5.5b, simple.  So I can see why Word 5.x users refuse 
>to move onto the newer versions of Word.  This must have been the main 
>reason why Microsoft let Word 5.5b go as a freebie for the existing Word 
>5.0 users.

I really like(d) Word 5.0. Coming from Wordstar 3.x / 4.x it took me
some time to convert, but apart from the key sequences in WS there was
nothing I'd miss in Word 5.0. No nonsense menus, text always visible,
IMHO the only useful piece of software they ever produced.

 Cheers,
              Stefan


-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: csaba.raduly@sophos.com                           07-Sep-99 11:18:26
  To: All                                               07-Sep-99 15:25:24
Subj: Re: check out  File Commander/2

From: Csaba Raduly <csaba.raduly@sophos.com>

Dennis Peterson wrote:
> 
> This is the most-used application I have ever purchased. I would guess
> that nearly 90% of all non-email text I've created over the last several
> years and virtually all html I've created was done with this tool. It is
> also my most used tool when I'm stuck using Windows, too. The recursive
> zip viewer, editor, file viewer, file finder, hot-key change dir, and
> some much more have assured this will always be on my system. Do I
> recommend it? Hell, yes! I would even consider using it on my Unix
> systsems if there were such a thing.
> 
> dp
> 
> "C.J." wrote:
> >
> >  File Commander/2
> > ************************
>

For someone growing up on Norton Commander, it's priceless
(well, actually it's around $ 25 :-)

For Win* I use Windows Commander ( http://www.ghisler.com/ )
which has even more nifty features (like built-in FTP client, etc.)

I hate the "always overwrite" feature of OS/2 CMD.EXE,
and even more the Windows Explorer. Copying files can't be
easier than from one panel to another.

Csaba
-- 
-----BEGIN GEEK CODE BLOCK----- 
Version 3.1
GCS/>GMU d- s:- a30 C++$ UL+ P+>+++ L++ E- W+ N++ o? K? w++>$ O++$ M-
V- PS PE Y PGP- t+ 5 X++ R* tv++ b++ DI+++ D++ G- e+++ h-- r-- !y+
-----END GEEK CODE BLOCK----- 

Csaba Raduly,    Software Developer (OS/2),    Sophos Anti-Virus
mailto:csaba.raduly@sophos.com            http://www.sophos.com/
US Support +1 888 SOPHOS 9            UK Support +44 1235 559933
Life is complex, with real and imaginary parts.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SOPHOS Plc (1:109/42)

+----------------------------------------------------------------------------+

From: dcurren@ibm.net                                   07-Sep-99 05:09:08
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: "Dale Curren" <dcurren@ibm.net>

On Mon, 06 Sep 1999 10:37:56 -0400, Raphael Tennenbaum wrote:

>"Dale Curren" <dcurren@ibm.net> wrote:
>
>>>Since it applies to both versions of PRM, I'm almost positive it's 
>>>Fixpack 11 related.  I uninstalled and cleaned out the os2.ini file 
>>>before reinstalling, so it has to be an outside influence.  As I'm 
>>>unwilling to back out FP 11, I'm looking for a new mail reader.
>>
>>We're having a lot of fun with jstreet.  A fellow named Paul VanKeep is
fixing 
>>many of the little problems and it's becoming quite wonderful.
>
>Now, that sounds interesting.  Mind telling us a little
>more?  A url maybe?

Be glad to.  You can download the program from hobbes.  The serial number is
included, I believe.  If not, I'll give you mine.  Once you get that file, go
to 
paul.vankeep.com and get his latest modifications.  This email runs in java,
therefore you can run in win95/98/nt, os2, linux, apple, etc


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: letoured@sover.net                                07-Sep-99 00:49:28
  To: All                                               07-Sep-99 15:25:25
Subj: Re: MR/2 ICE

From: letoured@sover.net

>I missed the beginning of this but if somebody else is complaining about 
>the appearance of folder indexes in MR2Ice I'll chime in. Having 
>information lines running off past vertical divider lines that aren't 
>draggable or scrollable is pretty bush league, to my eye. You have to
>drag  WarpSans to the page to see as many characters as you can, but that
>makes  it pretty difficult to read overall.

I've used MR/2 for a few years now and have never never felt compelled to
go around complaining about it.

RE-PHRASED:  If you don't like the product, don't use it! 


_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: FStolpmann@knuut.de                               07-Sep-99 13:49:03
  To: All                                               07-Sep-99 15:25:25
Subj: TCP/IP ID and PW after installing DB2 PE v6.1

From: Frank Stolpmann <FStolpmann@knuut.de>

Hi, 
 
recently I installed DB2 Personal Edition v6.1 (german). 
 
But now the TCP/IP setup requires an user ID and a password. Up to now   
every attempt entering TCP/IP setup failed due to the wrong ID. 
 
I tried to change the PW using admin_pw.cmd but it refuses: "Can't find   
JIT." 
 
What's wrong? What shall I do? 
 
My system: OS/2 Warp v4 FP 11 German, Java v1.1.8, TCP/IP v4.1 
 
Thanx.

 
Bye. 
 
Frank Stolpmann 
FStolpmann@knuut.de 
http://home.knuut.de/FStolpmann 
-------------------------------------------------------------------- 
PGP key available.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Customer of UUNET Deutschland GmbH, Dortmund, Ger
(1:109/42)

+----------------------------------------------------------------------------+

From: bd83h@bedford.waii.com                            07-Sep-99 14:43:06
  To: All                                               07-Sep-99 18:14:23
Subj: Re: MR/2 ICE

From: Steve Drewell <bd83h@bedford.waii.com>

On Tue, 7 Sep 1999, Bob Germer wrote:

 > I missed the beginning of this but if somebody else is complaining about
 >  the appearance of folder indexes in MR2Ice I'll chime in. Having 
 > information lines running off past vertical divider lines that aren't 
 > draggable or scrollable is pretty bush league, to my eye. You have to
 > drag  WarpSans to the page to see as many characters as you can, but
 > that makes  it pretty difficult to read overall.
 
 Anyone who makes such assinine claims must have one totally farkled system
 and lack the ability to properly install/operate a computer. Why don't you
 get your system fixed. No one else has the problems you claim with ICE
 running off the screen, etc.
 
 Frankly, I don't think you do either. I think you are a worthless liar.

Bob, who rattled your cage? In defense of Buddy, it is widely known that
in MR/2 ICE, the vertical divider lines in the message index cannot be
dragged left or right and that the text of, for example, the subject field
is limited to what will fit between the vertical divider lines. Reducing
the font size will enable more text to be viewed but at the expense of
legibility.

Maybe you should have read and understood the message before jumping down
Buddy's throat.

Cheers,
Steve

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Western Geophysical, Houston, TX (1:109/42)

+----------------------------------------------------------------------------+

From: lazaga1@ibm.net                                   07-Sep-99 07:07:21
  To: All                                               07-Sep-99 18:14:23
Subj: Re: Question about quality of pdf-files from ghostscript

From: Paul Lazaga <lazaga1@ibm.net>


>>>>>>>>>>>>>>>>>> Original Message <<<<<<<<<<<<<<<<<<

On 9-6-99, 12:20:05 PM, "Jan Hartman" <jan.hartman@fil.lu.se> wrote 
regarding Question about quality of pdf-files from ghostscript:


> Hi!

> In the process of sending a manuscript for a book to a publisher,
> I was told that they wanted a pdf-file, not a postscript file as I
> earlier
> was led to believe. However, even though I can create a postscript
> file
> which is 1200x1200 dpi, I can only get ghostview/script to make a
> pdf-file which is 300x300 dpi. This is not good enough. Any ideas
> about
> how to make a highquality pdf-file?

> I use DeScribe word processor, and I do not want to get Acrobat
> destiller
> or some other software to do this.

> Thanks for all help,

> / Jan
> ===================================================
> Jan Hartman
> Filosofiska institutionen/Department of Philosophy
> Lunds Universitet/Lund University
> Kungshuset, Lundagrd                                  +46-(0)46 
2223253
> S-222 22 Lund                                              fax 
+46-(0)46 2224424
> Sweden
> E-mail: Jan.Hartman@fil.lu.se

I am finding it difficult to find printers who work outside of Quark 
Xpress or Adobe Pagemaker.  Another problem is most WP programs do not 
handle exporting of gradients well.  I have not found an OS/2 program 
that creates either.  As far as graphics I have run into printers who 
can't work with 1200 x 1200 GIF 24 color files, saying they are not 
high enough resolution.  I think the problem lies more in their 
computer literacy and flexiblity.

I have had PDF files (b/w) from GS accepted for newsprinting though.

-- 
Paul Lazaga, eMail: lazaga1@ibm.net
WTW Group, Los Gatos, California, USA
Tel: 408-378-8636, Fax: 408-378-5927
Web: http://www.wtwgroup.com




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                07-Sep-99 10:11:03
  To: All                                               07-Sep-99 18:14:23
Subj: Re: MR/2 ICE

From: lifedata@xxvol.com

Bob Germer <bobg.REMOVEME.@pics.com> said:

>Unlike you, Nick is still working on, improving, adding features, etc. to
ICE.
>Thankfully, you appear to be one of a group of less than a dozen assholes who
>complaint about it.

Unlike you, Nick knows how to keep a civil tongue in his head.

I feel ICE DOES HAVE some unnecessary problems such as lack of helps at this
very late date.  I suppose that is why it is still referred to as a beta - at
this very late date.  

In any case I continue to use it because it does what I need done better than
anything else I've tried.

I must be one of the _______ who have complained.

Jim L
Remove XX from address to Email
More gun laws will cure the nations ills - just like drug laws do.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jklewis@nospam.com                                07-Sep-99 09:53:12
  To: All                                               07-Sep-99 18:14:23
Subj: Re: Can't type in DOS box after 50 days

From: Jim Lewis <jklewis@nospam.com>

Joerg Tiemann wrote:

> On Fri, 03 Sep 1999 10:56:28 -0500, Jim Lewis <jklewis@nospam.com> wrote:
> >  You say your 2.1 box shows an uptime of 123 days? What program are you
> > using to get that info? Does 2.1 not have the uptime wrap bug?
>
>   I use UpdSig 1.* by Peter Engels. It uses an internal counter which
> gets incremented each time the system counter overflows.  That way
> uptimes up to 137 years can be measured. :-)  The programm output is
> given as an update to an (signature) file which is of course free
> configurable ...  UpdSig can be found on Peter's homepage:
>
>         http://www.uni-bonn.de/~uzs0ad
>
> PS: No, I don't use it (yet?) for signatures.  I just look into the
> specified file to see the uptime.
> --
> tiemannj@gmx.de

   Instead of counting the overflows, I just count each minute in my Memory
Status app to get around the uptime overflow/wrap problem. The problem I am
seeing on my Warp 4 boxes with the DOS box is not happening on any of my
Warp 3 machines so I'm fairly sure now that there is nothing wrong with my
program (I run my app on all my OS/2 boxes). Maybe I need to install a
fixpack, except that I avoided doing that for 4 years and wanted to continue
avoiding it.

--

Jim Lewis
Not speaking for IBM.
Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Network Computing Division (1:109/42)

+----------------------------------------------------------------------------+

From: rrkurtz@us.ibm.com                                07-Sep-99 10:10:11
  To: All                                               07-Sep-99 18:14:23
Subj: FP11 and the little archive bit problem in directory entries

From: Dick Kurtz <rrkurtz@us.ibm.com>

Ref:     Append at 11:01:48 on 99/09/06 -0600 (by mckinnis@ibm.net)

This problem is fixed in FP12.

Dick Kurtz
eBusiness Development, Austin Tx.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Austin (1:109/42)

+----------------------------------------------------------------------------+

From: rwhutch@nr.infi.net                               07-Sep-99 16:16:16
  To: All                                               07-Sep-99 20:34:10
Subj: Re: Microsoft Word 5.5b Download

From: rwhutch@nr.infi.net  (R.W. Hutchinson)

>I really like(d) Word 5.0. Coming from Wordstar 3.x / 4.x it took me
>some time to convert, but apart from the key sequences in WS there was
>nothing I'd miss in Word 5.0. No nonsense menus, text always visible,
>IMHO the only useful piece of software they ever produced.

	I still think that Word 5.0 was the best Word Processor I ever used, but I
hear rumours that there HAVE been pretty decent versions of Excel too, some
time
in the past perhaps. Never used it myself.
--------------------------------------------------------------
"I would predict that there are far greater mistakes waiting
to be made by someone with your obvious talent for it."
Orac to Vila. [City at the Edge of the World.]
-----------------------------------------------
R.W. Hutchinson. | rwhutch@nr.infi.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                07-Sep-99 12:41:26
  To: All                                               07-Sep-99 20:34:10
Subj: Re: Microsoft Word 5.5b Download

From: lifedata@xxvol.com

rwhutch@nr.infi.net  (R.W. Hutchinson) said:

>I still think that Word 5.0 was the best Word Processor I ever used, but I

I missed the beginning of this thread.  Where is this Word download?

Jim L
Remove XX from address to Email
More gun laws will cure the nations ills - just like drug laws do.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         07-Sep-99 17:14:11
  To: All                                               07-Sep-99 20:34:11
Subj: Re: How to ...

From: racette@cablevision.qc.ca (Martin Racette)

On Tue, 7 Sep 1999 00:14:07, "J. R. Fox"
<jr_fox@earthlink.net> wrote:

> Martin Racette wrote:
> > 
> > On Thu, 2 Sep 1999 17:52:09,
> > jdc0014@InfoNET.st-johns.nf.ca (John
> > Hong) wrote:
> > 
> > > Martin Racette (racette@cablevision.qc.ca) wrote:
> > >
> > > : I would like to know How to copy the
> > > : content of an Audio cassette (music), to
> > > : a CD-R while using RSJ
> > >
> I don't really know what I'm talking about here, but you may
> want to check out a shareware OS/2 program called TWAVE.  There
> are a couple users on Compuserve who I think are using this to
> put tracks from LPs and reel-to-reel tapes into digital form -- 
> probably .WAV files on the h/d, which could then be converted
> into MP3 format, or whatever.  I suspect that TWAVE works with
> CDs too.  Of course, you'd then have to go from your h/d to a
> new cd using RSJ.  I doubt you'll find a one-step solution.
> 
> <jf>
> 

Thanks for the infornation, I'll check 
that later on and let you now :-)

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         07-Sep-99 17:19:25
  To: All                                               07-Sep-99 20:34:11
Subj: SETI@HOME problem

From: racette@cablevision.qc.ca (Martin Racette)

Hi guys,

The problem began last night (while I 
was asleep), the program finished the 
packet that it had to work on sent it 
back to the server and ever since it 
can't d/l another packet and return me 
the following error: "PLATFORM NOT 
FOUND" or "UNKNOWN ERROR -1", so what 
should I do about this

I'm running version 1.3 in Warp 4 FP11, 
and to last night everything was working
fine

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: domi@kenavo.NOSPAM.fi                             07-Sep-99 17:36:07
  To: All                                               07-Sep-99 20:34:11
Subj: Re: FP11 and the little archive bit problem in directory entries

From: domi@kenavo.NOSPAM.fi (Dominique Pivard)

On Tue, 7 Sep 1999 10:10:23, Dick Kurtz <rrkurtz@us.ibm.com> wrote:
> 
> This problem is fixed in FP12.

When will this puppy be available? I couldn't see it in 
ftp://service.boulder.ibm.com/ps/products/os2/fixes/v4warp/english-us/

Thanks, Dominique


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  07-Sep-99 17:54:03
  To: All                                               07-Sep-99 20:34:11
Subj: Re: How to ...

From: prather@infi.net (Jerry Prather)

In message <37D458CF.283E@earthlink.net> - "J. R. Fox"
<jr_fox@earthlink.net> writes:
:>I don't really know what I'm talking about here, but you may
:>want to check out a shareware OS/2 program called TWAVE.  There
:>are a couple users on Compuserve who I think are using this to
:>put tracks from LPs and reel-to-reel tapes into digital form -- 
:>probably .WAV files on the h/d, which could then be converted
:>into MP3 format, or whatever.  I suspect that TWAVE works with
:>CDs too.  Of course, you'd then have to go from your h/d to a
:>new cd using RSJ.  I doubt you'll find a one-step solution.

PMFJI but this looked interesting to me as well.  I grabbed it
from the net and read the documentation.  A quick try-out later
and I registered it.  This is going to permit me to do some neat
things!

Thanks for the pointer.


Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       07-Sep-99 18:28:08
  To: All                                               07-Sep-99 20:34:11
Subj: OS/2 DB2 Fixpack 8200?

From: Will Rose <cwr@cts.com>

I've been running DB2/2 2.1.2 FP 8120 for some time, and tried upgrading
to 8200 recently; that broke the Database Director, which fails
with a helpful message, for once; it can't find a resource in a DLL.
This is on Warp Connect, FP 40 and the DB2 Single-User edition; has
anyone seen this problem or anything like it?  Does anyone know the
difference between 8190 and 8200?  They are both still available.


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: meins@ll.mit.edu                                  07-Sep-99 15:55:04
  To: All                                               07-Sep-99 20:34:11
Subj: Re: PalmPilot and StarOffice

From: Charles Meins <meins@ll.mit.edu>

On 9-5-99, 1:55:53 PM, postmaster@[127.0.0.1] wrote regarding Re: 
PalmPilot and StarOffice:

> In <19990905.8414093@mis.configured.host>, on 09/05/99
>    at 08:41 AM, Brian Goodyear <bgoody@ibm.net> said:

> >Did anyone figure out how to syncronize the PalmPilot Addressbook
> >categories with the StarOffice addressbook?  There doesn't seem to be 
 any
> >equivalent of these categories in the StarOffice addressbook. Thanks,
> >Brian

> I'm careful with the SO/PalmPilot integration.  The last time I
> synchronized them, SO erased my categories in the PalmPilot.  I didn't 
lose
> any data, but the categories went back to the originals.

First off, there's a good discussion of SO/PalmPilot integration on 
OS/2 e-Zine (http://www.os2ezine.com/).  

Second, I had trouble with SO erasing stuff on my PalmPilot, too.  In 
my case, I lost all of the notes on the entries in my address book as 
well as resetting the address book categories.  Shortly after that, SO 
erased its own knowledge of PalmPilot synchronizing, i.e., it doesn't 
show up in the StarSchedule module anymore.  I haven't tried to 
reinstall it yet.

_____________________________________
Chuck Meins, Jr.
Group 38, Seeker and Missile Technology
MIT Lincoln Laboratory
781-981-7386 voice, -3330 fax




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@sover.net                                07-Sep-99 19:15:04
  To: All                                               08-Sep-99 05:26:21
Subj: Re: Microsoft Word 5.5b Download

From: letoured@sover.net

>I still think that Word 5.0 was the best Word Processor I ever used, but
>I hear rumours that there HAVE been pretty decent versions of Excel too,
>some time in the past perhaps. Never used it myself.

Word was more logical then Word Inperfect, but it was flop compaired to
the elegant layout of Lotus Manuscript.  -- Only trouble was that Lotus
marketed it, like IBM has marketed OS2. 


_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: raphaelt@netnews.worldnet.att.net                 07-Sep-99 20:29:21
  To: All                                               08-Sep-99 05:26:21
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum)

"Dale Curren" <dcurren@ibm.net> wrote:

>On Mon, 06 Sep 1999 10:37:56 -0400, Raphael Tennenbaum wrote:
>
>>"Dale Curren" <dcurren@ibm.net> wrote:
>>
snippers>
>>>We're having a lot of fun with jstreet.  A fellow named Paul VanKeep is
fixing 
>>>many of the little problems and it's becoming quite wonderful.
>>
>>Now, that sounds interesting.  Mind telling us a little
>>more?  A url maybe?
>
>Be glad to.  You can download the program from hobbes.  The serial number >is 
included, I believe.  If not, I'll give you mine.  

Thanks, I didn't need it (or don't yet, anyway).

I spent a half hour on it and it's awfully impressive --
everything I wanted to tweak, I could (that is, considering
it's java and not native OS/2).  It's as good as I'd heard. 
And I'm sure when I actually read the docs I'll be able to
figure how to change the font in the composing screen.

>Once you get that file, go to 
>paul.vankeep.com and get his latest modifications.  This email runs in >java, 
therefore you can run in win95/98/nt, os2, linux, apple, etc

I went to paul.vankeep.com but the jstreet stuff isn't there
(or should I say, not linked to by anything from the main
page).  Then I thought, and on a hunch, figured I'd invent a
subdirectory -- voila.  This does look fun.  Thanks again.

-- 
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: dcurren@ibm.net                                   07-Sep-99 19:32:27
  To: All                                               08-Sep-99 05:26:21
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: "Dale Curren" <dcurren@ibm.net>

>I went to paul.vankeep.com but the jstreet stuff isn't there
>(or should I say, not linked to by anything from the main
>page).  Then I thought, and on a hunch, figured I'd invent a
>subdirectory -- voila.  This does look fun.  Thanks again.

Oops, he changed some things since I was there last.  Try this one
paul.vankeep.com/jstreet. It works.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: awmg@yesic.com                                    07-Sep-99 21:44:20
  To: All                                               08-Sep-99 05:26:21
Subj: PMINEWS - binaries

From: "andrew g" <awmg@yesic.com>

Crickey! 
All I want to do is fire up PMInews 
have it get all the new articles in alt.binaries.clip-art
decode them into graphics files
leave them in a directory for me.

I can't believe I paid for this program if it can't even do something that
easy!

Anyone here had any success?

Thanks,

andrew
awmg@yesic.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Introits and Graduals (1:109/42)

+----------------------------------------------------------------------------+

From: jmiranda@ricochet.net                             07-Sep-99 19:13:07
  To: comp.os.os2.apps@list.deja.com                    08-Sep-99 05:26:21
Subj: Re: TCP/IP ID and PW after installing DB2 PE v6.1

To: "comp.os.os2.apps@list.deja.com" <comp.os.os2.apps@list.deja.com>
From: jose miranda <jmiranda@ricochet.net>

** Reply to note from "Robert Gehrig" <rgehrig@primenet.com> Tue, 07 Sep 1999
17:01:33 -0400 (EDT)
IBM uses USERID (in capital letters) for userid and PASSWORD for its password.

Good luck




 Sent via Deja.com http://www.deja.com/
 Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: nospam@null                                       08-Sep-99 02:32:04
  To: All                                               08-Sep-99 05:26:21
Subj: Fastback Plus for os/2 and CDRW's Long story

From: nospam@null (Richard Crane)

I have a P75 Mhz Award Bios computer with WARP 4 (at FP 9 I think- 10 does not 

seem to have installed successfully) installed and currently running on it as 
follows:
Hard Disc1Quantum 1 Gb IDE- master
Primary Part 	1 Mb 	Boot Manager with DOSos(C Drive), Win95(CDrive) and OS/2
(F 
Drive)options
Primary Part 	350Mb	For DOS and OS/2 (FAT)
Primary Part	685Mb	For Win95 (FAT)

Hard Disc 2 Maxtor 1Gb IDE- slave

Primary Part	505	D Drive FAT DATA
Logical Part		527             E Drive FAT DATA

CD ROM Matshita CR 585 on IDE Master

Hard Disc 3 SCSI Quantum 3.2 GB SCSI ID 0

Primary Part?	7Mb	Free Space- never created I just end up with this if I only 
logically partion this drive
Logical Partition	400Mb	F Drive HPFS OS2 system bootable
Logical Partition	760Mb	G Drive HPFS programs 
Logical Partition	1898Mb	H Drive HPFS data and programs

TAPE UNIT Seagate TapeStor 4/8Gb SCSI ID 4

Remainder of System

PCI Flashpoint LW SCSI card (ID's at 7)
PCI S3 864 2Mb video
ISA Soundblaster Vibra16 soundcard
ISA Modem can't remember brand 28K
ISA SCSI card (or pseudo SCSI?) came with  ARTEC AT3 scanner

Part 1 The Problem with Floppies
======================
Currently the heat wet and dirt of Darwin has me go through 1 or 2 floppy
drives
per year also it is not unusual to find that 8 or 9 out a box of10 floppies
you 
have stored generate CRC errors with fatal results for getting what was on
them 
back off.
Eg in the last month both my original and backup disc's for FASTBACK PLUS for 
OS/2 (stored in slightly different locations) showed they were now only
usefull 
as drink coasters, I'd pulled them and the Version 1.0 update disc out after 
reading about Brad Barclay still using Fastback successfully now (I don't
think 
I'd ever had it on Warp 4 and maybe not even Warp 3 Connect - memory goes as
to 
exactly when I used it either the days of 2.11 or non Connect 3).
That dreadful squeal that tells you your next thing to do is buy a new floppy 
drive greeted me on inserting my last floppy copy of BackAgain ver
2.01(despite 
what Roland says for me it has successfully restored my system from major 
operator errors made when installing  Linux ) ironically enough I had put it
in 
to do a disc copy.

So now I have no floppy based way to reinstall my back up software.

Part 2 The part 1 Problem work around
===========================

Simple I thought, as seen from the above drive table install OS/2 to another 
drive copy over the BA/2 drivers and files, manually add the entries to 
config.sys that you need. Check it works? Yep, pat self on back.
Getting even smarter putting it on a fat drive means that DOS can see it so if 

something happens that takes out my os/2 on both drives (like my stupid error) 
I
can restore my restoration software from my DOS eg I have one tape for using 
seagates DOS backup software and many floppies with enough to get dos and the 
seagate software running again. Further if any thing takes out the DOS it 
probably wont touch my main os/2 (f drive) and I can restore the C drive dos 
stuff from my os/2 back ups.

Part 3 The Second Problem
===================
Stupidity would be the short summary of it. No, not putting in the Win95
install
disc (as many would say)! But forgetting which C was active and which hidden
and
destroying the system files in the root of the DOS/OS2 partition somehow as I 
recall, this was just after some Partition Magic sessions to eliminate the
linux
partitions change partition sizes and locations etc etc. All this done so that 
I
would be able to "Solve" a  Win95 problem in the time honoured fashion 
(reinstall it ) and with an eye to future likely system changes.
Hey thats what backups are for right? Restore drive from backup and off we go.
Wrong!  Vaguely I recalled something about  being able systx for OS/2 on FAT 
drives and sys for DOS before they were bootable again so I think that maybe 
that's it but without thinking it through properly went to a command line and 
issued C:\os2\boot /dos. thinking I'll just check Dos Works while I'm here -  
wrong somehow about now I manged to get my config and autoexec's swapped eg
Dos 
tried to boot using OS/2's config.sys file. In short stuffed up the dual boot.
Ok this is no major crisis I can just format the disc and restore either from 
DOS or OS/2, a little nervous though as some of you will have noticed a level
of
redundancy is now missing in all this. 
 
Part 4 The Next "Great" Idea
 ===================
Instead of just doing that I now say to myself "Well I've had a problem with 
applying the last fixpack, the motherboard isn't 2K compliant so I'll be 
changing it soon, I'll upgrade the video to AGP then and (finances depending) 
maybe a new "big" drive or two. So maybe I should do a clean Warp 4 install
now 
and check that I'll have the appropriately updated drivers available and
working
on floppies for then and I know I've just replaced the floppy drive so it
should
be up to making a number of copies without s----ing itself." Usuall problems 
with floppies - throw away about 8 floppies before finally getting 3 good ones 

ready to go.

Part 6 How ?
=========
Inital plan: shutdown, insert CD reboot from floppies install small system in 
FAt with dual boot (memory check of what to select: TCPIP yes, VGA only
Desktop,
Faxworks, IBM's DOIP and IC should do from the CD - idea is that when I stuff 
something up it puts me in a position to email someone or fax them for help if 
I
need to - nothing more frustrating than remembering the solution to the
problem 
was in an newsgroup last week if you can't access the net).
Shutdown, reboot disc 2 no good. OK boot to main partition and make some new 
install discs by running cdinst.cmd off the CD.
Done, Shutdown, reboot, feed discs - install disc two eg the third in the 
process trundles away for a while then returns an error That the sytem can't 
operate the floppy or the hard drive and is stopped in that usual IBM speak
that
means that you don't know anything eg is it both the floppy and the HD it
can't 
run?
Reboot to main system recreate a new disc 2 shutdown reboot with discs feeding 

as necessary install starts OK chose Advanced selected the partition I wanted 
get reminded that although DOS isn't necessary for installing dual boot its 
easier that way- interupt install to put DOS on.

Part 7
OK I'll restore from tape
=================
Lastest backup in and away we go - noises of "shoeshining" from tape unit -
how 
long do I let it go? Dilemma solved in 35 minutes or there abouts Backagain 
returns an error about tape device.
Second try. Reboot from floppy to minimal  based DOS system and run Seagates
DOS
backup I'll restore from there. Whoops! The program isn't there any more. More 

DOS fooling around to get CD working so I can reinstall it. Then "Not enough 
memory to run program" - I'd forgotten those EMS/HIMEM games we used to all
play
with DOS. Spend time fiddling DOS drivers. Then have Seagates Backup tell me 
that there is a problem with the drive!
Bugger!
Search office for purchase record - experience delight of finding it and
finding
that the unit is still under warranty. Contact retailer "flicked" to importer 
(ACA Pacific - I'll mention them by name as they were helpful). Shipped unit 
back received new replacement. In the meantime look very closely at adds for 
CDRW's - for the general compatability issue it seems that the Yamaha 1644S is 

the go.

Part 8
Conclusion
========
At last you say. So why am I boring this group with all this? Well apart from 
the cartharsis that writing it has given me, I'd like to know is anyone using 
Fastback Plus with the Yamaha 1644S? Any setting up traps/tricks? Can anyone 
email me the Fastback Plus install disk files and the 1.0 update - Symantec in 

Australia doesn't want to help, seems rough when you've bought the license to 
use it ?
If i can't get that going what files do I need to have (and where) for
Cdrecord 
for OS/2 to work - can it be setup for "stand alone" (booting from floppy) 
restores (given the record I have with tapes, tape units and floppies and
floppy
drives I am expecting a hard drive will fail :(  sometime)?


Richard A Crane	cc emailed replies to rcraneAT ibmDOT net

Foolproof is not good enough ..... we're not dealing with fools

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: rappleby@cadvision.com                            07-Sep-99 20:42:10
  To: All                                               08-Sep-99 05:26:21
Subj: HomePage Publisher Training?

From: rappleby@cadvision.com (Ray Appleby)

Is there a manual or tutorial for HomePage Publisher?

Best Regards,
Ray Appleby                     rappleby@cadvision.com
[Team OS/2]                 Multitasking at OS/2 Warp4 Speed.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CADVision Development Corporation (http://www.cad
(1:109/42)

+----------------------------------------------------------------------------+

From: cstumpf@monmouth.com                              07-Sep-99 22:53:03
  To: All                                               08-Sep-99 05:26:21
Subj: Re: HomePage Publisher Training?

From: "Chris Stumpf" <cstumpf@monmouth.com>

The only docs, I know of are the help files that come with it and the faq on
the developer's website.


On 7 Sep 1999 20:42:20 -0700, Ray Appleby wrote:

:>Is there a manual or tutorial for HomePage Publisher?
:>
:>Best Regards,
:>Ray Appleby                     rappleby@cadvision.com
:>[Team OS/2]                 Multitasking at OS/2 Warp4 Speed.


		Chris Stumpf
		C.S.E. Computer Services
		Computer Consultant (OS/2, Lan, Wan, CTI)
		Serenity Systems Channel Partner
		IBM Certified Systems Expert - OS/2 Warp 4
		

web:    http://cse.anterras.net
email:	cse@anterras.net
phone: (732)918-2480



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Monmouth Internet (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          08-Sep-99 03:04:15
  To: All                                               08-Sep-99 10:38:27
Subj: Re: SETI@HOME problem

From: piquant00@uswestmail.net (Annie K.)

On Tue, 7 Sep 1999 17:19:51, racette@cablevision.qc.ca (Martin Racette) wrote:

:The problem began last night (while I 
:was asleep), the program finished the 
:packet that it had to work on sent it 
:back to the server and ever since it 
:can't d/l another packet and return me 
:the following error: "PLATFORM NOT 
:FOUND" or "UNKNOWN ERROR -1", so what 
:should I do about this

 Give the SETI boys at Berkeley a chance to fix their system(s).

-- 
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: rpeterse@ix.netcom.com                            07-Sep-99 20:55:15
  To: All                                               08-Sep-99 10:38:27
Subj: Re: FP11 and the little archive bit problem in directory entries

From: Randy Petersen <rpeterse@ix.netcom.com>

Chuck, If you run 'dirfix all test' it doesn't pickup HPFS formatted drives.

/*----------------------------------------------------------------------*
  Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
  Please also email replies to: Randy Petersen <rpeterse@ix.netcom.com>
  Now Very Happily Warping along with Warp 3.0 Connect at fixpack #40.
  SPAMMERS don't bother me, I direct them to the void at /dev/nul.
*----------------------------------------------------------------------*/

In <37D3FA2F.F12A5D10@ibm.net>, on 09/06/99
   at 11:30 AM, Chuck McKinnis <mckinnis@ibm.net> said:


>Sorry, had a minor problem parsing the argument in dirfix.

/*
dirfix.cmd - reset archive attribute on directories
Copyright 1999 by Chuck McKinnis,  Sandia Park, NM (USA)
mckinnis@ibm.net
*/

Trace 'N'

Parse Upper Arg drives test .

If drives = 'TEST' Then
   Parse Upper Arg test drives .

If Abbrev(test, 'TEST') Then
   test = 1
Else
   test = 0

If drives = '' Then
   Do
      Say 'Report on and reset directory entries'
      Say '   that have the archive bit set on'
      Say ''
      Say 'Usage - dirfix x: | all [test]'
      Say '   test - just report the findings'
      Return
   End

Call Setup

If drives = 'ALL' Then
   drives = SysDriveMap(, 'LOCAL')
Else
   If Lastpos(':', drives) <> Length(drives) Then
      drives = drives || ':'

tst_attrib = '++***'
chg_attrib = '-****'

if test Then
   chg_attrib = '*****'

Do i = 1 To Words(drives)
   Parse Value SysDriveInfo(Word(drives, i)) With drive free total . 
   If free = total | free = '' | free = 0 Then
      Iterate i
   drive = drive || '\'
   rc = SysFileTree(drive, 'dirs.', 'DSO', tst_attrib, chg_attrib)
   If dirs.0 > 0 Then
      Do i = 1 To dirs.0
         Say 'Archive bit set on in' dirs.i
      End
   Else
      Say 'No archive bits found set in directories on' drive
   If \test Then
      Do
         If dirs.0 = 1 Then
            Say dirs.0 'directory cleared on' drive
         Else
            Say dirs.0 'directories cleared on' drive
      End
End
Call Cleanup
Return

Cleanup:
 Procedure Expose sysfuncs. 
 Do i = 1 To sysfuncs.0
    If sysfuncs.i <> '' Then
       Call RxFuncDrop(sysfuncs.i)
 End
 Return

Setup:
 Procedure Expose sysfuncs.
 sysfuncs.1 = 'SysFileTree'
 sysfuncs.2 = 'SysDriveMap'
 sysfuncs.3 = 'SysDriveInfo'
 sysfuncs.0 = 3
 Do i = 1 To sysfuncs.0
    If RxFuncQuery(sysfuncs.i) Then
       Call RxFuncAdd sysfuncs.i, 'RexxUtil', sysfuncs.i
    Else
       sysfuncs.i = ''
 End
 Return

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      07-Sep-99 18:31:08
  To: All                                               08-Sep-99 10:38:27
Subj: Re: SETI@HOME problem

From: nospam@savebandwidth.invalid      (John Thompson)

In <z3F1sghqDj8g-pn2-G7tY00di6zr5@cnq57-73.cablevision.qc.ca>,
racette@cablevision.qc.ca (Martin Racette) writes:

>The problem began last night (while I 
>was asleep), the program finished the 
>packet that it had to work on sent it 
>back to the server and ever since it 
>can't d/l another packet and return me 
>the following error: "PLATFORM NOT 
>FOUND" or "UNKNOWN ERROR -1", so what 
>should I do about this
>
>I'm running version 1.3 in Warp 4 FP11, 
>and to last night everything was working
>fine

The seti project had some hardware problems over the weekend and 
apparently they haven't yet fully resolved them.  I've been 
seeing the same errors on my linux machine and have been unable 
to download a new work unit for a couple days now.

-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: OS2Guy@WarpCity.com                               07-Sep-99 23:05:16
  To: All                                               08-Sep-99 10:38:27
Subj: JStreet Mailer: Who, What, Where & How

From: Tim Martin <OS2Guy@WarpCity.com>

Rhys Dow wrote:

> Bill Wild Willy Kredentser wrote:

> > This is good to hear.  I think the method for joining
> > this list is of sufficient general interest that a
> > public request rather than a private E-mail is more
> > appropriate.  This is a public request.
> >
> I'm afraid I can't help you there, I signed off quite a while ago, and
> don't have any old addresses.  Hopefully someone on the list will
> reply.  I imagine Tim Martin knows!  :o

Yes, of course.  J Street Mailer is now under new development by
the J Street Band (of programmers) headed by Paul vanKeep of
Sumatra Software and Mike Bowler.  You would be amazed at what
these two extremely competent Java programmers have accomplished
in just a very short period of time.  To join the current mailing list
simply visit here, select the JStreet Users list and sign up:

http://www.sumatra.nl:81/guest/RemoteAvailableLists

If you have a copy of JSM on your system today you can
click the icon to download version pvk.7 dated august 31.
The file name is inno7.zip.  Download this file directly
into your JSM directory then rename your current innoval.jar
file innoval-old.jar and rename the inno7.zip to innoval.jar.
When you start JSM this new innoval.jar will unzip itself and
update all the necessary files.  Very ingenious.  You'll find
JSM really fast now with some new features and graphics
and much more to come.

The JSM community owes many kudos and special thanks
primarily to Paul vanKeep as well as to his newest team
member, Mike Bowler, for their fine work.  JSM continues
to be the leader in Java emailers.

Tim Martin
The OS/2 Guy
Warp City
http://warpcity.com
"E-ride the wild surf to Warp City!"

P.S.  If you're not a registered owner of J Street Mailer you can
become one very easily.  Dan Porter of InnoVal Systems has
released JSM for free.  Download your copy from here:
http://st6.yahoo.com/lib/innoval.jstreet.zip

and use the free registration code of:  38604851 to activate
your own copy of JSM.  Download the upgrade above to
upgrade it to the most current release.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: cabanuche@lep.-philips.fr                         08-Sep-99 08:11:08
  To: All                                               08-Sep-99 10:38:27
Subj: Re: HomePage Publisher Training?

From: "Jean-Pierre Cabani'e" <cabanuche@lep.-philips.fr>

On 7 Sep 1999 20:42:20 -0700, Ray Appleby wrote:

>Is there a manual or tutorial for HomePage Publisher?
>
>Best Regards,

You may ask any question to the author (clerinATcompuserveDOTcom), he is very
responsive.
Yours,


Jean-Pierre Cabani'e    ('e mimics an e acute)
cabanieATlep-philipsDOTfr


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Philips reserarch (1:109/42)

+----------------------------------------------------------------------------+

From: ron.beernink@nzpost.co.nz                         08-Sep-99 08:57:18
  To: All                                               08-Sep-99 14:43:00
Subj: semaphore limitations/settings

From: ron.beernink@nzpost.co.nz (Ron Beernink)

Does anyone know of semaphore limitations in OS/2 and if there is a
related setting?

Regards

Ron Beernink
Technical Designer
NZ Post
Wellington, New Zealand

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ICONZ - The Internet Company of New Zealand (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           08-Sep-99 05:42:26
  To: All                                               08-Sep-99 14:43:00
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <990907142523.31276E-100000@bisv3.bedford.waii.com>, on 09/07/99 at
02:43 PM,
   Steve Drewell <bd83h@bedford.waii.com> said:

>  Anyone who makes such assinine claims must have one totally farkled
> system  and lack the ability to properly install/operate a computer.
> Why don't you  get your system fixed. No one else has the problems you
> claim with ICE  running off the screen, etc.
>  
>  Frankly, I don't think you do either. I think you are a worthless
> liar.

> Bob, who rattled your cage? In defense of Buddy, it is widely known that
> in MR/2 ICE, the vertical divider lines in the message index cannot be
> dragged left or right and that the text of, for example, the subject
> field is limited to what will fit between the vertical divider lines.
> Reducing the font size will enable more text to be viewed but at the
> expense of legibility.

> Maybe you should have read and understood the message before jumping
> down Buddy's throat.

I read and understood "Buddy's" message. He claims the screen goes off his
monitor. Worse, he slammed Nick Knight completely unfairly and
untruthfully. Moreover, he is posting here with Win9x software which we
all know won't run under OS/2.

"Buddy" is a Microsoft lemming, a polite way of saying damned liar.



--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           08-Sep-99 05:46:26
  To: All                                               08-Sep-99 14:43:00
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <990907142523.31276E-100000@bisv3.bedford.waii.com>, on 09/07/99 at
02:43 PM,
   Steve Drewell <bd83h@bedford.waii.com> said:

> On Tue, 7 Sep 1999, Bob Germer wrote:

> Bob, who rattled your cage? In defense of Buddy, it is widely known that
> in MR/2 ICE, the vertical divider lines in the message index cannot be
> dragged left or right and that the text of, for example, the subject
> field is limited to what will fit between the vertical divider lines.
> Reducing the font size will enable more text to be viewed but at the
> expense of legibility.

This is my second reply to you. Read "Buddy's" message. Here are the
quotes which first rattled my cage:

-----------Begin quote from Donnelly's
message-------------------------------------

> Heh. Must be a new concept in Shareware. The 
> Share-or-Die-Die-Die-you-scumbucket-bastard-Ware concept. 

> Marketing attitude enhanced by Idi Amin?  Or Micro$oft. Or the Internal 
> Revenue Service.

--------------End quote from his
message----------------------------------------------


So, you see, he started the unpolite verbiage here. I responded in kind.

> Maybe you should have read and understood the message before jumping
> down Buddy's throat.

I read it. I understood it. However, after the above "Buddy" added the
following:

-------------Second quote from
Donnelly--------------------------------------------------

> But I think the answer is, it's too complicated for Nick to bother
> fixing  it at this late date?

------------End second
quote-------------------------------------------------------------------

That is a totally unfair, unwarranted, untrue lie about Nick and his
ability and willingness to continue development for a very small market
segment. It is this sort of demanding, snide, unfair, lie which drives
shareware authors away.

Idiots like Buddy Donnelly <spelling?> deserve to be castrated, drawn,
quartered, and have their heads stuck up on poles.


--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dink@dont.spam.me                                 08-Sep-99 07:22:00
  To: All                                               08-Sep-99 14:43:00
Subj: good .wav -> .mp3 encoder!

From: "dinkmeister" <dink@dont.spam.me>

check out:

ftp://hobbes.nmsu.edu/pub/os2/apps/mmedia/sound/convert/lame325.zip

it encoders w/better quality than bladeenc!  this version is quite a lot
faster
than the old v3.13..


- dink ( http://dink.org )



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  08-Sep-99 11:07:29
  To: All                                               08-Sep-99 14:43:00
Subj: Re: JStreet Mailer: Who, What, Where & How

From: l_luciano@da.mob (Stan Goodman)

I tried to subscribe to this list as soon as I saw Tim's posting. Two 
minutes later, I received a note from the list asking that I confirm the 
subscription. Two minutes after that, it turned out that the reason the 
list needed this confirmation was so that it could inform me that the list 
already had its maximum permissible number of subscribers. Way to go, 
fellas.

I can only hope that some of the kind successful subscribers will post here
(and maybe even on comp.os.os2.mail-news) some of the more trenchant 
information from the list, so that even those outside the select circle may
profit.

According to Tim's message, I could have downloaded the new version to 
replace my registered version by clicking on "the icon". Has anybody 
discovered this icon? I saw nothing that looked like a download link or an 
icon that might work as advertized.

On Wed, 8 Sep 1999 06:05:33, Tim Martin <OS2Guy@WarpCity.com> wrote:

> Rhys Dow wrote:
> 
> > Bill Wild Willy Kredentser wrote:
> 
> > > This is good to hear.  I think the method for joining
> > > this list is of sufficient general interest that a
> > > public request rather than a private E-mail is more
> > > appropriate.  This is a public request.
> > >
> > I'm afraid I can't help you there, I signed off quite a while ago, and
> > don't have any old addresses.  Hopefully someone on the list will
> > reply.  I imagine Tim Martin knows!  :o
> 
> Yes, of course.  J Street Mailer is now under new development by
> the J Street Band (of programmers) headed by Paul vanKeep of
> Sumatra Software and Mike Bowler.  You would be amazed at what
> these two extremely competent Java programmers have accomplished
> in just a very short period of time.  To join the current mailing list
> simply visit here, select the JStreet Users list and sign up:
> 
> http://www.sumatra.nl:81/guest/RemoteAvailableLists
> 
> If you have a copy of JSM on your system today you can
> click the icon to download version pvk.7 dated august 31.
> The file name is inno7.zip.  Download this file directly
> into your JSM directory then rename your current innoval.jar
> file innoval-old.jar and rename the inno7.zip to innoval.jar.
> When you start JSM this new innoval.jar will unzip itself and
> update all the necessary files.  Very ingenious.  You'll find
> JSM really fast now with some new features and graphics
> and much more to come.
> 
> The JSM community owes many kudos and special thanks
> primarily to Paul vanKeep as well as to his newest team
> member, Mike Bowler, for their fine work.  JSM continues
> to be the leader in Java emailers.
> 
> Tim Martin
> The OS/2 Guy
> Warp City
> http://warpcity.com
> "E-ride the wild surf to Warp City!"
> 
> P.S.  If you're not a registered owner of J Street Mailer you can
> become one very easily.  Dan Porter of InnoVal Systems has
> released JSM for free.  Download your copy from here:
> http://st6.yahoo.com/lib/innoval.jstreet.zip
> 
> and use the free registration code of:  38604851 to activate
> your own copy of JSM.  Download the upgrade above to
> upgrade it to the most current release.
> 

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    08-Sep-99 07:29:04
  To: All                                               08-Sep-99 14:43:00
Subj: Re: SETI@HOME problem

From: dcasey@ibm.net (Dan Casey)

In article <z3F1sghqDj8g-pn2-G7tY00di6zr5@cnq57-73.cablevision.qc.ca>,
racette@cablevision.qc.ca (Martin Racette) wrote:
>Hi guys,
>
>The problem began last night (while I
>was asleep), the program finished the
>packet that it had to work on sent it
>back to the server and ever since it
>can't d/l another packet and return me
>the following error: "PLATFORM NOT
>FOUND" or "UNKNOWN ERROR -1", so what
>should I do about this

Hardware problems at SETI@home. All seems to be fixed, now ... all 3
of my systems are crunching new Work Units.

--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: Jan.Danielsson@falun.mail.telia.com               08-Sep-99 14:26:24
  To: All                                               08-Sep-99 16:42:17
Subj: Re: semaphore limitations/settings

From: "Jan Danielsson" <Jan.Danielsson@falun.mail.telia.com>

>Does anyone know of semaphore limitations in OS/2 and if there is a
>related setting?

* 65535 shared semaphores (system wide)
* 65535 private sempahores per process

As far as I can gather, that does not mean 65535 event sempahores, 65535
mutex and 65535 muxwait sempahores.


I know of no related setting, but I am no expert...


 /j



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telia Internet (1:109/42)

+----------------------------------------------------------------------------+

From: OS2Guy@WarpCity.com                               08-Sep-99 08:25:19
  To: All                                               08-Sep-99 20:57:22
Subj: Re: JStreet Mailer: Who, What, Where & How

From: Tim Martin <OS2Guy@WarpCity.com>

Stan Goodman wrote:

> I tried to subscribe to this list as soon as I saw Tim's posting. Two
> minutes later, I received a note from the list asking that I confirm the
> subscription. Two minutes after that, it turned out that the reason the
> list needed this confirmation was so that it could inform me that the list
> already had its maximum permissible number of subscribers. Way to go,
> fellas.

I know there was some discussion of resticting the mail list
for various reasons.  Do not feel slighted or angry because
you can't get on.  There is a purpose to all the madness.

The developers may want to keep the number of subscribers
on a manageable level.  As a web master who also restricts the
number of members who have access to our services (free
tech support) it is very difficult to make everyone happy or
to meet all the requests for help that come in.  I can sometimes
get so bogged down from 'help me' requests that the Warp City
site suffers, updates cannot be accomplished, other members
requests cannot be fulfilled.  And as with all free things, there are
those who need a lot of step-by-step hand holding or personalized
assistance.  All of that is time consuming and takes focus away
from the JSM updating work.  The JStreet Band developers are releasing
updates that are considered solid Betas.  You know people, the
minute an update causes a problem some folks go completely
berserk and trash the work, flame the developers and end up
generating a bunch of negativity.  Always save your previous
updates and simply backlevel when you find the latest update
causes a problem.

Paul vanKamp released update 8 today adding in a few new 'gizmos'.
The speed of JSM is now superior to anything I've seen.

> I can only hope that some of the kind successful subscribers will post here
> (and maybe even on comp.os.os2.mail-news) some of the more trenchant
> information from the list, so that even those outside the select circle may
> profit.

My focus is Warp City members and I run as much new JSM
information as I can to keep members updated on new releases
and features.  Perhaps a JSM user outside of WC can post
updated information here too.

> According to Tim's message, I could have downloaded the new version to
> replace my registered version by clicking on "the icon". Has anybody
> discovered this icon? I saw nothing that looked like a download link or an
> icon that might work as advertized.

To download the latest update (which I left out of my previous message)
you can do so from: http://paul.vanKeep.com/jstreet/index.html.

>
>
> On Wed, 8 Sep 1999 06:05:33, Tim Martin <OS2Guy@WarpCity.com> wrote:
>
> > Rhys Dow wrote:
> >
> > > Bill Wild Willy Kredentser wrote:
> >
> > > > This is good to hear.  I think the method for joining
> > > > this list is of sufficient general interest that a
> > > > public request rather than a private E-mail is more
> > > > appropriate.  This is a public request.
> > > >
> > > I'm afraid I can't help you there, I signed off quite a while ago, and
> > > don't have any old addresses.  Hopefully someone on the list will
> > > reply.  I imagine Tim Martin knows!  :o
> >
> > Yes, of course.  J Street Mailer is now under new development by
> > the J Street Band (of programmers) headed by Paul vanKeep of
> > Sumatra Software and Mike Bowler.  You would be amazed at what
> > these two extremely competent Java programmers have accomplished
> > in just a very short period of time.  To join the current mailing list
> > simply visit here, select the JStreet Users list and sign up:
> >
> > http://www.sumatra.nl:81/guest/RemoteAvailableLists
> >
> > If you have a copy of JSM on your system today you can
> > click the icon to download version pvk.7 dated august 31.
> > The file name is inno7.zip.  Download this file directly
> > into your JSM directory then rename your current innoval.jar
> > file innoval-old.jar and rename the inno7.zip to innoval.jar.
> > When you start JSM this new innoval.jar will unzip itself and
> > update all the necessary files.  Very ingenious.  You'll find
> > JSM really fast now with some new features and graphics
> > and much more to come.
> >
> > The JSM community owes many kudos and special thanks
> > primarily to Paul vanKeep as well as to his newest team
> > member, Mike Bowler, for their fine work.  JSM continues
> > to be the leader in Java emailers.
> >
> > Tim Martin
> > The OS/2 Guy
> > Warp City
> > http://warpcity.com
> > "E-ride the wild surf to Warp City!"
> >
> > P.S.  If you're not a registered owner of J Street Mailer you can
> > become one very easily.  Dan Porter of InnoVal Systems has
> > released JSM for free.  Download your copy from here:
> > http://st6.yahoo.com/lib/innoval.jstreet.zip
> >
> > and use the free registration code of:  38604851 to activate
> > your own copy of JSM.  Download the upgrade above to
> > upgrade it to the most current release.
> >
>
> -------------
> Stan Goodman
> Qiryat Tiv'on
> Israel
>
> Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
>
> 




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: Larry.Snider@ibm.net                              08-Sep-99 11:32:19
  To: All                                               08-Sep-99 20:57:22
Subj: Re: MR/2 ICE

From: "Larry Snider" <Larry.Snider@ibm.net>

In <37d631d9$2$obot$mr2ice@news.pics.com>, on 09/08/99 
   at 05:46 AM, Bob Germer <bobg.REMOVEME.@pics.com> said:

=>That is a totally unfair, unwarranted, untrue lie about Nick and his
=>ability and willingness to continue development for a very small market
=>segment. It is this sort of demanding, snide, unfair, lie which drives
=>shareware authors away.

=>Idiots like Buddy Donnelly <spelling?> deserve to be castrated, drawn,
=>quartered, and have their heads stuck up on poles.

Sounds like a WarpCity tactic. ;>

-- 
Larry Snider - Portsmouth, RI
Internet: Larry.Snider@ibm.net
FidoNet: 1:109/921.52

"That OS/2 Feller"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            08-Sep-99 15:44:03
  To: All                                               08-Sep-99 20:57:22
Subj: Re: Microsoft Word 5.5b Download

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On Tue, 07 Sep 1999 12:41:52 -0400, lifedata@xxvol.com
<lifedata@xxvol.com> wrote:
>rwhutch@nr.infi.net  (R.W. Hutchinson) said:
>>I still think that Word 5.0 was the best Word Processor I ever used,
>>but I
>
>I missed the beginning of this thread.  Where is this Word download?

http://officeupdate.microsoft.com/downloadDetails/Wd55eng.htm

It states it is an upgrade for registered users of Word 5.0. Stefan


-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         08-Sep-99 16:23:06
  To: All                                               08-Sep-99 20:57:23
Subj: Re: SETI@HOME problem

From: racette@cablevision.qc.ca (Martin Racette)

Thank you all for your information, and 
if offended anybody I'm sorry, but I 
didn't knew that there was a problem 
with their server, to the contrary I 
thought that I was the problem (some I 
might of done wrong :-( )

Thanks again and I'll just wait for them
to fix everything, and I wish them good 
luck

//-------------------------
Good Luck

Bonne Chance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bd83h@bedford.waii.com                            08-Sep-99 17:33:12
  To: All                                               08-Sep-99 20:57:23
Subj: Re: MR/2 ICE

From: Steve Drewell <bd83h@bedford.waii.com>

On Wed, 8 Sep 1999, Bob Germer wrote:

 I read and understood "Buddy's" message. He claims the screen goes off his
 monitor.

Did he? I must have missed or forgotten that part....care to refresh my
memory?

 Moreover, he is posting here with Win9x software which we
 all know won't run under OS/2.

So what? I'm posting here using Pine running on AIX. Does that make me a
bad person? Does that mean I don't love and use OS/2 or MR/2 ICE?

Steve

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Western Geophysical, Houston, TX (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  08-Sep-99 16:28:16
  To: All                                               08-Sep-99 20:57:23
Subj: Re: JStreet Mailer: Who, What, Where & How

From: l_luciano@da.mob (Stan Goodman)

On Wed, 8 Sep 1999 11:07:58, l_luciano@da.mob (Stan Goodman) wrote:

> I tried to subscribe to this list as soon as I saw Tim's posting. Two 
> minutes later, I received a note from the list asking that I confirm the 
> subscription. Two minutes after that, it turned out that the reason the 
> list needed this confirmation was so that it could inform me that the list 
> already had its maximum permissible number of subscribers. Way to go, 
> fellas

Tim Martin was good enough to tell me the REAL address at which to get this
update (the Unofficial JStreet Users Page): 

http://paul.vankeep.com/jstreet

and I have downloaded the new JAR file and installed it. The Webpage asks 
that one send email to the JStreet List to report on one's impressions. 
Because the list refused to subscribe me (because it says it is full), I 
guess I should report here that it looks very good, and I hope the new 
developers will keep up the good work.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: ecmille@ibm.net                                   08-Sep-99 16:51:28
  To: All                                               08-Sep-99 20:57:23
Subj: Re: Netscape and Win16 Plug-ins???

From: ecmille@ibm.net (Ted Miller)

In message <176uZD2KcidF-pn2-iHoTWGVjNdcv@man-016.dialup.zetnet.co.uk> -
rde@tavi.co.uk (Bob Eager)07 Sep 1999 22:20:25 GMT writes:
:>
:>On Mon, 6 Sep 1999 20:39:22, ecmille@ibm.net (Ted Miller) wrote::>I have
been struggling with this for days. I did the above, applied 
:>the August FixPack and....it works!!!
:>
:>THANKS TED!
:>
:>-- 
:>Bob Eager
:>rde at tavi.co.uk
:>PC Server 325; PS/2s 8595*3, 9595*3 (2*P60 + P90), 8535, 8570, 9556*2,
:>8580*6,
:>8557*2, 8550, 9577, 8530, P70, PC/AT..


Hello Bob

I'm glad my info helped you. In the os2 news groups I've certainly received
more help than I've ever given, so its nice to be able to give a little back.

Ted Miller
ecmille@ibm.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jknott@ibm.net                                    08-Sep-99 08:47:24
  To: All                                               08-Sep-99 20:57:23
Subj: Re: Alternate CONFIGs

From: jknott@ibm.net (James Knott)

In article
<Z8vLRdP7nz3N-pn2-638uUGR4de2R@yourmachine.yourlocaldomain.yourisp>,
donnelly@tampabay.rr.com (Buddy Donnelly) wrote:
>On Mon, 6 Sep 1999 14:08:14, jknott@ibm.net (James Knott) a crit dans un 
>message:
>
>> In article
<Z8vLRdP7nz3N-pn2-jdgfHf5LzBMI@yourmachine.yourlocaldomain.yourisp>,
>> donnelly@tampabay.rr.com (Buddy Donnelly) wrote:
>> 
>> Where'd you find BOOTSET?
>> 
>
>	http://www.jmast.se/free/bootset.htm


Got it.  Tnx

-- 
E-mail jknott@ca.ibm.com
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: bd83h@bedford.waii.com                            08-Sep-99 17:49:26
  To: All                                               08-Sep-99 20:57:23
Subj: Re: MR/2 ICE

From: Steve Drewell <bd83h@bedford.waii.com>

On Wed, 8 Sep 1999, Bob Germer wrote:

 -----------Begin quote from Donnelly's
 message-------------------------------------
 
 > Heh. Must be a new concept in Shareware. The 
 > Share-or-Die-Die-Die-you-scumbucket-bastard-Ware concept. 
 
 > Marketing attitude enhanced by Idi Amin?  Or Micro$oft. Or the Internal 
 > Revenue Service.
 
 --------------End quote from his
 message----------------------------------------------
 
 
 So, you see, he started the unpolite verbiage here. I responded in kind.


I believe Buddy was responding to the way a previous poster eloquantly 
answered some ligitimate questions about MR/2 ICE. The previous poster's
attitude left a lot to be desired. It appears that someone can't ask a few
simple questions about a piece of software without a bunch of people
jumping down their throat, hurling abuse and intimidating them.


 > Maybe you should have read and understood the message before jumping
 > down Buddy's throat.
 
 I read it. I understood it. However, after the above "Buddy" added the
 following:
 
 -------------Second quote from
 Donnelly--------------------------------------------------
 
 > But I think the answer is, it's too complicated for Nick to bother
 > fixing  it at this late date?
 
 ------------End second
 quote-------------------------------------------------------------------
 
 That is a totally unfair, unwarranted, untrue lie about Nick and his
 ability and willingness to continue development for a very small market
 segment. It is this sort of demanding, snide, unfair, lie which drives
 shareware authors away.

It was an OPINION, not a lie. See where it says "I think the answer is". 
Why get so worked up over someone elses opinions?

 Idiots like Buddy Donnelly <spelling?> deserve to be castrated, drawn,
 quartered, and have their heads stuck up on poles.

And what about yourself?

Steve

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Western Geophysical, Houston, TX (1:109/42)

+----------------------------------------------------------------------------+

From: steve53_remove_this@earthlink.net                 08-Sep-99 11:24:12
  To: All                                               08-Sep-99 20:57:23
Subj: Re: MR/2 ICE

From: steve53_remove_this@earthlink.net

In
<sXnyXDNIUu65-pn2-dQTd9hhpYkDU@207-172-44-48.s48.tnt3.brd.va.dialup.rcn.com>,
on 09/06/99 
   at 01:43 AM, dboultr@spamfree.erols.com said:

Doug,

Hopefully the flame wars have subsided...

>As a refugee from PostRoadMailer, I've been trying out MR/s ICE which 
>has been highly touted here over the years.  I know Nick has been a  real
>supporter of OS/2 and very responsive to users of his program.   Still,
>I'm finding that the version that I downloaded to try out  (1.62) feels
>very much like an early beta.  I'm sure I'm missing  something here.  Can

The updates to ICE have slowed down a bit lately.  Reading between the
lines, Nick is doing a lot of WinXX work in his day job and is also
working on a WinXX port of ICE.  In the past, his tools were
cross-platform, so once the heavy lifting of the WixXX port is done,
hopefully we will start to see a higher pace of feature updates to the
OS/2 version.  Just my opinion.

>1) Most of the help seems to have not yet been written.  Is this 
>correct?  I saw reference under help to a manual online, but it seems  to
>download a file called manual.exe to my hard drive.  That program  will
>not run under OS/2 or DOS.  What am I missing here?  

Not quite sure what's going on.  The file you want is manual.inf.  I've
had my copy forever so I forget how it was packaged.  Perhaps, it's a zip
file with a rename extension.  Where did you get it from?

You are correct, ICE's help is not finished and probably never will be. 
That's the way it is.  I suggest you subscribe to the ICE mailing list and
use that as your manual. :)

>2) I need the conversion utility for address books from PRM.  The link on
>Nick's web site  says file not found.  Any ideas where I might get  it?

This I can't help with.  Perhaps someone on the list has it stashed away
somewhere.

>3)  Is there any way to change the appearance of the Inbox page?   There
>doesn't seem to be the ability to resize the columns.  Unless I  use tiny
>font sizes, I can't see more than a word or two in each  column.  ProNews
>handles this extremely well, and MR/2 doesn't seem to handle it at all.

Hope for an update.  There's lot's of little things I'd like to see
changed.  However, these are Nick's call.

>4)  Are taglines only possible with an add-in?

Yes, but the add-in's work just fine.

>I really want to like this program.  I'm hoping that my feeling that 
>it's a step back from ProNews is due to my unfamiliarity with it.

Mail reader's are like religion.  Each one has it's feature and benefits
and set of believer's. :)  ICE can do a lot and, obviously, it's my
choice.

HTH,

Steven

--
---------------------------------------------------------------
Steven Levine <steve53removethis@earthlink.net>  MR2/ICE #10183 Warp4/FP11
---------------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: bts@iaehv.nl                                      08-Sep-99 21:29:15
  To: All                                               08-Sep-99 20:57:23
Subj: Mousedriver for mouse w. Mousewheel

From: "Martin Bartelds" <bts@iaehv.nl>

Is there an OS/2 mouse driver for some
brand mouse with mousewheel ? Preferable Logitech.

Martin



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: BTSoftware (1:109/42)

+----------------------------------------------------------------------------+

From: areese@bestnetpc.com                              08-Sep-99 19:51:18
  To: All                                               08-Sep-99 21:38:26
Subj: Re: Mousedriver for mouse w. Mousewheel

From: areese@bestnetpc.com (A. Willard Reese)

In message <ogfvnruiay.fhrqt61.pminews@martin> - "Martin Bartelds"
<bts@iaehv.nl>Wed, 08 Sep 1999 21:29:30 +0200 (CDT) writes:
:>
:>Is there an OS/2 mouse driver for some
:>brand mouse with mousewheel ? Preferable Logitech.
:>
:>Martin
:>
Martin,
	Yes.  I have a logitech wheel mouse that I've had working in OS2 for
almost a year now.  As I recall, there is am IBM device driver for the
"ScrollPoint" or the "Logitech Mouseman+" mouse. The compressed file
is SCROLLMS.EXE. I'm not sure where I got the file but it was on one
of the IBM driver sites.
Willard



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Reese Associates (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          08-Sep-99 20:55:22
  To: All                                               09-Sep-99 03:51:06
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

> In <37d631d9$2$obot$mr2ice@news.pics.com>, on 09/08/99 
>    at 05:46 AM, Bob Germer <bobg@pics.com> said:
> 
> =>That is a totally unfair, unwarranted, untrue lie about Nick and his
> =>ability and willingness to continue development for a very small market
> =>segment. It is this sort of demanding, snide, unfair, lie which drives
> =>shareware authors away.
> 
> =>Idiots like Buddy Donnelly <spelling?> deserve to be castrated, drawn,
> =>quartered, and have their heads stuck up on poles.

Hm. It sounds like you gave that Sequence Of Operations good solid thought.


Although I think I'd make a note to save off the head in case it gets 
riven, cloven, sundered, or just lost in the dust during the Quartering 
process. (Quarterings always turn out to be more chaotic than you plan for 
on paper.)

But, you know, if it comes to this I've had a good life, all in all, and I 
think it's better to end one's days having one's head "stuck up on poles" 
than to live one's life with it stuck up one's ass, I should think. 

(Sorry, that's a cheap shot and I take it back.)


A note on ProNews Filters:

Y'all put up with aggro like this all the time, do you?



Good luck,

Buddy

Buddy Donnelly <spelling!>
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          08-Sep-99 20:59:03
  To: All                                               09-Sep-99 03:51:07
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 8 Sep 1999 16:33:25, Steve Drewell <bd83h@bedford.waii.com> a crit
dans un message:

> On Wed, 8 Sep 1999, Bob Germer wrote:
> 
>  I read and understood "Buddy's" message. He claims the screen goes off his
>  monitor.

No he didn't. And he doesn't. And it doesn't. (If it did I'd fix it.)

> 
> Did he? I must have missed or forgotten that part....care to refresh my
> memory?
> 
>  Moreover, he is posting here with Win9x software which we
>  all know won't run under OS/2.

Interesting supposition there. Based on Zero Evidence. And totally 
incorrect, I can say.

> 
> So what? I'm posting here using Pine running on AIX. Does that make me a
> bad person? Does that mean I don't love and use OS/2 or MR/2 ICE?

Line up to the right for the Loyalty Oaths.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: gsingerzz@home.com                                08-Sep-99 21:13:14
  To: All                                               09-Sep-99 03:51:07
Subj: Re: Fastback Plus for os/2 and CDRW's Long story

From: gsingerzz@home.com (Gideon Singer)

On Wed, 8 Sep 1999 02:32:09, nospam@null (Richard Crane) wrote:

-> Can anyone 
-> email me the Fastback Plus install disk files and the 1.0 update - Symantec 
in 
-> Australia doesn't want to help, seems rough when you've bought the license
to 
-> use it ?
-> 

Wish I could help with the Fastback Plus install disk, but I am 
looking for that one as well. I put mine somewhere and have not been 
able to find it. The Fastback 1.0 update is on hobbes. As for Symantec
they will not help even here in NA. The software is no longer 
supported at any level. So If anyone sees this message and has a copy 
of Fastback Plus for OS2 install disk please zip it up and mail it to 
both of us and then put it on Hobbes as well. I use Fastback with a 
zip drive and find that it works well.

---
Gideon Singer
"It's A Magical World, Hobbes, Ol' Buddy... ...Let's Go Exploring !"
Calvin's Last Words 12/31/95
Where do you want to Warp today?
Remove the Z to email.
Webpage: members.home.net:80/gsinger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          08-Sep-99 21:09:01
  To: All                                               09-Sep-99 03:51:07
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 8 Sep 1999 16:49:53, Steve Drewell <bd83h@bedford.waii.com> a crit
dans un message:
> 
> 
> I believe Buddy was responding to the way a previous poster eloquantly 
> answered some ligitimate questions about MR/2 ICE. The previous poster's
> attitude left a lot to be desired. It appears that someone can't ask a few
> simple questions about a piece of software without a bunch of people
> jumping down their throat, hurling abuse and intimidating them.

Thanks for getting it. I make no apologies for mixing Irony into such 
things.


>  -------------Second quote from
>  Donnelly--------------------------------------------------
>  
>  > But I think the answer is, it's too complicated for Nick to bother
>  > fixing  it at this late date?
>  
>  ------------End second
>  quote-------------------------------------------------------------------

And to clarify, though most seemed to have "gotten it" too, I was guessing 
that Nick considers the layout of those indexes sufficient to present the 
information, because they haven't been changed since the beginning of time.
And if it were *not* complicated to change, I think he'd have changed it 
long before now.

However, it might deserve a second look by Nick. When he began MR2, the 
Subject lines were fairly short. Now, with all these automated website 
things sending you mail (take any ebay communication, for instance) the 
resultant Subject line quickly runs off the alloted space. If you've got 
several ebay (for example again) notices from different ebay Item # 
auctions, you can't read the Subject without opening the article itself, 
and its Header window.

It ain't no big deal, since on balance MR2 is wayy beyond every other mail 
client I've used, on any platform, and if he never fixed another thing 
except kept it up to date with the changes in underlying Warp code that IBM
seems to be using to bedevil ISPs, it would still be worth every nickel I 
paid for it long ago. And I'd continue to use it exclusively, despite the 
other mail clients I've paid for and the clients provided as freeware.



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: OS2Guy@WarpCity.com                               08-Sep-99 14:22:22
  To: All                                               09-Sep-99 03:51:07
Subj: Re: JStreet Mailer: Who, What, Where & How

From: Tim Martin <OS2Guy@WarpCity.com>

Stan Goodman wrote:

> On Wed, 8 Sep 1999 11:07:58, l_luciano@da.mob (Stan Goodman) wrote:
>
> > I tried to subscribe to this list as soon as I saw Tim's posting. Two
> > minutes later, I received a note from the list asking that I confirm the
> > subscription. Two minutes after that, it turned out that the reason the
> > list needed this confirmation was so that it could inform me that the list
> > already had its maximum permissible number of subscribers. Way to go,
> > fellas
>
> Tim Martin was good enough to tell me the REAL address at which to get this
> update (the Unofficial JStreet Users Page):
>
> http://paul.vankeep.com/jstreet

The 'real' url was offered in the post to which I responded.

> and I have downloaded the new JAR file and installed it. The Webpage asks
> that one send email to the JStreet List to report on one's impressions.
> Because the list refused to subscribe me (because it says it is full), I
> guess I should report here that it looks very good, and I hope the new
> developers will keep up the good work.

I was hoping my information was helping the OS/2 user.
In the future I'll limit such information to Warp City members.

> -------------
> Stan Goodman
> Qiryat Tiv'on
> Israel
>
> Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
>
> 




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: jhimmel@i-2000.com                                08-Sep-99 23:20:11
  To: All                                               09-Sep-99 05:38:01
Subj: Re: MR/2 ICE

From: jhimmel@i-2000.com (James Himmelman)

On Wed, 8 Sep 1999 09:42:53, Bob Germer <bobg.REMOVEME.@pics.com> 
wrote:
> I read and understood "Buddy's" message. He claims the screen goes off his
> monitor.

You may have read it, but you didn't understand it. He never said the 
screen goes off his monitor. He was saying that the text flows past 
the dividers that can not be adjusted. He didn't use the best wording,
but it was obvious that he was referring to the text getting cut off 
by fields that are not large enough to contain the full string, and 
the inability to adjust the field size.

I use and love MR/2 ICE. I am not bothered by the above mentioned 
"limitation", but I can see how some people might be.

I DO take exception to his comment that this feels like an "early 
beta". EARLY BETA??? This app NEVER fails me. NEVER! It's one of my 
favorite pieces of shareware. It was a stupid comment.

[[[ James Himmelman - jhimmel@i-2000.com ]]]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jhimmel@i-2000.com                                08-Sep-99 23:25:29
  To: All                                               09-Sep-99 05:38:02
Subj: Re: Netscape and Win16 Plug-ins???

From: jhimmel@i-2000.com (James Himmelman)

It solved MY problem too.

On Tue, 7 Sep 1999 22:20:25, rde@tavi.co.uk (Bob Eager) wrote:
> On Mon, 6 Sep 1999 20:39:22, ecmille@ibm.net (Ted Miller) wrote:
> 
> > I am currently using Netscape 4.61 and at first I couldn't get Netscape to
> > recognize my Win16 plugins either(Shockwave and Realplayer). Before I go
any
> > further here are readouts of my relevant plugin directoties:
> > 
> > Directory of E:\NETSCAPE\PROGRAM\WIN16\PLUGINS
> > 
> > 10-29-98   8:23p     <DIR>           0  .
> > 10-29-98   8:23p     <DIR>           0  ..
> >  8-16-99   7:24p     <DIR>           0  np16dsw
> > 10-29-97   4:54a      5728           0  NP16DSW.DLL
> > 11-22-97   8:48p     22720           0  NPRA16.DLL
> >  4-21-98  12:49p    204944           0  Npswf16.dll
> > 10-02-97   7:25p      5673           0  SWReadMe.htm
> >         7 file(s)     239065 bytes used
> >                    828356096 bytes free
> > 
> > and:
> > 
> > Directory of E:\NETSCAPE\PROGRAM\PLUGINS
> > 
> >  8-30-99   7:41p     <DIR>           0  .
> >  8-30-99   7:41p     <DIR>           0  ..
> >  8-10-99   5:34p      3158          61  DUMYPLUG.DLL
> >  8-21-99   6:08p      3158          61  NP16DSW.DLL
> >  1-14-98   4:49p     51333           0  npbamba.dll
> > 10-20-98   5:36p     82629           0  NPFI.DLL
> >  8-09-99   4:25p    197728           0  NPNULOS2.DLL
> >  8-10-99   5:33p      2116           0  NPOS2AUD.DLL
> >  8-10-99   5:33p      2116           0  NPOS2MID.DLL
> >  8-10-99   5:33p      2116           0  NPOS2VID.DLL
> >  5-16-97   1:09a    106711           0  nppdfos2.dll
> >  8-10-99   5:33p     83048           0  NPPROXY.DLL
> >  8-21-99   6:08p      3158          61  NPRA16.DLL
> >  8-21-99   6:08p      3158          61  Npswf16.dll
> >  8-10-99   5:34p     93752          61  XLATE.DLL
> >        15 file(s)     634181 bytes used
> >                    828355584 bytes free
> > 
> > Notice the different sizes of np16dsw.dll,npra16.dll, and npswf16.dll in
the
> > two directories. When Netscape wasn't recognizing the plugins, the
relevant
> > files in e:\netscape\program\plugins were exactly the same as in 
> > E:\NETSCAPE\PROGRAM\WIN16\PLUGINS. I then deleted the three files in
> > e:\netscape\program\plugins and presto the plugins were recognized and
> > Netscape recreated the files each 3158 bytes long.
> > 
> > I hope what worked for me can be of some help to you.
> 
> I have been struggling with this for days. I did the above, applied 
> the August FixPack and....it works!!!
> 
> THANKS TED!
> 
> -- 
> Bob Eager
> rde at tavi.co.uk
> PC Server 325; PS/2s 8595*3, 9595*3 (2*P60 + P90), 8535, 8570, 9556*2,
> 8580*6,
> 8557*2, 8550, 9577, 8530, P70, PC/AT..

[[[ James Himmelman - jhimmel@i-2000.com ]]]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  08-Sep-99 19:01:16
  To: All                                               09-Sep-99 05:38:02
Subj: Re: FP11 and the little archive bit problem in directory entries

From: Chuck McKinnis <mckinnis@ibm.net>

The quick and dirty Rexx routine had a couple of quick and dirty coding
errors.  Think all is well now if you go to
http://www.os2ss.com/users/mckinnis

Randy Petersen wrote:
> 
> Chuck, If you run 'dirfix all test' it doesn't pickup HPFS formatted drives.
> 
> /*----------------------------------------------------------------------*
>   Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
>   Please also email replies to: Randy Petersen <rpeterse@ix.netcom.com>
>   Now Very Happily Warping along with Warp 3.0 Connect at fixpack #40.
>   SPAMMERS don't bother me, I direct them to the void at /dev/nul.
> *----------------------------------------------------------------------*/
> 
> In <37D3FA2F.F12A5D10@ibm.net>, on 09/06/99
>    at 11:30 AM, Chuck McKinnis <mckinnis@ibm.net> said:
> 
> >Sorry, had a minor problem parsing the argument in dirfix.
> 
> /*
> dirfix.cmd - reset archive attribute on directories
> Copyright 1999 by Chuck McKinnis,  Sandia Park, NM (USA)
> mckinnis@ibm.net
> */
> 
> Trace 'N'
> 
> Parse Upper Arg drives test .
> 
> If drives = 'TEST' Then
>    Parse Upper Arg test drives .
> 
> If Abbrev(test, 'TEST') Then
>    test = 1
> Else
>    test = 0
> 
> If drives = '' Then
>    Do
>       Say 'Report on and reset directory entries'
>       Say '   that have the archive bit set on'
>       Say ''
>       Say 'Usage - dirfix x: | all [test]'
>       Say '   test - just report the findings'
>       Return
>    End
> 
> Call Setup
> 
> If drives = 'ALL' Then
>    drives = SysDriveMap(, 'LOCAL')
> Else
>    If Lastpos(':', drives) <> Length(drives) Then
>       drives = drives || ':'
> 
> tst_attrib = '++***'
> chg_attrib = '-****'
> 
> if test Then
>    chg_attrib = '*****'
> 
> Do i = 1 To Words(drives)
>    Parse Value SysDriveInfo(Word(drives, i)) With drive free total .
>    If free = total | free = '' | free = 0 Then
>       Iterate i
>    drive = drive || '\'
>    rc = SysFileTree(drive, 'dirs.', 'DSO', tst_attrib, chg_attrib)
>    If dirs.0 > 0 Then
>       Do i = 1 To dirs.0
>          Say 'Archive bit set on in' dirs.i
>       End
>    Else
>       Say 'No archive bits found set in directories on' drive
>    If \test Then
>       Do
>          If dirs.0 = 1 Then
>             Say dirs.0 'directory cleared on' drive
>          Else
>             Say dirs.0 'directories cleared on' drive
>       End
> End
> Call Cleanup
> Return
> 
> Cleanup:
>  Procedure Expose sysfuncs.
>  Do i = 1 To sysfuncs.0
>     If sysfuncs.i <> '' Then
>        Call RxFuncDrop(sysfuncs.i)
>  End
>  Return
> 
> Setup:
>  Procedure Expose sysfuncs.
>  sysfuncs.1 = 'SysFileTree'
>  sysfuncs.2 = 'SysDriveMap'
>  sysfuncs.3 = 'SysDriveInfo'
>  sysfuncs.0 = 3
>  Do i = 1 To sysfuncs.0
>     If RxFuncQuery(sysfuncs.i) Then
>        Call RxFuncAdd sysfuncs.i, 'RexxUtil', sysfuncs.i
>     Else
>        sysfuncs.i = ''
>  End
>  Return

-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: dickey@shell.clark.net                            09-Sep-99 01:01:02
  To: All                                               09-Sep-99 10:27:18
Subj: Re: lynx and wget

From: "T.E.Dickey" <dickey@shell.clark.net>

Jan Danielsson <Jan.Danielsson@falun.mail.telia.com> wrote:
> Hello!

> I decided that sometimes it takes too long time to fire up Netscape when I
> want to download a small file, so I installed Lynx.

> Apart from it crashing all the time (Netscape never crashes), I have managed

did you compile it yourself, or download a binary?

(I rarely see lynx crash except when I'm modifying it ;-)

-- 
Thomas E. Dickey
dickey@clark.net
http://www.clark.net/pub/dickey

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Clark Internet Services, Inc., Ellicott City, MD 
(1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          09-Sep-99 01:55:08
  To: All                                               09-Sep-99 10:27:18
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 8 Sep 1999 23:20:23, jhimmel@i-2000.com (James Himmelman) a crit 
dans un message:

> On Wed, 8 Sep 1999 09:42:53, Bob Germer <bobg@pics.com> 
> wrote:
> > I read and understood "Buddy's" message. He claims the screen goes off his
> > monitor.
> 
> You may have read it, but you didn't understand it. He never said the 
> screen goes off his monitor. He was saying that the text flows past 
> the dividers that can not be adjusted. He didn't use the best wording,

Ouch.

> but it was obvious that he was referring to the text getting cut off 
> by fields that are not large enough to contain the full string, and 
> the inability to adjust the field size.

That was both my point, and my perception of the originator's complaint in 
that area.

> 
> I use and love MR/2 ICE. I am not bothered by the above mentioned 
> "limitation", but I can see how some people might be.
> 
> I DO take exception to his comment that this feels like an "early 
> beta". EARLY BETA??? This app NEVER fails me. NEVER! It's one of my 
> favorite pieces of shareware. It was a stupid comment.

Things got merged, somewhere. That wasn't me who said that, but the 
originator, although *I* understood where he was coming from. MR2 is 
(still, after all these years) a little rougher to get up and going, 
especially without useful online HELP, than most current programs. I still 
find the Settings pages to be illogical and unfinished, and can see how a 
newcomer would be feeling puny and inadequate to the task of running MR2 
"like Mike".

And MR2 does fail me, often. If I reindex a folder, my "Sort by Date" that 
puts the last in/out item at the top always gets screwed up. And MR2 does 
not like to have part of your articles Zipped in packages and part in 
individual articles, although zipping saves a lot of space.

I've often wondered why more apps didn't automatically use zip containers 
for stuff like this. The system overhead of zipping/unzipping time, even 
for a multiple Move to another folder, can't be all that devastating these 
days.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: bradshaw@uu.net                                   08-Sep-99 22:12:08
  To: All                                               09-Sep-99 10:27:18
Subj: Insufficient Stack space in NC/2 4.04 and NC/2 4.61

From: bradshaw@uu.net (Nyarlathotep)

  Communicator just recently started bailing out every page it opened with
the error message "insufficient stack space". Now I now what this means in
theory, but does anyone have an idea of why this happened? And how can I
fix this. The only change recently to my system has been from an old S3
card to a Matrox G200. Every other app seems to work fine, even Star
Office and XFree86.


Warp 4 Fixpack 10
128MB SDRAM
Matrox G200 8MB AGP

John Midtgard

reply to: midtgard(AT)atlantic.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dmcbride@no.tower.spam.to.org                     09-Sep-99 02:43:11
  To: All                                               09-Sep-99 12:44:11
Subj: Re: OS/2 DB2 Fixpack 8200?

From: "Darin McBride" <dmcbride@no.tower.spam.to.org>

On 7 Sep 1999 18:28:17 GMT, Will Rose wrote:

>I've been running DB2/2 2.1.2 FP 8120 for some time, and tried upgrading
>to 8200 recently; that broke the Database Director, which fails
>with a helpful message, for once; it can't find a resource in a DLL.
>This is on Warp Connect, FP 40 and the DB2 Single-User edition; has
>anyone seen this problem or anything like it?  Does anyone know the
>difference between 8190 and 8200?  They are both still available.

What was it that you were looking to get fixed in 8200 that wasn't fixed in
8190?  If you aren't having problems, you probably shouldn't apply a fixpak.

That said, you probably should give serious thought to upgrading to v5 or v6
over the next year anyway - by the time v7 comes out, DB2 will stop being
able to migrate from v2.  Should you then want to take advantage of
functionality in v7, you will have to step through v5/v6 to get to v7 without
data or configuration loss.  (Going from SU, you would want to get Personal
Edition.)  Of course, this means that v5 and v6 *can* migrate from v2.

---
Disclaimer: unless explicitly mentioned otherwise, I do not speak,
nor have I ever spoken, for the company I work for.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: n3jja@my.address.is.my.business....               09-Sep-99 02:54:18
  To: All                                               09-Sep-99 12:44:11
Subj: Re: AOL Instant Messenger for OS/2 ????

Message sender: n3jja@my.address.is.my.business.jackoff

From: n3jja@my.address.is.my.business.jackoff (Jim Nuytens)

On Fri, 3 Sep 1999 02:15:27, dagroe-nospam@messagehost.net (Dean Groe)
wrote:

> Does this mean that you have AIM for Java running with 1.1.7? I have 
> been trying like crazy to make it fly, but no luck. I was hoping that 
> I would not have to download the 1.1.8 that is currently available. I 
> think that it is only the full JDK right now. All I need is a JVM. 
> 
> Every time I try to launch AIM Java, I get a tiny window that says log
> (login maybe?) that cannot be adjusted and in the Java screen is see 
> errors about invalid functions, or something like that. I do not have 
> it on this computer and do not have the messages written down. I just 
> assumed it was a lack of functionallity on the part of OS/2 Java 1.1.7
>  I do have other Java apps running OK. 

I installed the Java version of AIM on this system about a month ago 
and it's working just fine on Warp 4, FP11, and Java 1.1.7.



"The bureaucratic mentality is the only constant in the universe."
Dr. McCoy to Kirk / Star Trek IV:The Voyage Home

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            09-Sep-99 02:03:02
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Mousedriver for mouse w. Mousewheel

From: mike.luther@ziplog.com

In <d7zB3.10606$r5.777178@typ11.nn.bcandid.com>, areese@bestnetpc.com (A.
Willard Reese) writes:
>In message <ogfvnruiay.fhrqt61.pminews@martin> - "Martin Bartelds"
><bts@iaehv.nl>Wed, 08 Sep 1999 21:29:30 +0200 (CDT) writes:
>:>
>:>Is there an OS/2 mouse driver for some
>:>brand mouse with mousewheel ? Preferable Logitech.
>:>
>:>Martin
>:>
>Martin,
>	Yes.  I have a logitech wheel mouse that I've had working in OS2 for
>almost a year now.  As I recall, there is am IBM device driver for the
>"ScrollPoint" or the "Logitech Mouseman+" mouse. The compressed file
>is SCROLLMS.EXE. I'm not sure where I got the file but it was on one
>of the IBM driver sites.
>Willard


Will it work with the new Logitec RF mice?  The new brands are scroll
wheel mice as as well.

--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: dmcbride@no.tower.spam.to.org                     09-Sep-99 03:06:22
  To: All                                               09-Sep-99 12:44:11
Subj: Re: DB2 installation

From: "Darin McBride" <dmcbride@no.tower.spam.to.org>

On 6 Sep 1999 13:11:32 GMT, Jerry Prather wrote:

>In message
><1bMmtd7zwYPT-pn2-dRCp79ddL4fW@237.pittsburgh-03-04rs.pa.dial-acc
>ess.att.net> - SkidMARX@att.net writes:
>:>
>:>I had the same thing happen to me.  Did you by chance use lower case 
>:>characters for the name/password combo ?
>:>
>:>If so, somewhere on the IBM db2 website I found a help section where 
>:>it stated that names/passwords must be in CAPS !!!
>:>
>:>I haven't tried this fix yet myself but give it a shot and report back
>:>;-)
>
>You are absolutely correct.  When installing DB2 I did enter the
>userid and password in lower case.  I got past the login by using
>USERID and PASSWORD.  However, I've had to (try to) blow away DB2

OS/2 is case insensitive.  That is, OS/2 itself uppercases all userids and
passwords.  That sounds very fishy to me.

>and my (failed) attempts to install TCPIP - which has loused
>everything up; I can't even get InJoy to start anymore!

You already had TCP/IP installed if InJoy ever worked before!

>I'll remember your tip when I make another effort to install DB2.
>Thanks for the help!

If you manually blew away DB2, I wouldn't be surprised if it automatically
fudged up during reinstall.  (You really should use the Installation Utility
icon in your DB2 folder to uninstall - it does a proper cleanup!)

Next time, if it installs cleanly, leave it installed unless someone
(preferably DB2 service or someone from DB2) tells you to uninstall it to
reinstall.  Unless, of course, you're giving up, in which case, go right
ahead.  As long as you want to get it going, chances are that once it is
installed properly, we can do *something* to make it work.  After all, I had
DB2 v5.0 running here long before I had a local area network going... (Now I
have DB2 v6.1 installed - both Enterprise Edition and Software Developer's
Kit.)

When you get errors, either write down the error message, or, if it is GUI,
get a screen capture, or, if it is text-mode, save the output (redirect or
use the cut&paste of VIO windows).  If it is a message that starts with
"xxx#####y" where xxx is something like SQL, DBI, or some other three-letter
combination, ##### is 5 (possibly only 4) digits, and y is either E(rror),
W(arning), or I(nformational), don't forget to include this as well, as it
can help us track things down.

Basically, the install is relatively difficult to screw up.  Chances are
that, rather than you doing something wrong, your system is not set up the
way that DB2 expects it.  It's just a matter of tracking down what isn't set
up right, and setting it right.

From your message, I'm guessing the problem is in Net.Question.  (Look this
product up in deja ... I'll say no more.)  Since you have to reinstall
anyway, try not installing the documentation as well as the Control Center. 
I know, I know, these are important parts, especially when evaluating or
learning DB2.  However, just for problem diagnoses, let's just leave them
out.  If First Steps works (or whatever you're trying to use), or at least
the problems you were facing don't appear, then we've narrowed it down to
pretty much confirm what I am thinking.  Then you can reinstall - don't
bother uninstalling - and select the docs and/or the CC, if you want them.

If you can confirm this is indeed the case, come on back and we'll continue
problem determination from there.

Thanks,
---
I am currently speaking on behalf of my company.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: dmcbride@no.tower.spam.to.org                     09-Sep-99 03:10:08
  To: All                                               09-Sep-99 12:44:11
Subj: Re: DB2 v6 - having problems with userid/password

From: "Darin McBride" <dmcbride@no.tower.spam.to.org>

On 5 Sep 1999 21:25:41 GMT, Jerry Prather wrote:

>In message <37D2D58E.82588C8E@bcs.org.uk> - Tim Timmins
><tim.timmins@bcs.org.uk> writes:
>:>
>:>Did you try 'userid' and 'password' ?
>:>
>Bingo!  At least it got me past the password problem...

Go into the user account manager (while you're logged in as userid and
password) and create some new ID's.  :-)  upmaccts is the executable. 
Unfortunately, I don't recall the icon, nor its location.

After that, select one of the newly created ID's that you made into an
administrator, and type at the command prompt:

db2admin setid <username> <password>

Then login as any administrator (other than userid), and delete the userid
account.  :-)

---
Disclaimer: unless explicitly mentioned otherwise, I do not speak
for the company I work for.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             09-Sep-99 00:03:15
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Fastback Plus for os/2 and CDRW's Long story

From: Alan Beagley <abeagley@datatone.com>

Would it be "kosher" to put FastBack Plus on Hobbes? I think I have the
program
somewhere.

Alan


Gideon Singer wrote:

> On Wed, 8 Sep 1999 02:32:09, nospam@null (Richard Crane) wrote:
>
> -> Can anyone
> -> email me the Fastback Plus install disk files and the 1.0 update -
Symantec in
> -> Australia doesn't want to help, seems rough when you've bought the
license to
> -> use it ?
> ->
>
> Wish I could help with the Fastback Plus install disk, but I am
> looking for that one as well. I put mine somewhere and have not been
> able to find it. The Fastback 1.0 update is on hobbes. As for Symantec
> they will not help even here in NA. The software is no longer
> supported at any level. So If anyone sees this message and has a copy
> of Fastback Plus for OS2 install disk please zip it up and mail it to
> both of us and then put it on Hobbes as well. I use Fastback with a
> zip drive and find that it works well.
>
> ---
> Gideon Singer
> "It's A Magical World, Hobbes, Ol' Buddy... ...Let's Go Exploring !"
> Calvin's Last Words 12/31/95
> Where do you want to Warp today?
> Remove the Z to email.
> Webpage: members.home.net:80/gsinger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: n3jja@my.address.is.my.business....               09-Sep-99 04:23:28
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Swap file

Message sender: n3jja@my.address.is.my.business.jackoff

From: n3jja@my.address.is.my.business.jackoff (Jim Nuytens)

Jumping into this a bit late, but my advice is simple: more RAM.

As an experiment, I opened up Star Office ( I don't use it much) in 
addition to Netscape, PMMail/2, and ProNews/2 (which I do have open on
a regular basis). I've finally used up most of the physical RAM in the
machine and have about 10M of a 20M swap file used up.

I run Warp 4, FP11, and Java 1.1.7 on a K6-2-350 and 128M RAM.


On Wed, 1 Sep 1999 00:52:49, jpedone_no_spam@flash.net wrote:

> Hi all - hopefully someone here can give me some advice....
> 
>   I recently picked up a memory monitor program written by Jim Lewis and 
> was just playing with it (Good prog BTW) and noticed that my swap was 
> getting around 70MB when staroffice and NS were running.  Under normal
> load the machine seems to maintain about a 32MB swap and this program is
> indicated between 524K and 1MB free ram.  I initially had the swap set
> for 20MB but have since changed it to 61865K to keep it from growing.
>   Now granted, these two programs are memory hogs but does a swap of
> around 70MB seem excessive?  What are the performance ramifications of 
> this large of a swap?
> 
> 


"The bureaucratic mentality is the only constant in the universe."
Dr. McCoy to Kirk / Star Trek IV:The Voyage Home

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                09-Sep-99 04:49:26
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Fastback Plus for os/2 and CDRW's Long story

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <NymHBqo6l1K2-pn2-LL7dUd6gdX27@cr1003178-a.crdva1.bc.wave.home.com>,
gsingerzz@home.com (Gideon Singer) writes:
>On Wed, 8 Sep 1999 02:32:09, nospam@null (Richard Crane) wrote:
>
>-> Can anyone 
>-> email me the Fastback Plus install disk files and the 1.0 update -
Symantec in 
>-> Australia doesn't want to help, seems rough when you've bought the license 
to 
>-> use it ?
>-> 
>
>Wish I could help with the Fastback Plus install disk, but I am 
>looking for that one as well. I put mine somewhere and have not been 
>able to find it. The Fastback 1.0 update is on hobbes. As for Symantec
>they will not help even here in NA. The software is no longer 
>supported at any level. So If anyone sees this message and has a copy 
>of Fastback Plus for OS2 install disk please zip it up and mail it to 
>both of us and then put it on Hobbes as well. I use Fastback with a 
>zip drive and find that it works well.

   I cannot see it being released to the public domain (Hobbes),
as Symantec owns it, and I doubt that they would release it.
The developers do not have the rights to it.  That being said, I
have a (hidden) copy on my WWW site, so if you can let me
believe that you own a licence, I'll send you the URL.

baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        09-Sep-99 04:51:02
  To: All                                               09-Sep-99 12:44:11
Subj: Re: MR/2 ICE

From: dboultr@spamfree.erols.com

On Wed, 8 Sep 1999 23:20:23, jhimmel@i-2000.com (James Himmelman) 
wrote:

> I DO take exception to his comment that this feels like an "early 
> beta". EARLY BETA??? This app NEVER fails me. NEVER! It's one of my 
> favorite pieces of shareware. It was a stupid comment.

Then it's my stupid comment, not Buddy's.  That was from MY original 
message.  He never said it.

I've been testing OS/2 beta software since version 2.0 in what, 1991? 
Perhaps I should have said "looks like" instead of "feels like."  
Especially since after a week or so of testing, nothing has crashed.

But the facts of no help, the appearance problem, a tab which, when 
clicked on, does nothing, and other little things make it seem like an
early beta to me.  YMMV.  I'm not trying to dissuade anyone from using
the program.  It does some things better than PRM, and some things it 
does worse.

Thanks to all the ICE users who, either here or in e-mail, answered 
questions and attempted to help.  Buddy was foremost in that group.  
To flame him as insufficiently loyal is a sick joke.  He sent me three
e-mails answering questions and attempting to convince me that ICE was
the best thing going.

I'm saddened that we OS/2 users are at the point of riding each other 
out of town on a rail over a mail reader.  We used to be proud of the 
fact that OS/2 had the three best mail readers going.  We were proud 
that the three were sufficiently different that each person could 
choose based on personal preference.  Now we insult each other because
of those preferences.  If your OS/2 box isn't exactly  like mine, you 
must be an idiot.  

Here's a clue for the loud-mouthed assholes.  I've made my own 
decisions about what OS/2 software to use (and support - I run no 
unlicensed shareware here) for eight years.  I'm fairly confident that
there will be plenty of other OS/2 users around to answer questions 
and provide help, as there have always been with this operating 
system.  It's only when THOSE people go away that OS/2 has no future. 
The flamers just go in my killfile.

Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        09-Sep-99 04:54:29
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: dboultr@spamfree.erols.com

On Wed, 8 Sep 1999 00:29:42, raphaelt@netnews.worldnet.att.net 
(Raphael Tennenbaum) wrote:

> I spent a half hour on it and it's awfully impressive --
> everything I wanted to tweak, I could (that is, considering
> it's java and not native OS/2).  It's as good as I'd heard. 
> And I'm sure when I actually read the docs I'll be able to
> figure how to change the font in the composing screen.

Is there a conversion utility for address books and folders from PRM? 
My problem is that I have quite a bit of stuff from PRM that I can't 
afford to lose in a changeover.  

Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                09-Sep-99 05:00:09
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Swap file

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <7r7cos$e6j$0@216.155.32.224>, n3jja@my.address.is.my.business.jackoff (Jim 
Nuytens) writes:
>Jumping into this a bit late, but my advice is simple: more RAM.

   Yeah, but I just upgraded from 64 MeB to 128 MeB RAM, and a
day later I got a black screen stating my swapper partition (100
MeB) was full.  It surprised me, but I guess that Netscape with
Java and WebExplorer like the extra virtual memory.  I think
that when a system only has 16 MeB RAM, by the time the
SWAPPER.DAT file is over 80 MeB, you notice a definite
performance degradation due to memory management.  However, with
128 MeB RAM, the memory management is not noticed, and the
swapper can easily be all used up.

>As an experiment, I opened up Star Office ( I don't use it much) in 
>addition to Netscape, PMMail/2, and ProNews/2 (which I do have open on
>a regular basis). I've finally used up most of the physical RAM in the
>machine and have about 10M of a 20M swap file used up.
>
>I run Warp 4, FP11, and Java 1.1.7 on a K6-2-350 and 128M RAM.
>
>
>On Wed, 1 Sep 1999 00:52:49, jpedone_no_spam@flash.net wrote:
>
>> Hi all - hopefully someone here can give me some advice....
>> 
>>   I recently picked up a memory monitor program written by Jim Lewis and 
>> was just playing with it (Good prog BTW) and noticed that my swap was 
>> getting around 70MB when staroffice and NS were running.  Under normal
>> load the machine seems to maintain about a 32MB swap and this program is
>> indicated between 524K and 1MB free ram.  I initially had the swap set
>> for 20MB but have since changed it to 61865K to keep it from growing.
>>   Now granted, these two programs are memory hogs but does a swap of
>> around 70MB seem excessive?  What are the performance ramifications of 
>> this large of a swap?
>> 
>> 
>
>
>"The bureaucratic mentality is the only constant in the universe."
>Dr. McCoy to Kirk / Star Trek IV:The Voyage Home


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 09-Sep-99 05:14:12
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Swap file

From: hamei@pacbell.net

In <7r7cos$e6j$0@216.155.32.224>, n3jja@my.address.is.my.business.jackoff (Jim 
Nuytens) writes:
>Jumping into this a bit late, but my advice is simple: more RAM.
>
>As an experiment, I opened up Star Office ( I don't use it much) in 
>addition to Netscape, PMMail/2, and ProNews/2 (which I do have open on
>a regular basis). I've finally used up most of the physical RAM in the
>machine and have about 10M of a 20M swap file used up.
>
>I run Warp 4, FP11, and Java 1.1.7 on a K6-2-350 and 128M RAM.
>


No StarOffice here, but with 128 M Ram and an initial swap size of 2 meg,
the swapper almost *never* grows until I open Netscape. Even HotJava
doesn't make it grow like Netscape. And the graphics are turned off !
What a kluge.

----------------------------------------------------------
Hrad ngravvrd
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     09-Sep-99 04:07:03
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Insufficient Stack space in NC/2 4.04 and NC/2 4.61

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

Nyarlathotep wrote:

>   Communicator just recently started bailing out every page it opened with
> the error message "insufficient stack space". Now I now what this means in
> theory, but does anyone have an idea of why this happened? And how can I
> fix this. The only change recently to my system has been from an old S3
> card to a Matrox G200. Every other app seems to work fine, even Star
> Office and XFree86.

Did you get the latest version of the Matrox video driver?  Is it
reporting the failure in a DLL file with "MGA" in the name?  Are
you running at 24-bit or 32-bit color?

Jeffrey S. Kobal
IBM Corporation
Netscape Communicator for OS/2 - Development Team


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: horseman@ibm.net                                  08-Sep-99 19:00:23
  To: All                                               09-Sep-99 12:44:12
Subj: Re: JStreet Mailer: Who, What, Where & How

From: Tony Wright <horseman@ibm.net>

Tim Martin wrote:

> Stan Goodman wrote:
>
> > I tried to subscribe to this list as soon as I saw Tim's posting. Two
> > minutes later, I received a note from the list asking that I confirm the
> > subscription. Two minutes after that, it turned out that the reason the
> > list needed this confirmation was so that it could inform me that the list
> > already had its maximum permissible number of subscribers. Way to go,
> > fellas.
>
> I know there was some discussion of resticting the mail list
> for various reasons.  Do not feel slighted or angry because
> you can't get on.  There is a purpose to all the madness.
>
> The developers may want to keep the number of subscribers
> on a manageable level.  As a web master who also restricts the
> number of members who have access to our services (free
> tech support) it is very difficult to make everyone happy or
> to meet all the requests for help that come in.  I can sometimes
> get so bogged down from 'help me' requests that the Warp City
> site suffers, updates cannot be accomplished, other members
> requests cannot be fulfilled.  And as with all free things, there are
> those who need a lot of step-by-step hand holding or personalized
> assistance.  All of that is time consuming and takes focus away
> from the JSM updating work.  The JStreet Band developers are releasing
> updates that are considered solid Betas.  You know people, the
> minute an update causes a problem some folks go completely
> berserk and trash the work, flame the developers and end up
> generating a bunch of negativity.

What a nice,courteous and thoughtful reply for a change......A real
pleasure to read.......

Of course if a certain other ISV had been developing JStreet mailer then
perhaps one might be excused for expecting someone in particular to go
*berserk* with some very *negative* *flames* in an attempt to *trash*
their efforts? Strange 'ol world........

...but do PLEASE keep up the *CONSTRUCTIVE* work....

--
Rgds Tony W   Email: horseman@ibm.net

"humanum est errare: To err is human
.... and to fail is to be a Project Manager...
...but to foul things up completely needs a computer!"


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Equi-Tek CompCon (1:109/42)

+----------------------------------------------------------------------------+

From: jan.hartman@fil.lu.se                             08-Sep-99 15:41:08
  To: All                                               09-Sep-99 12:44:12
Subj: Re: Question about quality of pdf-files from ghostscript

From: "Jan Hartman" <jan.hartman@fil.lu.se>

Hi Buddy!

On Tue, 07 Sep 1999 02:06:14 GMT, Buddy Donnelly wrote:

>On Mon, 6 Sep 1999 12:20:05, "Jan Hartman" <jan.hartman@fil.lu.se> a  crit 
>dans un message:
>
>> In the process of sending a manuscript for a book to a publisher,
>> I was told that they wanted a pdf-file, not a postscript file as I
>> earlier was led to believe. However, even though I can create a postscript
>> file which is 1200x1200 dpi, I can only get ghostview/script to make a
>> pdf-file which is 300x300 dpi. This is not good enough. Any ideas
>> about how to make a highquality pdf-file?
>
>This is quite strange, and you should find out how they plan to use the PDF
>file. 
>
>1200x1200dpi is beyond "high" quality at your stage of the publishing 
>process, and I would think they want to be able to send it directly to a 
>filmsetter if they're calling for that spec.

Yes, that is probably the plan.

>But that's not the way publishers normally work, because they like to edit 
>and add their own stuff first, as well as adjust layout, composition, 
>typography, etc., and it's not that easy making such changes to PDF files 
>themselves.

Well, actually I do not want them to do anything with my text. I do
my type-
setting myself, and my output from DeScribe is better than what they
get
from their FrameMaker.

>If you determine that they still want to be able to do editing, I'd offer 
>them a PS file, which you can make with any Postscript printer driver 
>printing to file. Or one of the other WP formats, which are much more 
>editable.

I have asked them about a .ps file again, and hopefully they
reconsider.

>
>But, the short answer is No. Right now GSView is limited to 300x300 for the
>pdf printer driver. DeScribe printing to PS imported to GSView and printing
>to PDF makes some very nice files, and they are completely readable no 
>matter what they are printed on later. You could always scan printed pages 
>at 1200dpi into a multipage format and convert *those* to PDF via GSView, I
>guess.
>

Well I edited printer.ini in the \gstools\gsview directory. I changed
pdfwrite=72,300 to pdfwrite=300,600,1200, and after running configure
from GSView, I could make pdf-files with those better resolutions.
So, it seems this solved the problem. Still have to send a pdf-file
to the
publishing company, and see if it works.

>Good luck,
>
>Buddy

Thanks,

/ Jan

===================================================
Jan Hartman
Filosofiska institutionen/Department of Philosophy
Lunds Universitet/Lund University                                       
Kungshuset, Lundagrd                                  +46-(0)46 2223253
S-222 22 Lund                                              fax +46-(0)46
2224424
Sweden
E-mail: Jan.Hartman@fil.lu.se


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Lund University (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          09-Sep-99 08:47:18
  To: All                                               09-Sep-99 15:49:20
Subj: Re: Question about quality of pdf-files from ghostscript

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 8 Sep 1999 13:41:16, "Jan Hartman" <jan.hartman@fil.lu.se> a crit 
dans un message:

> Hi Buddy!

Yo.

> >
> >1200x1200dpi is beyond "high" quality at your stage of the publishing 
> >process, and I would think they want to be able to send it directly to a 
> >filmsetter if they're calling for that spec.
> 
> Yes, that is probably the plan.

You can always print out, then scan back in at a high res, then print these
directly to PS files that can be converted to PS. I don't think the actual 
quality would be as good, but the "numerical" values would meet their 
requisites.


> 
> >But that's not the way publishers normally work, because they like to edit 
> >and add their own stuff first, as well as adjust layout, composition, 
> >typography, etc., and it's not that easy making such changes to PDF files 
> >themselves.
> 
> Well, actually I do not want them to do anything with my text. 

No writer wants them to edit it. But they seldom let you have control over 
the layout, typography, etc.


> I do
> my type-
> setting myself, and my output from DeScribe is better than what they
> get
> from their FrameMaker.

Yes, I've made excellent-looking output from DeScribe. I seldom go into Win
to use Framemaker or anything else over there.

> 
> >
> >But, the short answer is No. Right now GSView is limited to 300x300 for the
> >pdf printer driver. DeScribe printing to PS imported to GSView and printing
> >to PDF makes some very nice files, and they are completely readable no 
> >matter what they are printed on later. You could always scan printed pages 
> >at 1200dpi into a multipage format and convert *those* to PDF via GSView, I
> >guess.
> >
> 
> Well I edited printer.ini in the \gstools\gsview directory. I changed
> pdfwriter,300 to pdfwrite00,600,1200, and after running configure
> from GSView, I could make pdf-files with those better resolutions.
> So, it seems this solved the problem. Still have to send a pdf-file
> to the
> publishing company, and see if it works.

Good thinking. Let us know how it turns out. 

I remember playing with that 300 setting last year, somehow, and couldn't 
get it to make valid 600x600 PDFs, but I didn't know what I was doing so I 
probably messed it up myself.


And there was another reply in this thread yesterday that enclosed a 
command line to force the conversion, but I haven't tried it.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          09-Sep-99 08:53:14
  To: All                                               09-Sep-99 15:49:20
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Thu, 9 Sep 1999 04:54:58, dboultr@spamfree.erols.com a crit dans un 
message:

> On Wed, 8 Sep 1999 00:29:42, raphaelt@netnews.worldnet.att.net 
> (Raphael Tennenbaum) wrote:
> 
> > I spent a half hour on it and it's awfully impressive --
> > everything I wanted to tweak, I could (that is, considering
> > it's java and not native OS/2).  It's as good as I'd heard. 
> > And I'm sure when I actually read the docs I'll be able to
> > figure how to change the font in the composing screen.
> 
> Is there a conversion utility for address books and folders from PRM? 
> My problem is that I have quite a bit of stuff from PRM that I can't 
> afford to lose in a changeover.  

http://cartman.secant.com/nick/prmconv.zip

Use MR2's HELP pulldown to quickly jump to the Home Page via a brower, then
drill to the bottom of the page for a listing of very useful links. That's 
where I found this.

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: Jan.Danielsson@falun.mail.telia.com               09-Sep-99 10:08:02
  To: All                                               09-Sep-99 15:49:21
Subj: Re: lynx and wget

From: "Jan Danielsson" <Jan.Danielsson@falun.mail.telia.com>

>> I decided that sometimes it takes too long time to fire up Netscape when I
>> want to download a small file, so I installed Lynx.
>
>> Apart from it crashing all the time (Netscape never crashes), I have
managed
>
>did you compile it yourself, or download a binary?

I downloaded a binary. However, I have noticed that it doesn't crash
randomly. I know what I can do and what I should stay away from. I don't
think fixing the bugs would be a big problem.

>(I rarely see lynx crash except when I'm modifying it ;-)

:-)

I doubt that there is a VisualAge C++ ready source out there, and I seem ti
be the one person the face of the earth that doesn't like gnu-stuff
(especially the compilers).... So....


 /j



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telia Internet (1:109/42)

+----------------------------------------------------------------------------+

From: groarg@my-deja.com                                09-Sep-99 10:50:25
  To: All                                               09-Sep-99 15:49:21
Subj: this is how it might work (Re: PalmPilot and StarOffice)

From: groarg@my-deja.com

In article
<37d276b4$1$sebqbwee$mr2ice@nntp.interaccess.com>,
  postmaster@[127.0.0.1] wrote:
> In <19990905.8414093@mis.configured.host>, on
09/05/99
>    at 08:41 AM, Brian Goodyear <bgoody@ibm.net>
said:
>
> >Did anyone figure out how to syncronize the
PalmPilot Addressbook
> >categories with the StarOffice addressbook?
There doesn't seem to be  any
> >equivalent of these categories in the
StarOffice addressbook. Thanks,
> >Brian
>
> I'm careful with the SO/PalmPilot integration.
The last time I
> synchronized them, SO erased my categories in
the PalmPilot.  I didn't lose
> any data, but the categories went back to the
originals.
>

It seems that you have to do some configuration
before pressing the HotSync-Button...
There is actually a dialog where you can tell
StarSync what to do with the categories:
(using win95) this is how I think it works:
- install the starsync.prc (There should be a
program called HotSync Installation Tool in the
PalmPilot Program Files menu; starsync.prc is in
/StarOffice51/palmpilot directory)
- do 1 single (and I mean it: only one) HotSync to
copy the starsync.prc onto the pilot
- right click on the little hotsync button in the
Windows-Task-Bar and select "Personalisation..",
"Configuration..." (or something like that, it is
not "Setup..." though; I only have the german
version there it says "Benutzerdefiniert..." ;)
- in the list you should now have the option
"StarSync" wich you can modifiy with one of the
buttons on the right.
- try defining what you want him to do with the
categories there

the only problem I have now: I dont have any
categories left, so I coulndn't try if it works

tell us if someone gets it to work without erasing
anything.

roadrunner




Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: dontgivemymail@excite.com                         09-Sep-99 10:58:10
  To: All                                               09-Sep-99 15:49:21
Subj: how it might work (Re: PalmPilot and StarOffice)

From: dontgivemymail@excite.com

In article <37d276b4$1$sebqbwee$mr2ice@nntp.interaccess.com>,
  postmaster@[127.0.0.1] wrote:
> In <19990905.8414093@mis.configured.host>, on 09/05/99
>    at 08:41 AM, Brian Goodyear <bgoody@ibm.net> said:
>
> >Did anyone figure out how to syncronize the PalmPilot Addressbook
> >categories with the StarOffice addressbook?  There doesn't seem to be
 any
> >equivalent of these categories in the StarOffice addressbook. Thanks,
> >Brian
>
> I'm careful with the SO/PalmPilot integration.  The last time I
> synchronized them, SO erased my categories in the PalmPilot.  I didn't
lose
> any data, but the categories went back to the originals.
>

I know I dont belong here, but this is how I got it to work with win95,
and it might be similar for os2

It seems that you have to do some configuration
before pressing the HotSync-Button...
There is actually a dialog where you can tell
StarSync what to do with the categories:
using win95 this is how I think it works:

- install the starsync.prc (There should be a
program called HotSync Installation Tool in the
PalmPilot Program Files menu; starsync.prc is in
/StarOffice51/palmpilot directory)

- do 1 single (and I mean it: only one) HotSync to
copy the starsync.prc onto the pilot

- right click on the little hotsync button in the
Windows-Task-Bar (well, try the equivalent for os2)
and select "Personalisation..",
"Configuration..." (or something like that, it is
not "Setup..." though; I only have the german
version there it says "Benutzerdefiniert..." ;)

- in the list you should now have the option
"StarSync" wich you can modifiy with one of the
buttons on the right.

- try defining what you want him to do with the
categories there

the only problem I have now: I dont have any
categories left, so I coulndn't try if it works

if someone gets it to work without erasing
anything: I'm interested ;)


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           09-Sep-99 06:12:23
  To: All                                               09-Sep-99 15:49:21
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <Z8vLRdP7nz3N-pn2-RQzVCXTT0MCY@yourmachine.yourlocaldomain.yourisp>, on
09/08/99 at 09:09 PM,
   donnelly@tampabay.rr.com (Buddy Donnelly) said:


> Thanks for getting it. I make no apologies for mixing Irony into such 
> things.

Irony hell! You fail to address the first quote where you virtually accuse
Nick of fraud. 

YOU wrote it. I have it on tape, on disk, and on paper. And you will
forever be on the shit list wherever I see you.

Here for the record is what YOU wrote:

> Heh. Must be a new concept in Shareware. The 
> Share-or-Die-Die-Die-you-scumbucket-bastard-Ware concept. 

> Marketing attitude enhanced by Idi Amin?  Or Micro$oft. Or the Internal 
> Revenue Service.

That's not irony, you idiot. That's slander at BEST.


--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           09-Sep-99 06:22:14
  To: All                                               09-Sep-99 15:49:21
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <Z8vLRdP7nz3N-pn2-smjdFTshDesn@yourmachine.yourlocaldomain.yourisp>, on
09/08/99 at 08:59 PM,
   donnelly@tampabay.rr.com (Buddy Donnelly) said:

> > 
> >  Moreover, he is posting here with Win9x software which we
> >  all know won't run under OS/2.

> Interesting supposition there. Based on Zero Evidence. And totally 
> incorrect, I can say.

You claim elsewhere to be an ICE user. But your headers show you are not
using ICE to post here. For the record, here is a portion of the header of
the message I am replying to here.

X-Newsreader: Your Internet Banner Ad Here!
MIME-Version: 1.0
Content-Type: text/plain; charset="us-ascii"
Content-Transfer-Encoding: 8bit

That is Win95 crap. If you were using ICE, Ice would be listed as the
Newsreader.

Again, you are proved a worthless liar.



--
-------------------------------------------------------------------------=
---------------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------=
---------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           09-Sep-99 06:27:01
  To: All                                               09-Sep-99 15:49:21
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <Z8vLRdP7nz3N-pn2-RFhyOE23EOIi@yourmachine.yourlocaldomain.yourisp>, on
09/08/99 at 08:55 PM,
   donnelly@tampabay.rr.com (Buddy Donnelly) said:

> > 
> > =>Idiots like Buddy Donnelly <spelling?> deserve to be castrated, drawn,
> > =>quartered, and have their heads stuck up on poles.

> Hm. It sounds like you gave that Sequence Of Operations good solid
> thought.

For your information, since you obviously never had any history classes,
for several centuries in England the standard method of execution for
treason was to be hanged until nearly dead, then revived, castrated, the
genitals placed in your mouth, then drawn (sliced open) your intestines
ripped out while you were still conscious, beheaded, and the rest of the
body quartered. The head was placed on poles to rot as a warning to others
in London. The four parts were sent to various parts of the country where
your actions were known and put on poles.

--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           09-Sep-99 06:31:09
  To: All                                               09-Sep-99 15:49:21
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <990908172542.83162M-100000@bisv3.bedford.waii.com>, on 09/08/99 at
05:33 PM,
   Steve Drewell <bd83h@bedford.waii.com> said:

> On Wed, 8 Sep 1999, Bob Germer wrote:

>  Moreover, he is posting here with Win9x software which we  all know
> won't run under OS/2.

> So what? I'm posting here using Pine running on AIX. Does that make me a
> bad person? Does that mean I don't love and use OS/2 or MR/2 ICE?

You don't claim to be using ICE. Donnelly does.



--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dcurren@ibm.net                                   09-Sep-99 05:36:28
  To: All                                               09-Sep-99 15:49:21
Subj: Re: JStreet Mailer: Who, What, Where & How

From: "Dale Curren" <dcurren@ibm.net>

On Wed, 08 Sep 1999 19:00:46 +0100, Tony Wright wrote:

Paul VanKeep just increased the number of members to 200.  Try again.

>> Stan Goodman wrote:
>>
>> > I tried to subscribe to this list as soon as I saw Tim's posting. Two
>> > minutes later, I received a note from the list asking that I confirm the
>> > subscription. Two minutes after that, it turned out that the reason the
>> > list needed this confirmation was so that it could inform me that the
list
>> > already had its maximum permissible number of subscribers. Way to go,
>> > fellas.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: nolospamoawmg@yesic.com                           09-Sep-99 08:04:07
  To: All                                               09-Sep-99 15:49:21
Subj: Re: MR/2 ICE

From: "andrew g" <nolospamoawmg@yesic.com>

On Thu, 09 Sep 1999 06:27:02 -0400, Bob Germer wrote:

> The head was placed on poles to rot as a warning to others
>in London. The four parts were sent to various parts of the country where
>your actions were known and put on poles.

Geez. I feel sorry for those poor Poles.

andrew


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Introits and Graduals (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  09-Sep-99 12:20:28
  To: All                                               09-Sep-99 15:49:21
Subj: Re: DB2 v6 - having problems with userid/password

From: prather@infi.net (Jerry Prather)

In message
<qzpoevqrgbjregbbet.fhrvh33.pminews@news.mtag1.on.wave.home.com>
- "Darin McBride" <dmcbride@no.tower.spam.to.org> writes:
:>Go into the user account manager (while you're logged in as userid and
:>password) and create some new ID's.  :-)  upmaccts is the executable. 
:>Unfortunately, I don't recall the icon, nor its location.
:>
:>After that, select one of the newly created ID's that you made into an
:>administrator, and type at the command prompt:
:>
:>db2admin setid <username> <password>
:>
:>Then login as any administrator (other than userid), and delete the userid
:>account.  :-)

Thanks for the input.  I've got a lot to learn about DB2 <G>.


Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: mpajoh@odot.org                                   09-Sep-99 07:20:02
  To: All                                               09-Sep-99 15:49:21
Subj: StarOffice Unlock Code?

From: Masoud Pajoh <mpajoh@odot.org>

Hi All;
I recently bought a CD which among other thing also has SO5.1 on it.
I went to the Star Office site to register to get the unlock code.
The only place I found to do that was when I tried to download, I was
asked to
register.  After doing that I got a page which obviously had a blank
spot 
that should have had the registration number.  The message below it said
something
to the effect that "If you are trying a product no registration is
necessary."

What am I doing wrong?  Where do I get this unlock Code?

Thanks
Masoud

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Oklahoma (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  09-Sep-99 12:26:05
  To: All                                               09-Sep-99 15:49:21
Subj: Re: DB2 installation

From: prather@infi.net (Jerry Prather)

In message
<qzpoevqrgbjregbbet.fhrvb72.pminews@news.mtag1.on.wave.home.com>
- "Darin McBride" <dmcbride@no.tower.spam.to.org> writes:
:>
:>On 6 Sep 1999 13:11:32 GMT, Jerry Prather wrote:
:>
Thanks much for the detailed input.  I've restored my D partition
from backup and seem to have everything back at ground zero
again, so it's about time to try the install again.  I will take
your advice.


Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: luistino@my-deja.com                              09-Sep-99 13:12:19
  To: All                                               09-Sep-99 15:49:21
Subj: Re: Fastback Plus for os/2 and CDRW's Long story

From: luistino <luistino@my-deja.com>

Baden Kudrenecky wrote:
> 
> In <NymHBqo6l1K2-pn2-LL7dUd6gdX27@cr1003178-a.crdva1.bc.wave.home.com>,
gsingerzz@home.com (Gideon Singer) writes:
> >On Wed, 8 Sep 1999 02:32:09, nospam@null (Richard Crane) wrote:
> >
> >-> Can anyone
> >-> email me the Fastback Plus install disk files and the 1.0 update -
Symantec 
> 
>    I cannot see it being released to the public domain (Hobbes),
> as Symantec owns it, and I doubt that they would release it.
> The developers do not have the rights to it.  That being said, I
> have a (hidden) copy on my WWW site, so if you can let me
> believe that you own a licence, I'll send you the URL.
> 
> baden
> 
> baden@unixg.ubc.ca
> http://baden.nu/
> OS/2, Solaris & Linux
Hi Baden

I own a company which did licence it. Now I can't find the box.I have a
whole bunch of fastback backed up manuals and no software to read them.
System crashed and that's all she wrote. A copy of the prog would be
great.

Thanks

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: domi@kenavo.NOSPAM.fi                             09-Sep-99 13:08:10
  To: All                                               09-Sep-99 15:49:21
Subj: Re: MR/2 ICE

From: domi@kenavo.NOSPAM.fi (Dominique Pivard)

On Thu, 9 Sep 1999 10:22:29, Bob Germer <bobg.REMOVEME.@pics.com> 
wrote:
> 
> You claim elsewhere to be an ICE user. But your headers show you are not
> using ICE to post here. For the record, here is a portion of the header of
> the message I am replying to here.
> 
> X-Newsreader: Your Internet Banner Ad Here!
> That is Win95 crap. If you were using ICE, Ice would be listed as the
> Newsreader.
> 
> Again, you are proved a worthless liar.

Come on, Bob, give us a break! Just because someone is using ICE (or 
is knowledgeable about it) doesn't mean he's using it always and 
exclusively. Some people can't choose their operating systems at work.
Others (me for instance) may choose to use the mail portion of ICE, 
but not its news part. Others may be familiar with several mailers and
newsreaders. So Buddy's header doesn't prove he's a liar (and 
worthless at that).

In all fairness, Buddy's contributions to comp.os.os2.* have been 
plentiful over the years (just do a search in Deja if you're not 
convinced) and (most of the time) very worthy. I for one have found 
them very beneficial. With friends like you, the OS/2 and ICE 
community certainly needs no enemy ;-)

Just my $0.02, anyway.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: fritsch@remove-this.hmi.de                        09-Sep-99 15:15:28
  To: All                                               09-Sep-99 15:49:21
Subj: Re: StarOffice Unlock Code?

From: fritsch@remove-this.hmi.de

In <37D7A5F4.7C184408@odot.org>, on 09/09/99 
   at 07:20 AM, Masoud Pajoh <mpajoh@odot.org> said:
>
>I recently bought a CD which among other thing also has SO5.1 on it. I
>went to the Star Office site to register to get the unlock code. The only
>place I found to do that was when I tried to download, I was asked to
>register.  After doing that I got a page which obviously had a blank spot
>that should have had the registration number.  The message below it said
>something
>to the effect that "If you are trying a product no registration is
>necessary."

>What am I doing wrong?  Where do I get this unlock Code?

After you got your CD Stardivision has become a part of Sun and the rules
have changed. Now the code is not locked - you can use it after you
downloaded it - or else buy a CD with the "new" code for a nominal fee.

I *think* I saw, on www.stardivision.de, a note on how to get the unlock
key for the code that had been downloaded earlier. 

Wolfgang

--
=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-
  Wolfgang Fritsch
  Bereich Theoretische Physik, HMI Berlin
  e-mail fritsch@remove-this.hmi.de      http://www.hmi.de/people/fritsch/
  tel. +49-30-8062 2318                       fax +49-30-8062 2098
  "Which is worse: ignorance or apathy?  I neither know nor care."
=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Hahn-Meitner-Institut Berlin (1:109/42)

+----------------------------------------------------------------------------+

From: rrkurtz@us.ibm.com                                09-Sep-99 08:59:04
  To: All                                               09-Sep-99 15:49:21
Subj: Re: FP11 and the little archive bit problem in directory entries

From: Dick Kurtz <rrkurtz@us.ibm.com>

Ref:     Append at 17:36:15 on 99/09/07 GMT (by domi@kenavo.NOSPAM.fi
(Dominique Pivard)

Should be available the end of the month. OS/2 fixpaks are now on a
quarterly schedile.

> When will this puppy be available? I couldn't see it in
> ftp://service.boulder.ibm.com/ps/products/os2/fixes/v4warp/english-us/

Dick Kurtz
eBusiness Development, Austin Tx.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Austin (1:109/42)

+----------------------------------------------------------------------------+

From: patrickstump@my-deja.com                          09-Sep-99 14:24:14
  To: All                                               09-Sep-99 15:49:21
Subj: Re: TouchStone PCMCIA driver ti1220 and 3com nic card

From: patrickstump@my-deja.com

Ok did that but still doesnb;t assign the 3com nic card a io address or
an IRQ.  The pcmcia controller and scokets them selves don't have io or
irq.  I have the touchstone software sspcic.sys, but I am having trouble
configuring it.  It seems to recognize the pcmcia sockets but will not
assign irq or io address.
  When the driver loads at boot it shows that it recognizes the ti
pci1220 , and says can't assign irq!!! CARDBUS.  Touchstone wants me to
ship the notebook to them for $200 an hour.  They are in germany..  I am
not that rich, so I am stuck.   PLEASE HELP ME!  Is there anyone who
knows the switches for sspcic.sys.

Thanks
Patrick



In article <pgbzcfrgpvgvrfarg.fhlyla0.pminews@news.7cities.net>,
  "Clark Tompsett" <ctompset@7cities.net> wrote:
> Use basedev=reserve.sys /mem=ca00,2000
> This must be the first line in the config.sys
>
> Clark.
>
> On Sun, 05 Sep 1999 14:37:22 GMT, patrickstump@my-deja.com wrote:
>
> :>I have the ti1220 on my dell insprion 7000.  I am trying o use a
3com
> :>3c589b nic card, but so far it will just show it as memory.  Can
anyone
> :>help me with the switches.  I also have invested serveral hours.
> :>I think I jsut need the correct switches.
> :>
> :>I have also played with the reserve.sys command.  No luck there
either.
> :>
> :>Thanks
> :>Patrick
> :>
> :>In article <37c4ce20$3$ecrgrefr$mr2ice@nntp.ix.netcom.com>,
> :>  Randy Petersen <rpeterse@ix.netcom.com> wrote:
> :>> In <gE9QtwxbB80C-pn2-YWpPtePbwJdX@localhost>, on 08/23/99
> :>>    at 10:35 AM, sznever@usa.net (Zamp) said:
> :>>
> :>> >Hi.
> :>>
> :>> >Still no way to work on my MITAC 6133 (TI1225) PCMCIA modem :(((
> :>> >Drivers correctly read during boot my chipset (TI1225) and IO
> :>address
> :>> >(3E0)
> :>> >but doesn't assign ANY memory address NOR any IRQ.
> :>> >Instead driver SS2INTEL.SYS assign memory address (D0000, lenght
> :>1000)
> :>> >according to rmview and/or Hardware Manager but doesn't assign
ANY
> :>IRQ
> :>> >and not see my modem.
> :>>
> :>> I think you need a modem card specific enabler.
> :>> IBM's PC Card Direcotr and PLAYWILL use a script to enable the
modem
> :>cards.
> :>> Not that it works for my modem card (it doesn't).
> :>>
> :>> How is their tech support?
> :>>
> :>> >I have lost many DAYS to try various configuration, but without
any
> :>> >success.
> :>>
> :>> >I'm desperate, i've paid 108DM for this driver :(((
> :>>
> :>> >PS: Someone have sent me SS2INTEL.SYS driver, but i doesn't
remember
> :>> >who is.
> :>>
> :>> If your socket services driver sees the cards inserted/removed,
then
> :>it's
> :>> most likely the correct driver to use.  You just need to get your
> :>specific
> :>> PCMCIA cards enabled (turned on/correct voltages/correct
> :>port,memory,irq,etc).
> :>>
> :>> >Thanks.
> :>>
> :>>
>
:>/*--------------------------------------------------------------------
-
> :>-*
> :>>   Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on
OS/2
> :>>   Please also email replies to: Randy Petersen
> :><rpeterse@ix.netcom.com>
> :>>   Now Very Happily Warping along with Warp 3.0 Connect at fixpack
> :>#40.
> :>>   SPAMMERS don't bother me, I direct them to the void at /dev/nul.
> :>>
>
:>*---------------------------------------------------------------------
-
> :>*/
> :>>
> :>
> :>
> :>Sent via Deja.com http://www.deja.com/
> :>Share what you know. Learn what you don't.
>
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: nospam@sancoatjpsdotnet.void                      09-Sep-99 08:21:17
  To: All                                               09-Sep-99 17:03:10
Subj: Re: MR/2 ICE

From: nospam@sancoatjpsdotnet.void (Sander Nyman)

Bob, QUICK.  Get back on your meds.  Welcome to my kill file. 

Sander Nyman 

On 09/08/99 at 05:42 AM, Bob Germer <bobg.REMOVEME.@pics.com> said:

>On <990907142523.31276E-100000@bisv3.bedford.waii.com>, on 09/07/99 at
>02:43 PM,
>   Steve Drewell <bd83h@bedford.waii.com> said:

>>  Anyone who makes such assinine claims must have one totally farkled
>> system  and lack the ability to properly install/operate a computer.
>> Why don't you  get your system fixed. No one else has the problems you
>> claim with ICE  running off the screen, etc.
>>  
>>  Frankly, I don't think you do either. I think you are a worthless
>> liar.

>> Bob, who rattled your cage? In defense of Buddy, it is widely known that
>> in MR/2 ICE, the vertical divider lines in the message index cannot be
>> dragged left or right and that the text of, for example, the subject
>> field is limited to what will fit between the vertical divider lines.
>> Reducing the font size will enable more text to be viewed but at the
>> expense of legibility.

>> Maybe you should have read and understood the message before jumping
>> down Buddy's throat.

>I read and understood "Buddy's" message. He claims the screen goes off
>his monitor. Worse, he slammed Nick Knight completely unfairly and
>untruthfully. Moreover, he is posting here with Win9x software which we
>all know won't run under OS/2.

>"Buddy" is a Microsoft lemming, a polite way of saying damned liar.



>--
>------------------------------------------------------------------------------
----------------
>Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
>Proudly running OS/2 Warp 4.0 w/ FixPack 8
>MR/2 Ice Registration Number 67
>Aut Pax Aut Bellum
>------------------------------------------------------------------------------
----------------

-- 
-----------------------------------------------------------
"Sander Nyman"<sanco@jps.net>
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@sover.net                                09-Sep-99 10:16:14
  To: All                                               09-Sep-99 17:03:10
Subj: Re: Question about quality of pdf-files from ghostscript

From: letoured@sover.net

>> I do my type-setting myself, and my output from DeScribe is better than
what they
>> get >> from their FrameMaker.
>Yes, I've made excellent-looking output from DeScribe. I seldom go into
>Win to use Framemaker or anything else over there.

Framemaker has some pretty good type and layout controls. I find it hard
to believe that any word processor does a better job. So I'm curious, just
what is the publisher doing that you don't like? 

BTW, if you can get Frame 5, it runs just find under Win-OS2.


_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dtander@agts.net                                  09-Sep-99 16:26:12
  To: All                                               09-Sep-99 17:03:10
Subj: Re: PMINEWS - binaries

From: dtander@agts.net (David T. Anderson)

On Wed, 8 Sep 1999 01:44:40, "andrew g" <awmg@yesic.com> wrote:

> Crickey! 
> All I want to do is fire up PMInews 
> have it get all the new articles in alt.binaries.clip-art
> decode them into graphics files
> leave them in a directory for me.
> 
> I can't believe I paid for this program if it can't even do something that
> easy!

Handling binaries is one of PMINews' s big weaknesses, IMHO.  
ProNews/2 will do what you want with just a little configuration and a
few mouseclicks...you might want to give it a try... 

David T. Anderson
Calgary, Alberta
http://www.agt.net/public/dtander/

Using ProNews/2 for OS/2 Warp

**NOSPAM**  To email me, remove the 's' from my address...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dd@dandrake.com                                   09-Sep-99 17:40:26
  To: All                                               09-Sep-99 17:03:11
Subj: Re: MR/2 ICE

From: dd@dandrake.com (Dan Drake)

On Thu, 9 Sep 1999 10:12:47, Bob Germer <bobg.REMOVEME.@pics.com> wrote

nothing worth quoting, but he has really a fine return address.  Why are 
people responding to his rants (what, he wants to inherit the mantle of 
the late lamented Earl Curley?)  when they could be gratefully taking the 
advice he gives right after the bobg?

-- 
Dan Drake
dd@dandrake.com
http://www.dandrake.com/index.html

What exactly was the sin of Sodom?
Explicit details at
http://bible.gospelcom.net/bible?ezekiel+16:49

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DNAI ( Direct Network Access ) (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          09-Sep-99 17:50:29
  To: All                                               09-Sep-99 17:03:11
Subj: Re: Question about quality of pdf-files from ghostscript

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Thu, 9 Sep 1999 14:16:29, letoured@sover.net a crit dans un message:

> >> I do my type-setting myself, and my output from DeScribe is better than
what they
> >> get >> from their FrameMaker.
> >Yes, I've made excellent-looking output from DeScribe. I seldom go into
> >Win to use Framemaker or anything else over there.
> 
> Framemaker has some pretty good type and layout controls. I find it hard
> to believe that any word processor does a better job. So I'm curious, just
> what is the publisher doing that you don't like? 
> 

Have you looked at DeScribe? It is much more than a "word" processor. It 
uses a system of frames and is highly refined for Desktop Publishing. 
Excellent type handling, graphics inserting, and a very powerful system of 
Forms, Layouts, and Macros. If you are producing work and sending it to a 
printer device that you control, it's an excellent workhorse product.

Its main drawback these days is that all commercial printers now use RIP 
software that wants to reopen your file with copies of the programs that 
created the piece, before sending it down the wire to the expensive (to 
correct) stage of filmsetting, so that inconsistencies are eliminated and 
other technical aspects are in control. If your file isn't coming in the 
standard Mac or Win DTP formats, they can't do anything with it.

Two years ago I tried to get a simple, one page black-and-white piece 
uploaded to a printer in another city, so my client there could just go in 
and pick up the finished job. I was travelling and using my laptop, and 
DeScribe, and used an old technique of converting it to PCL format by 
printing to file via an HPII printer. These files will print beautifully on
*any* HP emulating laser printer, simply by issuing the command COPY /B 
MYFILE.PCL PRN, and I had verified by phone that I had found printers who 
had HP lasers online. (You could even carry a diskette with the file on it 
into Kinko's, go to a command line, enter that one command, and the 
printout would be generated without ka-chinging the part of the Kinko's 
software that charged you for a printed page. But not any more.)

However, after spending the entire day at this, it turned out that not one 
single commercial "online" printer had the capability of handling this. 
Every single one had RIP software installed to manage the printer, that 
refused to allow this file to travel down the wire to the laser port. My 
one-pager was pure type, and it would have been handled perfectly if I had 
generated it in Illustrator, or Freehand, or Pagemaker, or Framemaker. But 
not with what I had. 

It was the first time I was embarassed to have to tell the client it was my
screwup, for relying on OS/2. After that I carried a second HD with a Win95
install and Illustrator, for stuff like this.



> BTW, if you can get Frame 5, it runs just find under Win-OS2.

I've been trying for some time to find a copy, but no joy. Email me if you 
know someone who wants to sell.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          09-Sep-99 18:10:27
  To: All                                               09-Sep-99 17:03:11
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

> On Thu, 9 Sep 1999 10:22:29, Bob Germer <bobg.REMOVEME.@pics.com> 
> wrote:
> > 
> > You claim elsewhere to be an ICE user. But your headers show you are not
> > using ICE to post here. For the record, here is a portion of the header of
> > the message I am replying to here.
> > 
> > X-Newsreader: Your Internet Banner Ad Here!
> > That is Win95 crap. If you were using ICE, Ice would be listed as the
> > Newsreader.

No, not true.

If I were using MR2Ice on USENET (which I gave up long ago) I'd go back and
bithack the X-Newsreader string out of it's executables the same way I did 
for ProNews. (Yes, I also pick all the little threads out to remove the 
self-advertising tags that "designers" put on jeans. I don't understand 
paying my money to advertise somebody else. And when I was in the military 
I tried to go everyplace I could without wearing a hat, too.)

I'm not smart enough to change it to anything that has more characters, 
but, using HEXEDIT2 (under OS/2, of course) the ASCII string:
	X-Newsreader: Your Internet Banner Ad Here!
could just as easily become:
	X-Newsreader: Posted In Absolute Ignorance!
or revert back to:
	X-Newsreader: ProNews/2 Version 1.50 Beta 1

I believe that X-function is an archaic remnant of the Olde Internete, 
anyway. It provides fuel and fodder for the already nervous hyperstimulated
spittle-dripping rabidites, without bringing any benefit back my way.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     09-Sep-99 20:00:26
  To: All                                               09-Sep-99 20:01:15
Subj: Re: MR/2 ICE

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Thu, 09 Sep 1999 06:22:29 -0400, Bob Germer wrote:

->X-Newsreader: Your Internet Banner Ad Here!
->MIME-Version: 1.0
->Content-Type: text/plain; charset="us-ascii"
->Content-Transfer-Encoding: 8bit
->
->That is Win95 crap. If you were using ICE, Ice would be listed as the
->Newsreader.

There's nothing there that identifies it as one operating system or
another nor as one newsreader vs another. If anything it looks more like
dejanews stuff.


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: anon@anonymous.co.uk                              09-Sep-99 19:29:22
  To: All                                               09-Sep-99 20:01:15
Subj: Req: Old software Lotus 123G v2.0 -> v2.1 update

From: anon@anonymous.co.uk (Steve)

Hi

I own a legitimate copy of Lotus 1-2-3(G) for OS/2 V2.0
which I would like to update to V2.1.

However because the software is so old I can find no 
references to either it, or the update on either Lotus's
or IBM's site.

If anybody still has a copy of this update, would you be
able to send me a copy or otherwise help me obtain this
update ?.

Any assistance would be most welcome.


Steve O'Neill
----------------------------
soneil@wildn.freeserve.co.uk

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Customer of Planet Online (1:109/42)

+----------------------------------------------------------------------------+

From: heloman@my-deja.com                               09-Sep-99 19:25:15
  To: All                                               09-Sep-99 20:01:15
Subj: Netscape Communicator

From: heloman@my-deja.com

I have run out of space on a particular partition
that has Netscape Communicator on it. I tried to move
all of the files to another partition, edited all the
statements in the config.sys that pointed to the old
location. Upon bootup I received an error msg
pertaining to 'NETAPI' - what is this and is there
any connection between Netscape AND NETAPI? Has
anyone moved it to another partition and done
anything special? Thanks in advance for any
information about this.....


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: kenkahn@us.ibm.com                                09-Sep-99 19:35:09
  To: All                                               09-Sep-99 20:01:15
Subj: Re: BOOTOS2 doesn't work for me!!!!! Help!!!!!

From: kenkahn@us.ibm.com

In article <NXbNN=xIM70fVlmpi39WO8tPebfz@4ax.com>,
  jiclbch@ibm.net wrote:
> Dear Friends:
>
> I tried to generate a two diskette, bootable,
minimum OS/2, using
> BOOTOS2. The problem is that the product insists to
include, in the
> first diskette, a lot of drivers that are included
in my main
> CONFIG.SYS, that I don't need in an emergency
diskette based OS/2.

The problem is it's not easy (i.e. *very* hard) to
figure out which BASEDEV drivers are required for
basic system function, and which are optional, like
the sound card drivers.  I've tried many different
approaches but have never come up with a solution
that doesn't miss some required drivers and add other
optional drivers.  That's why I added the LXLITE
support, which helps a little bit.

I'm open for suggestions.  One I've been thinking of
is to have BOOTOS2 prompt the user while processing
each BASEDEV driver and ask if it should be added.
Optionally, or additionally, I could allow for an
alternate text file that would list those drivers
in your CONFIG.SYS that you didn't want added to a
boot disk.  Maybe we could come up with a minimal
file of this type that I would distribute (my AWE64
card only has DEVICE drivers, no BASEDEVs).

--

Kenneth Kahn - IBM P/390 Software Development (and
BOOTOS2 Author)


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: srd@x.mcmail.com                                  09-Sep-99 21:23:04
  To: All                                               09-Sep-99 23:52:09
Subj: Re: MR/2 ICE

From: Steve Drewell <srd@x.mcmail.com>

On Thu, 09 Sep 1999 at 06:31 -0400, Bob Germer <bobg.REMOVEME.@pics.com>
wrote:

>On <990908172542.83162M-100000@bisv3.bedford.waii.com>, on 09/08/99 at
>05:33 PM,
>   Steve Drewell <bd83h@bedford.waii.com> said:

>> On Wed, 8 Sep 1999, Bob Germer wrote:

>>  Moreover, he is posting here with Win9x software which we  all know
>> won't run under OS/2.

>> So what? I'm posting here using Pine running on AIX. Does that make me a
>> bad person? Does that mean I don't love and use OS/2 or MR/2 ICE?

>You don't claim to be using ICE. Donnelly does.


Erm....but I do, and I am as I write this. Your argument just fell apart.
Ever considered that someone may use more than one email or news client on
more than one operating system on more than one machine to access these
newsgroups?

Cheers,
Steve
-- 
Steve Drewell             (Remove x. from address to reply)
_____________________________________________________________
Using IBM OS/2 Warp 4 running 21 processes with 127 threads.
Machine uptime is 7 days, 21 hours, 27 mins and 48 secs.
_____________________________________________________________


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          09-Sep-99 20:46:15
  To: All                                               10-Sep-99 04:48:06
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Thu, 9 Sep 1999 20:23:08, Steve Drewell <srd@x.mcmail.com> a crit dans 
un message:

> On Thu, 09 Sep 1999 at 06:31 -0400, Bob Germer <bobg.REMOVEME.@pics.com>
> wrote:
> 
> >On <990908172542.83162M-100000@bisv3.bedford.waii.com>, on 09/08/99 at
> >05:33 PM,
> >   Steve Drewell <bd83h@bedford.waii.com> said:
> 
> >> On Wed, 8 Sep 1999, Bob Germer wrote:
> 
> >>  Moreover, he is posting here with Win9x software which we  all know
> >> won't run under OS/2.
> 
> >> So what? I'm posting here using Pine running on AIX. Does that make me a
> >> bad person? Does that mean I don't love and use OS/2 or MR/2 ICE?
> 
> >You don't claim to be using ICE. Donnelly does.
> 
> 
> Erm....but I do, and I am as I write this. Your argument just fell apart.
> Ever considered that someone may use more than one email or news client on
> more than one operating system on more than one machine to access these
> newsgroups?

If y'all didn't quote him I'd never see his stuff, but this brings up a 
question I'd be curious to know the answer to. 

If REMOVEME is using MR2 for both mail and news, exclusively, why does he 
need to spamproof his email address?

I've been running with a SIG that has my own real email "in the clear" for 
a long long time, and the filters I've got in place do a great job of 
keeping me from seeing more than a few pieces of spam a week. (Which simple
get moved to the Pitched folder, not deleted, for future examination and 
possible Filter rejiggering if I can identify some searchable string that 
blocks multiple spams.)

As a matter of fact I see more spam in USENET since I took my very 
aggressive idiot-domain and freemail-domain filters off in ProNews, but I 
may just go ahead and put them back on. (Nobody cowering beadyeyed 
sniveling in the corrupt hope of selfish gain behind a freemail address 
ever contributes anything useful, anyway.) ProNews uses the nifty and 
unique HotFilters function to augment the normal filter system, so I can 
just work up to it.

But as far my email inbox goes my MR2 filters make me smile in happiness 
every day, and they're simple enough to construct that even a lamebrain 
like me (a brain that's lame even before it gets gin in its fuel supply) 
can get some started. Makes me wonder why an actual MR2 advocate User 
wouldn't be trying to teach school to everyone else on employing such 
functions?


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       09-Sep-99 19:01:04
  To: All                                               10-Sep-99 04:48:06
Subj: Re: MR/2 ICE

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

On Wed, 08 Sep 1999 05:42:53 -0400, bobg.REMOVEME.@pics.com wrote:
>On <990907142523.31276E-100000@bisv3.bedford.waii.com>, on 09/07/99 at
>02:43 PM,
>   Steve Drewell <bd83h@bedford.waii.com> said:
>
>>  Anyone who makes such assinine claims must have one totally farkled
>> system  and lack the ability to properly install/operate a computer.
>> Why don't you  get your system fixed. No one else has the problems you
>> claim with ICE  running off the screen, etc.
>>  
>>  Frankly, I don't think you do either. I think you are a worthless
>> liar.
>
>> Bob, who rattled your cage? In defense of Buddy, it is widely known that
>> in MR/2 ICE, the vertical divider lines in the message index cannot be
>> dragged left or right and that the text of, for example, the subject
>> field is limited to what will fit between the vertical divider lines.
>> Reducing the font size will enable more text to be viewed but at the
>> expense of legibility.
>
>> Maybe you should have read and understood the message before jumping
>> down Buddy's throat.
>
>I read and understood "Buddy's" message. He claims the screen goes off his
>monitor. Worse, he slammed Nick Knight completely unfairly and
>untruthfully. Moreover, he is posting here with Win9x software which we
>all know won't run under OS/2.

No, Buddy did not say this. Well my understanding of it was that he 
did not say this!

>
>"Buddy" is a Microsoft lemming, a polite way of saying damned liar.

Yeah right!!!

I've read Buddy's posts many times and the overall view I get is 
that he runs the latest win2000 beta and posts only using 
true MS software!!    <----- Wrong!!!!!

Buddy is a true OS/2 user, and his posts are always very 
useful to read, as to be honest, are yours.  Usually:-)


Cheers
Chris

-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       09-Sep-99 19:09:09
  To: All                                               10-Sep-99 04:48:06
Subj: Re: MR/2 ICE

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

On Thu, 09 Sep 1999 06:27:02 -0400, bobg.REMOVEME.@pics.com wrote:
>On <Z8vLRdP7nz3N-pn2-RFhyOE23EOIi@yourmachine.yourlocaldomain.yourisp>, on
>09/08/99 at 08:55 PM,
>   donnelly@tampabay.rr.com (Buddy Donnelly) said:
>
>> > 
>> > =>Idiots like Buddy Donnelly <spelling?> deserve to be castrated, drawn,
>> > =>quartered, and have their heads stuck up on poles.
>
>> Hm. It sounds like you gave that Sequence Of Operations good solid
>> thought.
>
>For your information, since you obviously never had any history classes,
>for several centuries in England the standard method of execution for
>treason was to be hanged until nearly dead, then revived, castrated, the
>genitals placed in your mouth, then drawn (sliced open) your intestines
>ripped out while you were still conscious, beheaded, and the rest of the
>body quartered. The head was placed on poles to rot as a warning to others
>in London. The four parts were sent to various parts of the country where
>your actions were known and put on poles.

....and there was me thinking "drawing" means stretching on
a rack until you are really in a little bit of pain!!


Cheers
Chris



-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        09-Sep-99 21:05:22
  To: All                                               10-Sep-99 04:48:06
Subj: Re: MR/2 ICE

From: dboultr@spamfree.erols.com

On Thu, 9 Sep 1999 13:08:20, domi@kenavo.NOSPAM.fi (Dominique Pivard) 
wrote:

> On Thu, 9 Sep 1999 10:22:29, Bob Germer <bobg.REMOVEME.@pics.com> 
> wrote:

Would someone who doesn't have Bob in their killfile please explain to
him how to spamproof his address without wasting Internet bandwidth?  
For someone who apparently can't leave other people's headers alone, 
you'd think he'd try to make sure that his own didn't make him look 
like some novice. 

Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dboultr@spamfree.erols.com                        09-Sep-99 21:08:11
  To: All                                               10-Sep-99 04:48:06
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: dboultr@spamfree.erols.com

On Thu, 9 Sep 1999 08:53:29, donnelly@tampabay.rr.com (Buddy Donnelly)
wrote:

> Use MR2's HELP pulldown to quickly jump to the Home Page via a brower, then
> drill to the bottom of the page for a listing of very useful links. That's 
> where I found this.

No, no, no, no!  I already have that one!  and used it! <grin>

I want to convert from PRM to J-Street Mailer!

Doug Boulter

To reply by e-mail, remove the obvious spam traps from the address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: hamei@pacbell.net                                 09-Sep-99 21:22:29
  To: All                                               10-Sep-99 04:48:06
Subj: Re: MR/2 ICE

From: hamei@pacbell.net

In <Z8vLRdP7nz3N-pn2-kmiCK1fHBfYW@yourmachine.yourlocaldomain.yourisp>, 
donnelly@tampabay.rr.com (Buddy Donnelly) writes:

>As a matter of fact I see more spam in USENET since I took my very 
>aggressive idiot-domain and freemail-domain filters off in ProNews, but I 
>may just go ahead and put them back on. (Nobody cowering beadyeyed 
>sniveling in the corrupt hope of selfish gain behind a freemail address 
>ever contributes anything useful, anyway.) 

not arguing with your thesis, but some people in other countries have
a difficult time accessing usenet directly : occasionally a deja poster
is one of these. I have a few friends who use hotmail because @ $100/mo
income, they really can't afford their own dialup connection.


>Good luck,
>
>Buddy
>
>Buddy Donnelly
>donnelly@tampabay.rr.com
>
>


skl !

----------------------------------------------------------
Hrad ngravvrd
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  09-Sep-99 21:31:06
  To: All                                               10-Sep-99 04:48:06
Subj: Re: DB2 installation

From: prather@infi.net (Jerry Prather)

In message
<qzpoevqrgbjregbbet.fhrvb72.pminews@news.mtag1.on.wave.home.com>
- "Darin McBride" <dmcbride@no.tower.spam.to.org>Thu, 09 Sep 1999
03:06:44 GMT writes:
:>Next time, if it installs cleanly, leave it installed unless someone
:>(preferably DB2 service or someone from DB2) tells you to uninstall it to
:>reinstall.  Unless, of course, you're giving up, in which case, go right
:>ahead.  As long as you want to get it going, chances are that once it is
:>installed properly, we can do *something* to make it work.  After all, I had
:>DB2 v5.0 running here long before I had a local area network going... (Now I
:>have DB2 v6.1 installed - both Enterprise Edition and Software Developer's
:>Kit.)

Okay, I now have it installed.  IAW your instructions, I did not
install the documentation or the control center.  I created the
sample database, apparently without problem.  I started db2 and
was able to display the database (it shows 1 record, right?).  

I think that at this point I need the documentation.  It's been
about fifteen years since I last messed with an SQL database
program
and that was an early version of Informix running on UNIX.  

So I decided to get brave and install the documentation.  Done,
apparently.

Found the documentation area and started going through the Quick
Beginnings section.  The first problem I ran into was that it
told me to go to DB2->Registration and there was no such option. 
Maybe because of the way I downloaded, I'm already registered and
the option was surpressed???
 
:>From your message, I'm guessing the problem is in Net.Question.  (Look this
:>product up in deja ... I'll say no more.)  

Done.  I'm not sure whether I understood it all or not, but my
intent is to install VA Java V2 as soon as I feel that DB2 is
running and try to create DB2/Java applications (not necessarily
for web use, for now - I'm more interested in OS-independent
applications).

:>Since you have to reinstall
:>anyway, try not installing the documentation as well as the Control Center. 
:>I know, I know, these are important parts, especially when evaluating or
:>learning DB2.  However, just for problem diagnoses, let's just leave them
:>out.  If First Steps works (or whatever you're trying to use), or at least
:>the problems you were facing don't appear, then we've narrowed it down to
:>pretty much confirm what I am thinking.  Then you can reinstall - don't
:>bother uninstalling - and select the docs and/or the CC, if you want them.
:>
:>If you can confirm this is indeed the case, come on back and we'll continue
:>problem determination from there.

Okay.  I've loaded up the documentation and that works - although
I need to get the association back to NS 4.61B2 instead of
StarOffice.  I've also installed the control center and am at the
point where I need to reboot to have that take effect.  So my
intention, since this was already so far advanced, is to get this
off before rebooting.

Thanks for your assistance.


Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: Jeff.davis.no@spam.ibm.net                        09-Sep-99 20:10:24
  To: All                                               10-Sep-99 04:48:07
Subj: DB2 and NETQOS2

From: "Jeff Davis" <Jeff.davis.no@spam.ibm.net>

Does anybody have this working on a standalone system (no NIC card) 
Following some advice from Darin and by taking a shot in the dark I now get
the message that it has started but I still can't search I get the message
"NetQ message: The specified NetQuestion server is not available. (rc=33)" On
the other hand my Visualage Java search now works.  What I did based on info
from Darin and SNIFFLE was to assign a TCP address to LAN 0 even though I
don't have a NIC card.  As a result I have the following 
localhost 127.0.0.1

LAN0 127.0.0.1 mask 255.255.255.0 

TCP 4.1, Fixpack 11 and JAVA 1.1.8

The rest of DB2 seems fine so I will struggle to get JAVA to red and write to
DB2.

Help or suggestions on NETQ would be cheerfully appreciated.

Jeff

// ------------------------------------
// Jeff Davis
// Prince Edward Island, Canada



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Larry.Snider@ibm.net                              09-Sep-99 19:10:25
  To: All                                               10-Sep-99 04:48:07
Subj: Re: MR/2 ICE

From: "Larry Snider" <Larry.Snider@ibm.net>

In <37d78c9b$4$obot$mr2ice@news.pics.com>, on 09/09/99 
   at 06:31 AM, Bob Germer <bobg.REMOVEME.@pics.com> said:

=>On <990908172542.83162M-100000@bisv3.bedford.waii.com>, on 09/08/99 at
=>05:33 PM,
=>   Steve Drewell <bd83h@bedford.waii.com> said:

=>> On Wed, 8 Sep 1999, Bob Germer wrote:

=>>  Moreover, he is posting here with Win9x software which we  all know
=>> won't run under OS/2.

=>> So what? I'm posting here using Pine running on AIX. Does that make me a
=>> bad person? Does that mean I don't love and use OS/2 or MR/2 ICE?

=>You don't claim to be using ICE. Donnelly does.

If one's evaluating ICE, then one can truthfully say that they are using
ICE.  It doesn't mean that that's what they use all the time.  One could
be using the e-mail portion exclusively, too.

-- 
Larry Snider - Portsmouth, RI
Internet: Larry.Snider@ibm.net
FidoNet: 1:109/921.52

"That OS/2 Feller"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Larry.Snider@ibm.net                              09-Sep-99 19:13:17
  To: All                                               10-Sep-99 04:48:07
Subj: Re: MR/2 ICE

From: "Larry Snider" <Larry.Snider@ibm.net>

In <njztlrfvppbz.fhsk730.pminews@news.yesic.com>, on 09/09/99 
   at 08:04 AM, "andrew g" <nolospamoawmg@yesic.com> said:

=>On Thu, 09 Sep 1999 06:27:02 -0400, Bob Germer wrote:

=>> The head was placed on poles to rot as a warning to others
=>>in London. The four parts were sent to various parts of the country where
=>>your actions were known and put on poles.

=>Geez. I feel sorry for those poor Poles.

As if the jokes weren't degrading enough...

-- 
Larry Snider - Portsmouth, RI
Internet: Larry.Snider@ibm.net
FidoNet: 1:109/921.52

"That OS/2 Feller"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Larry.Snider@ibm.net                              09-Sep-99 19:22:21
  To: All                                               10-Sep-99 04:48:07
Subj: Re: MR/2 ICE

From: "Larry Snider" <Larry.Snider@ibm.net>

In
<sXnyXDNIUu65-pn2-rybByxHndd2g@207-172-53-242.s242.tnt4.brd.va.dialup.rcn.com>,

on 09/09/99 at 09:05 PM, dboultr@spamfree.erols.com said:

=>On Thu, 9 Sep 1999 13:08:20, domi@kenavo.NOSPAM.fi (Dominique Pivard) 
=>wrote:

=>> On Thu, 9 Sep 1999 10:22:29, Bob Germer <bobg.REMOVEME.@pics.com> 
=>> wrote:

=>Would someone who doesn't have Bob in their killfile please explain to
=>him how to spamproof his address without wasting Internet bandwidth?  
=>For someone who apparently can't leave other people's headers alone, 
=>you'd think he'd try to make sure that his own didn't make him look 
=>like some novice. 

It's quite easy really.  All you have to do is place the spam proofing on
the domain name side of e-mail address (ie., on the right of the @).  This
will keep spam from even reaching the mail server.

-- 
Larry Snider - Portsmouth, RI
Internet: Larry.Snider@ibm.net
FidoNet: 1:109/921.52

"That OS/2 Feller"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: letoured@sover.net                                09-Sep-99 18:39:06
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Req: Old software Lotus 123G v2.0 -> v2.1 update

From: letoured@sover.net

Most of the old Lotus stuff is archived in some obscure place. I don't
remember what they call it, but I've found it a few times in the past --
twice by accident, and once because I knew where to look.  Unfortunately,
I don't remember the path right now. 


>I own a legitimate copy of Lotus 1-2-3(G) for OS/2 V2.0
>which I would like to update to V2.1.

>However because the software is so old I can find no 
>references to either it, or the update on either Lotus's
>or IBM's site.

>If anybody still has a copy of this update, would you be
>able to send me a copy or otherwise help me obtain this
>update ?.

>Any assistance would be most welcome.
_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          09-Sep-99 23:52:18
  To: All                                               10-Sep-99 04:48:07
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Thu, 9 Sep 1999 21:22:59, hamei@pacbell.net a crit dans un message:

> In <Z8vLRdP7nz3N-pn2-kmiCK1fHBfYW@yourmachine.yourlocaldomain.yourisp>, 
> donnelly@tampabay.rr.com (Buddy Donnelly) writes:
> 
> >As a matter of fact I see more spam in USENET since I took my very 
> >aggressive idiot-domain and freemail-domain filters off in ProNews, but I 
> >may just go ahead and put them back on. (Nobody cowering beadyeyed 
> >sniveling in the corrupt hope of selfish gain behind a freemail address 
> >ever contributes anything useful, anyway.) 
> 
> not arguing with your thesis, but some people in other countries have
> a difficult time accessing usenet directly : occasionally a deja poster
> is one of these. I have a few friends who use hotmail because @ $100/mo
> income, they really can't afford their own dialup connection.

I understand, and since people here do tend to quote those whom I've 
already filtered (blanketly or otherwise) if they come up with some 
usefulness I can modify the filters in either ProNews or MR2 to allow that 
address to slip in.

Anybody trying to email me who doesn't get a response, can post a notice 
here and I'll catch it and adjust the inbounds accordingly.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          10-Sep-99 00:13:07
  To: All                                               10-Sep-99 04:48:07
Subj: Re: MR/2 ICE

From: donnelly@tampabay.rr.com (Buddy Donnelly)

> On Thu, 09 Sep 1999 06:27:02 -0400, bobg@pics.com wrote:
> >On <Z8vLRdP7nz3N-pn2-RFhyOE23EOIi@yourmachine.yourlocaldomain.yourisp>, on
> >09/08/99 at 08:55 PM,
> >   donnelly@tampabay.rr.com (Buddy Donnelly) said:
> >
> >> > 
> >> > =>Idiots like Buddy Donnelly <spelling?> deserve to be castrated,
drawn,
> >> > =>quartered, and have their heads stuck up on poles.
> >
> >> Hm. It sounds like you gave that Sequence Of Operations good solid
> >> thought.
> >
> >For your information, since you obviously never had any history classes,

Had plenty of them, but tended to lose interest even at a young age in the 
bloodthirsty, barbaric, jingoistic side of "history" and I preferred to 
focus on the higher planes of the human condition over the course of time.


> >for several centuries in England the standard method of execution for
> >treason was to be hanged until nearly dead, then revived, castrated, the
> >genitals placed in your mouth, then drawn (sliced open) your intestines
> >ripped out while you were still conscious, beheaded, and the rest of the
> >body quartered. The head was placed on poles to rot as a warning to others
> >in London. The four parts were sent to various parts of the country where
> >your actions were known and put on poles.

I saw that being done to a self-destructive Scot named William Warfield, or
Walters, something like that I'm pretty sure, in one of those Mel Gibson 
fantasy movies. It looked like a fine tradition, if you had it in for 
Scots. The special effects were pretty good.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: bradshaw@uu.net                                   09-Sep-99 20:15:25
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Insufficient Stack space in NC/2 4.04 and NC/2 4.61

From: bradshaw@uu.net (Nyarlathotep)

In <37D731E4.EC11B822@ausNOSPAMtin.rr.com>, on 09/09/99 
   at 04:07 AM, "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com> said:


>Did you get the latest version of the Matrox video driver?  

   This did the trick. I noticed at once the Win95 driver for the G200 was
buggy and I had upgraded it but OS/2 seemed happy. I had not been online
for a while and had been using  mostly text apps in OS/2 so I had not run
Netscape for a week -- I generally don't fix what's  isn't broken :).

Thanks for such a rapid response. (And of course for the hard work on
NC/2) John Midtgard

email: midtgard(AT)atlantic.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          10-Sep-99 00:15:02
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Thu, 9 Sep 1999 21:08:23, dboultr@spamfree.erols.com a crit dans un 
message:

> On Thu, 9 Sep 1999 08:53:29, donnelly@tampabay.rr.com (Buddy Donnelly)
> wrote:
> 
> > Use MR2's HELP pulldown to quickly jump to the Home Page via a brower,
then
> > drill to the bottom of the page for a listing of very useful links. That's 

> > where I found this.
> 
> No, no, no, no!  I already have that one!  and used it! <grin>
> 
> I want to convert from PRM to J-Street Mailer!

Oh. Dumb me.


Going from one Innoval product to another, you'd think there might have 
been some kind of standard format there.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: spambotsbewasre@antispam.org                      09-Sep-99 20:37:20
  To: All                                               10-Sep-99 04:48:07
Subj: The Ultimate Operating System News (yes we have OS/2!)

From: "spambotsbeware@antispam.org" <spambotsbewasre@antispam.org>

http://TheUltimateOS.com

News
Reviews
Free @TheUltimateOs.com email!
And much more


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@iname.com                                  09-Sep-99 22:29:23
  To: All                                               10-Sep-99 04:48:07
Subj: Re: emTeX or emTeX/TDS?

From: "Ken Kuttner" <nospam@iname.com>

On Sat, 28 Aug 1999 00:21:07 +0200, Christian Hennecke wrote:

>I am planning to use VTeX (PDF output) which needs either a special TeX
>distribution set or emTeX/TDS according to its README. Currently I have
>installed normal emTeX.
>Can anybody tell me about the differences between normal emTeX and
>emTeX/TDS? What are the advantages/disadvantages? I have read that there
>are things emTeX/TDS can't do. But which?
>
>Thanks in advance
>
>Christian Hennecke

Christian,

I just installed the new version of emTeX/TDS, replacing an older version of
"regular" emTeX.  AFAIK, the only difference is the directory placement of
the files.  emTeX/TDS conforms to the new standard directory layout, while
"regular" emTeX had its own default layout.

Once I figured out the right place to put my macro files, all my documents
work fine with the new emTeX/TDS, and now I can use the type 1 CM fonts, and
use VTeX to make pdf files directly.  

Bottom line: emTeX/TDS is the way to go, IMHO.

Ken

-----------------------------------------
Ken Kuttner
To reply replace "nospam" with "knk" 
-----------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Columbia University (1:109/42)

+----------------------------------------------------------------------------+

From: bogus.due2UCE@atlantic.net                        09-Sep-99 22:53:07
  To: All                                               10-Sep-99 04:48:07
Subj: E.EXE

From: Felix Miata <bogus.due2UCE@atlantic.net>

Anyone know a way to make it stop appending ACSII 26 to the end of an
HTML file?
-- 
When pride comes, then comes disgrace, but with humility comes
wisdom.                Proverbs 11:2 NKJV

 Team OS/2

Felix Miata  ***  http://mrmazda.members.atlantic.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Webmasters, have you read: http://www.mcsr.olemis
(1:109/42)

+----------------------------------------------------------------------------+

From: zerofree@ix.netcom.com                            10-Sep-99 02:58:11
  To: All                                               10-Sep-99 04:48:07
Subj: os2 Assistance Please

From: zerofree@ix.netcom.com

This may be a stupid question, but I am looking to get a copy of the OS2
actual operating system (warp 4.0 or later).  I have searched around but
got nothing including ibm's mess of a website.  Is there a site or ftp I
 could download it from? If not where would I purchase it from and for
how much?  Any help would be greatly appreciated and I would try to
return the favor.

thanks, Brent


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: zerofree@ix.netcom.com                            10-Sep-99 02:56:25
  To: All                                               10-Sep-99 04:48:07
Subj: os2 Assistance Please

From: zerofree@ix.netcom.com

This may be a stupid question, but I am looking to get a copy of the OS2
actual operating system (warp 4.0 or later).  I have searched around but
got nothing including ibm's mess of a website.  Is there a site or ftp I
 could download it from? If not where would I purchase it from and for
how much?  Any help would be greatly appreciated and I would try to
return the favor.

thanks, Brent


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: peter@seagoon.newcastle.edu.au                    10-Sep-99 03:47:05
  To: All                                               10-Sep-99 04:48:07
Subj: Re: E.EXE

From: peter@seagoon.newcastle.edu.au (Peter Moylan)

Felix Miata <bogus.due2UCE@atlantic.net> wrote:
>Anyone know a way to make it stop appending ACSII 26 to the end of an
>HTML file?

I'm pretty sure you can't.  Luckily there are plenty of other
editors around.

-- 
Peter Moylan                                         peter@ee.newcastle.edu.au
See http://eepjm.newcastle.edu.au for OS/2 information and software

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: jdb@juliand.com                                   09-Sep-99 23:17:19
  To: All                                               10-Sep-99 04:48:07
Subj: Re: os2 Assistance Please

From: Julian Dominic <jdb@juliand.com>

Indelible Blue is the supplier that I use.  They also stock a lot OS/2
applications.  You can get to them at
http://www.indelibleblue.com/ibapps/products.nsf/By+Platform . Select OS/2
as the platform and scroll down to the product.


zerofree@ix.netcom.com wrote:

> This may be a stupid question, but I am looking to get a copy of the OS2
> actual operating system (warp 4.0 or later).  I have searched around but
> got nothing including ibm's mess of a website.  Is there a site or ftp I
>  could download it from? If not where would I purchase it from and for
> how much?  Any help would be greatly appreciated and I would try to
> return the favor.
>
> thanks, Brent
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          10-Sep-99 05:13:26
  To: All                                               10-Sep-99 04:48:07
Subj: Re: os2 Assistance Please

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Fri, 10 Sep 1999 02:58:22, zerofree@ix.netcom.com a crit dans un 
message:

> This may be a stupid question, but I am looking to get a copy of the OS2
> actual operating system (warp 4.0 or later).  I have searched around but
> got nothing including ibm's mess of a website.  Is there a site or ftp I
>  could download it from? If not where would I purchase it from and for
> how much?  Any help would be greatly appreciated and I would try to
> return the favor.

It's available nearly constantly at ebay:

http://search.ebay.com/cgi-bin/texis/ebay/results.html?&query=ibm+warp



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: hep@nospam.thanks                                 10-Sep-99 08:23:07
  To: All                                               10-Sep-99 10:22:08
Subj: Netscape Fonts

From: hep@nospam.thanks

Hi,

I'm using the latest Netcape 4.61 release, but the default fonts 
(1024x768 resolution) are not brilliant. Does any body have any 
suggestions for a more readable format ?

Thanks & Regards

Howard

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: hep@nospam.thanks                                 10-Sep-99 09:40:10
  To: All                                               10-Sep-99 10:22:08
Subj: Re: MR/2 ICE

From: hep@nospam.thanks (Howard Pollock)

On Wed, 8 Sep 1999 09:42:53, Bob Germer <bobg.REMOVEME.@pics.com> 
wrote:

> Moreover, he is posting here with Win9x software which we
> all know won't run under OS/2.
> 

I would say, from looking at the headers, that he is using Pronews 
(unless the headers are beeing manipulated)

Regards

Howard

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dcurren@ibm.net                                   10-Sep-99 04:01:06
  To: All                                               10-Sep-99 10:22:08
Subj: Re: Post Road Mailer and FP11 ...lost folders...still

From: "Dale Curren" <dcurren@ibm.net>

On Fri, 10 Sep 1999 00:15:05 GMT, Buddy Donnelly wrote:

 
>> I want to convert from PRM to J-Street Mailer!

There is a file called jsmutils that converts several things IIRC.  I used it
long 
ago and have it here.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: falko.tesch@bigfoot.com                           10-Sep-99 09:44:13
  To: All                                               10-Sep-99 10:22:08
Subj: Re: Netscape Fonts

From: Falko Tesch <falko.tesch@bigfoot.com>

Am 10.09.99, 10:23:15, schrieb hep@nospam.thanks zum Thema Netscape 
Fonts:


> Hi,

> I'm using the latest Netcape 4.61 release, but the default fonts
> (1024x768 resolution) are not brilliant. Does any body have any
> suggestions for a more readable format ?

Hi Howard,
Yepp!
Just install FreeType 1.0 (http://www.freetype.org) and use Arial as 
your Defaultfont. Looks much, much, much better here (using NN 4.04).

CU/2
Falko



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Star Division GmbH, Hamburg, Germany (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          10-Sep-99 10:35:22
  To: All                                               10-Sep-99 10:22:08
Subj: Re: os2 Assistance Please

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Fri, 10 Sep 1999 05:13:53, donnelly@tampabay.rr.com (Buddy Donnelly) a 
crit dans un message:

> On Fri, 10 Sep 1999 02:58:22, zerofree@ix.netcom.com a crit dans un 
> message:
> 
> > This may be a stupid question, but I am looking to get a copy of the OS2
> > actual operating system (warp 4.0 or later).  I have searched around but
> > got nothing including ibm's mess of a website.  Is there a site or ftp I
> >  could download it from? If not where would I purchase it from and for
> > how much?  Any help would be greatly appreciated and I would try to
> > return the favor.
> 
> It's available nearly constantly at ebay:
> 
> http://search.ebay.com/cgi-bin/texis/ebay/results.html?&query=ibm+warp

Or better yet:

http://search.ebay.com/cgi-bin/texis/ebay/results.html?&query=os%2F2+warp


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: mohd.k.yusof@bohm.anu.edu.au                      10-Sep-99 20:41:11
  To: All                                               10-Sep-99 10:22:08
Subj: Re: Netscape Fonts

From: mohd.k.yusof@bohm.anu.edu.au (Khairil Yusof)

On Fri, 10 Sep 1999 08:23:15, hep@nospam.thanks wrote:

> I'm using the latest Netcape 4.61 release, but the default fonts 
> (1024x768 resolution) are not brilliant. Does any body have any 
> suggestions for a more readable format ?

Select Helv 10-14pt. Nice and sharp.

 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Australian National University (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           10-Sep-99 08:00:24
  To: All                                               10-Sep-99 14:32:04
Subj: Re: IBM Anti Virus

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <9ddCdfeFk555-pn2-SdMNbMs42God@localhost>, on 09/09/99 at 11:42 PM,
   fwkirk@ibm.net (Frank Kirk) said:

> On Wed, 8 Sep 1999 10:35:02, Bob Germer <bobg.REMOVEME.@pics.com> 
> wrote:

> > Hmm, I just went to their website. I AM sending a copy of this message to
> > custserv@symantec.com. I wonder if THIS will garner a response

> 	Don't hold your breath.  If you receive a response, it'll probably be a
> standard form letter;  "Thank you for your interest, blah, blah,  blah.

> 	Someone recently put me on hold for a long time while I listened to 
> recordings telling me "your call is important to us", shortly before I
> was disconnected.

Oh, I got the same treatment, but I was more persistent. I finally got
through to a live human being. Here in a nutshell is the gist of the
conversation:

One must buy the "Enterprise" CD which contains NAV for OS/2 as well as
for NT, Win95, Win98, DOS, MAC, and some others. Plus one must also buy
site licenses for a MINIMUM of 10 users. One can only buy those items from
a reseller. A reseller must contact a "Symantec Specialist" at Ingram to
get the part number and order the software and license. THEN, and ONLY
then will Symantec ship the product to Ingram which in turn will ship to
the reseller.

The 10 user license is a site license. There is no provision for the SOHO
market since "OS/2 is deployed only in large companies" according to a
management contact I finally made by calling the headquarters of Symantec.
Since I was so "upset" she offered to send me a complimentary copy. I told
her I would rather institute a class action lawsuit against Symantec, that
I have clients with 3,4,5 etc. workstations who want the product and are
unwilling to pay for software for computers they don't own, software for
operating systems they do not use, and for 3 or more times the number of
machines they own.

They only sell NAV for Windows and NT as "retail" packages. They sell for
$36 from Symantec but for under $30 from various retailers.

I then called Indelible Blue. They neglected to include OS/2 as one of the
various platforms supported by the Norton AntiVirus Solution CD which they
sell for $207. In addition, one must buy a minimum of 10 site licenses at
$39 each. Thus the SOHO or individual user must pay a MINIMUM of $597 plus
shipping for what Windoze users get for under $30.

Now I see two possible solutions here.

One, and the one I am leaning toward, is to file a breach of contract suit
against Symantec based upon the press releases issued at the time they
took over IBM's antivirus product. Possibly IBM would also have to be a
party defendant to the suit since otherwise Symantec could claim, in
defense, that IBM wanted them to eliminate the SOHO and individual user
after promising support, applications, etc. for OS/2 which induced us to
buy the OS in the first place.

It would not cost nearly the price of the CD and 10 licenses for an
individual to file a suit. If a dozen or so do it at the same time, the
suits would be combined into a class action on behalf of all purchasers of
OS/2.

Naming IBM as co-defendant would probably get IBM to force Symantec to
release individual copies of the software to end users rather than be
charged by Symantec as the instigator of the policy. It would bring IBM
"out of the closet" so to speak regarding its non-support of OS/2
purchasers. If Symantec has documents, etc. to prove that IBM deliberately
wanted to keep the software from end users and SOHO's it would put IBM at
risk of a second class action suit from both users and ISV's.

The second solution would be for a group of users, SOHO's, etc. to form a
non-profit corporation, pool our money, and buy one copy of the software
and the requisite licenses. This is afterall an "enterprise" CD with
server versions, etc. as well as workstation versions. I was informed that
the user licenses were not based on a physical site, but on the total
number of licenses an enterprise wanted for its total number of
workstations, servers, etc.  they wished to protect.

This would reduce the cost of each copy to around $75 per copy. The site
license is $39. The cost of copying the CD and shipping one each would
raise the end user price to $75 or so after adding the distributed cost of
forming a non-profit company, opening a bank account, etc.

I am sure that there might be a price break if someone wanted to buy say
500 or a thousand licenses. That could conceivably reduce the cost even
more.

I had a discussion with a representative of Indelible Blue regarding this
matter. This person told me that there have been many, many calls for
individual copies of the OS/2 product. I have a call into Buck Bohoc, the
owner of IB, and I will explore the matter with him, hopefully today.

IF enough people in the OS/2 community are interested in getting NAV and
willing to pay less than $80 per copy, I will explore the first option at
length with my company's lawyer. If this doesn't look promising, I will
refine idea 2. I personally would be willing to absorb the cost of 20 or
30 copies and setting up the non-profit enterprise based upon promises of
purchase. However, I am not willing to put out the cost for more than
that. Some sort of pre-payment or at least partial pre-payment would be
necessary for me to foot the entire up-front costs.

So, if anyone is really wanting NAV for Warp, please do 3 things:

1. Respond here. I am saving this thread to use as a hammer on Symantec.

2. Email me at bobg@pics.com (NOTE just clicking on a CC button to this
posting will not get to me. You must change the anti-spam automatic
address) so that I can be sure of getting your message.

3. Search your disks, etc. for any announcement material issued by IBM and
Symantec in the event we decide to file a class action.

And if you really want to help, cross-post this message to every OS/2
related and MAC workgroup. MAC users could also purchase from the
non-profit if we go that route.

Bob Germer

PS. Regarding the non-profit company. I would likely list its purpose as
to raise money for Jerry's Kids (The Muscular Disease Foundation) or some
similar eleemosynary organization. $1 of every "purchase" would be sent to
the charity. 

--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           10-Sep-99 08:34:20
  To: All                                               10-Sep-99 14:32:04
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <Z8vLRdP7nz3N-pn2-UdtbVPWfKJ3d@yourmachine.yourlocaldomain.yourisp>, on
09/10/99 at 12:13 AM,
   donnelly@tampabay.rr.com (Buddy Donnelly) said:

> I saw that being done to a self-destructive Scot named William Warfield,
> or Walters, something like that I'm pretty sure, in one of those Mel
> Gibson  fantasy movies. It looked like a fine tradition, if you had it
> in for  Scots. The special effects were pretty good.

Actually, it was William Wallace. The actual torture and execution were
pretty historically accurate. Much of the rest of the movie was more
fiction than fact. The execution was not in the proper year in the movie,
but he was executed in the prescribed manner for traitors which the
English king considered him. We Scots, on the other hand, regard Wallace
as a national hero.

The movie was "Braveheart". It was somewhat accurate in its protrayal of
the treachery of the Comyns and Bruces, but the actual battles, etc. were
fanciful given that there is some written history of the period. Moreover,
nothing in history gives any hint of a relationship between the English
Queen and Wallace.


--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           10-Sep-99 08:40:23
  To: All                                               10-Sep-99 14:32:04
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <geribeurzfyrlqvnycvcrkpbz.fhthdh0.pminews@news.dial.pipex.com>, on
09/09/99 at 08:00 PM,

   "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com> said:
> There's nothing there that identifies it as one operating system or
> another nor as one newsreader vs another. If anything it looks more like
> dejanews stuff.

Nah, it's exactly what I see in posts from my daughter in law who is using
Win98 because its required by her grad school class.



--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           10-Sep-99 08:42:13
  To: All                                               10-Sep-99 14:32:04
Subj: Re: MR/2 ICE

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <37d841e3$4$yneel.favqre$mr2ice@news3.ibm.net>, on 09/09/99 at 07:22
PM,
   "Larry Snider" <Larry.Snider@ibm.net> said:


> =>Would someone who doesn't have Bob in their killfile please explain to
> =>him how to spamproof his address without wasting Internet bandwidth?  
> =>For someone who apparently can't leave other people's headers alone, 
> =>you'd think he'd try to make sure that his own didn't make him look 
> =>like some novice. 

> It's quite easy really.  All you have to do is place the spam proofing
> on the domain name side of e-mail address (ie., on the right of the @). 
> This will keep spam from even reaching the mail server.

I am well aware of how other choose to do it. I prefer my way.


--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: hep@bigfoot.com                                   10-Sep-99 14:55:08
  To: All                                               10-Sep-99 14:32:05
Subj: Re: Netscape Fonts

From: Howard Pollock <hep@bigfoot.com>

Thanks for the replies and advise.

Regards

Howard

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A Beeb User (1:109/42)

+----------------------------------------------------------------------------+

From: paul.ratcliffe@bbc.co.uk                          10-Sep-99 14:49:02
  To: All                                               10-Sep-99 14:32:05
Subj: Re: E.EXE

From: Paul Ratcliffe <paul.ratcliffe@bbc.co.uk>

Peter Moylan wrote:
> 
> Felix Miata <bogus.due2UCE@atlantic.net> wrote:
> >Anyone know a way to make it stop appending ACSII 26 to the end of an
> >HTML file?
> 
> I'm pretty sure you can't.  Luckily there are plenty of other
> editors around.

I know I looked at patching it to do this. I can't remember whether I
succeeded or not now. Will look when I get home...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: BBC Bristol (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          10-Sep-99 15:19:21
  To: All                                               10-Sep-99 17:01:23
Subj: Re: os2 Assistance Please

From: piquant00@uswestmail.net (Annie K.)

On Fri, 10 Sep 1999 02:56:50, zerofree@ix.netcom.com wrote:

:I am looking to get a copy of the OS2
:actual operating system (warp 4.0 or later).  I have searched around but
:got nothing including ibm's mess of a website.  Is there a site or ftp I
: could download it from? 

 Not legally, no.

:If not where would I purchase it from and for
:how much? 

 Post a WTB in comp.os.os2.marketplace, or look on http://www.ebay.com

-- 
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                10-Sep-99 11:19:22
  To: All                                               10-Sep-99 17:01:23
Subj: Re: MR/2 ICE

From: lifedata@xxvol.com

Bob Germer <bobg.REMOVEME.@pics.com> said:

>I am well aware of how other choose to do it. I prefer my way.

A simple question.  Does that mean that you deliberately choose to permit
stuff
you don't want to clog the servers?  Another one.  Why would you want the
servers to catch stuff you don't want yourself?  Yet another.  Is this some
kind
of vendetta?

Jim L
Remove XX from address to Email
More gun laws will cure the nations ills - just like drug laws do.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dgwhiz@earthling.net                              10-Sep-99 15:34:27
  To: All                                               10-Sep-99 17:01:24
Subj: Re: E.EXE

From: dgwhiz@earthling.net (DG)

In message <slrn7tgvro.pd.peter@eepjm.newcastle.edu.au> -
peter@seagoon.newcastle.edu.au (Peter Moylan) writes:

 <=Luckily there are plenty of other editors...=>


   ...such as SmallEditor, Boxer and Kon, all shareware...
plus Mr Edit [prog name change?] and also the "WebWriter"
HTML editor, which are both offered now as freeware. All 5
editors will allow writing of an HTML text file w/o the
end-of-file marker.
   There are still more OS/2 text and HTML editors that
probably will do the same, either for free or low-cost.

DG

   



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DG (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         10-Sep-99 16:52:09
  To: All                                               10-Sep-99 17:01:24
Subj: RealAudio Problem

From: racette@cablevision.qc.ca (Martin Racette)

Hi guys,

I've got a really weird problem with 
RealAudio, I can play local files 
correctly, but as soon as it has to go 
to the Internet for the data, my entire 
computer locks upnad I have to do a 
RESET to make the system work again.

It was working about a month ago 
perfectly well, and a couple of days ago
I tried it again and the problem 
started, I tried to re-install it 
several times to no avail

My system is P-II Celeron 400Mhz with 
128Mb RAM, Warp 4 FP11

BTW. don't tell me that its FP11, 
because it was working OK shortly after 
I installed FP11

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bandyo@wam.umd.edu                                10-Sep-99 14:09:15
  To: All                                               10-Sep-99 17:01:24
Subj: Re: IBM Anti Virus

From: Sushenjit Bandyopadhyay <bandyo@wam.umd.edu>

I don't need a retail copy of NAV for OS/2.  I got mine when I called 
Symantec and told them I have IBM AV and I want to upgrade to NAV for 
OS/2.  They sent it free and didn't ask for any proof.  

Now it seems they are charging some $9.95.  It seems odd that they 
would upgrade single licence but not sell them.

In principle I agree that (a threat of) a class action suit may help 
move that matter along.

Sushenjit

>>>>>>>>>>>>>>>>>> Original Message <<<<<<<<<<<<<<<<<<

On 9-10-99, 12:00:49 PM, Bob Germer <bobg.REMOVEME.@pics.com> wrote 
regarding Re: IBM Anti Virus:


> On <9ddCdfeFk555-pn2-SdMNbMs42God@localhost>, on 09/09/99 at 11:42 PM,
>    fwkirk@ibm.net (Frank Kirk) said:

> > On Wed, 8 Sep 1999 10:35:02, Bob Germer <bobg.REMOVEME.@pics.com>
> > wrote:

> > > Hmm, I just went to their website. I AM sending a copy of this message 
to
> > > custserv@symantec.com. I wonder if THIS will garner a response

> >     Don't hold your breath.  If you receive a response, it'll probably 
be a
> > standard form letter;  "Thank you for your interest, blah, blah,  
blah.

> >     Someone recently put me on hold for a long time while I listened 
to
> > recordings telling me "your call is important to us", shortly before I
> > was disconnected.

> Oh, I got the same treatment, but I was more persistent. I finally got
> through to a live human being. Here in a nutshell is the gist of the
> conversation:

> One must buy the "Enterprise" CD which contains NAV for OS/2 as well 
as
> for NT, Win95, Win98, DOS, MAC, and some others. Plus one must also 
buy
> site licenses for a MINIMUM of 10 users. One can only buy those items 
from
> a reseller. A reseller must contact a "Symantec Specialist" at Ingram 
to
> get the part number and order the software and license. THEN, and ONLY
> then will Symantec ship the product to Ingram which in turn will ship 
to
> the reseller.

> The 10 user license is a site license. There is no provision for the 
SOHO
> market since "OS/2 is deployed only in large companies" according to a
> management contact I finally made by calling the headquarters of 
Symantec.
> Since I was so "upset" she offered to send me a complimentary copy. I 
told
> her I would rather institute a class action lawsuit against Symantec, 
that
> I have clients with 3,4,5 etc. workstations who want the product and 
are
> unwilling to pay for software for computers they don't own, software 
for
> operating systems they do not use, and for 3 or more times the number 
of
> machines they own.

> They only sell NAV for Windows and NT as "retail" packages. They sell 
for
> $36 from Symantec but for under $30 from various retailers.

> I then called Indelible Blue. They neglected to include OS/2 as one of 
the
> various platforms supported by the Norton AntiVirus Solution CD which 
they
> sell for $207. In addition, one must buy a minimum of 10 site licenses 
at
> $39 each. Thus the SOHO or individual user must pay a MINIMUM of $597 
plus
> shipping for what Windoze users get for under $30.

> Now I see two possible solutions here.

> One, and the one I am leaning toward, is to file a breach of contract 
suit
> against Symantec based upon the press releases issued at the time they
> took over IBM's antivirus product. Possibly IBM would also have to be 
a
> party defendant to the suit since otherwise Symantec could claim, in
> defense, that IBM wanted them to eliminate the SOHO and individual 
user
> after promising support, applications, etc. for OS/2 which induced us 
to
> buy the OS in the first place.

> It would not cost nearly the price of the CD and 10 licenses for an
> individual to file a suit. If a dozen or so do it at the same time, 
the
> suits would be combined into a class action on behalf of all 
purchasers of
> OS/2.

> Naming IBM as co-defendant would probably get IBM to force Symantec to
> release individual copies of the software to end users rather than be
> charged by Symantec as the instigator of the policy. It would bring 
IBM
> "out of the closet" so to speak regarding its non-support of OS/2
> purchasers. If Symantec has documents, etc. to prove that IBM 
deliberately
> wanted to keep the software from end users and SOHO's it would put IBM 
at
> risk of a second class action suit from both users and ISV's.

> The second solution would be for a group of users, SOHO's, etc. to 
form a
> non-profit corporation, pool our money, and buy one copy of the 
software
> and the requisite licenses. This is afterall an "enterprise" CD with
> server versions, etc. as well as workstation versions. I was informed 
that
> the user licenses were not based on a physical site, but on the total
> number of licenses an enterprise wanted for its total number of
> workstations, servers, etc.  they wished to protect.

> This would reduce the cost of each copy to around $75 per copy. The 
site
> license is $39. The cost of copying the CD and shipping one each would
> raise the end user price to $75 or so after adding the distributed 
cost of
> forming a non-profit company, opening a bank account, etc.

> I am sure that there might be a price break if someone wanted to buy 
say
> 500 or a thousand licenses. That could conceivably reduce the cost 
even
> more.

> I had a discussion with a representative of Indelible Blue regarding 
this
> matter. This person told me that there have been many, many calls for
> individual copies of the OS/2 product. I have a call into Buck Bohoc, 
the
> owner of IB, and I will explore the matter with him, hopefully today.

> IF enough people in the OS/2 community are interested in getting NAV 
and
> willing to pay less than $80 per copy, I will explore the first option 
at
> length with my company's lawyer. If this doesn't look promising, I 
will
> refine idea 2. I personally would be willing to absorb the cost of 20 
or
> 30 copies and setting up the non-profit enterprise based upon promises 
of
> purchase. However, I am not willing to put out the cost for more than
> that. Some sort of pre-payment or at least partial pre-payment would 
be
> necessary for me to foot the entire up-front costs.

> So, if anyone is really wanting NAV for Warp, please do 3 things:

> 1. Respond here. I am saving this thread to use as a hammer on 
Symantec.

> 2. Email me at bobg@pics.com (NOTE just clicking on a CC button to 
this
> posting will not get to me. You must change the anti-spam automatic
> address) so that I can be sure of getting your message.

> 3. Search your disks, etc. for any announcement material issued by IBM 
and
> Symantec in the event we decide to file a class action.

> And if you really want to help, cross-post this message to every OS/2
> related and MAC workgroup. MAC users could also purchase from the
> non-profit if we go that route.

> Bob Germer

> PS. Regarding the non-profit company. I would likely list its purpose 
as
> to raise money for Jerry's Kids (The Muscular Disease Foundation) or 
some
> similar eleemosynary organization. $1 of every "purchase" would be 
sent to
> the charity.

> --
> 
-----------------------------------------------------------------------
-----------------------
> Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
> Proudly running OS/2 Warp 4.0 w/ FixPack 8
> MR/2 Ice Registration Number 67
> Aut Pax Aut Bellum
> 
-----------------------------------------------------------------------
-----------------------



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Maryland College Park (1:109/42)

+----------------------------------------------------------------------------+

From: jasper.dekeijzer@worldonline.nl                   10-Sep-99 20:53:25
  To: All                                               10-Sep-99 19:59:23
Subj: DrawIt support.

From: jasper <jasper.dekeijzer@worldonline.nl>

Dear OS/2 user.

The support for DrawIt for OS/2 Warp is available via a new e-mail
address. The old compuserve account which is described in the online
help is closed. For support and questions please e-mail to
jasper.dekeijzer@worldonline.nl

The DrawIt homepage can be reached with the following link

http://home-5.worldonline.nl/~jdekeij


Whithin a few weeks I will send updates to BMT to get the addresses
fixed in the onlinehelp.

The following topics will be addressed in the new release:

1 - Saving in the JPEG format. Currently JPEG images can only be read.
2 - Flipping text vertical/horizontal is broken in the last release and
will be fixed.

If you have ideas, what should be included in the packed, please let me
know.

Have fun,
Jasper de Keijzer.
The development of DrawIt is a never ending story!


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: WorldOnline News server (1:109/42)

+----------------------------------------------------------------------------+

From: etschmeisser@tasc.com                             10-Sep-99 12:28:18
  To: All                                               10-Sep-99 19:59:23
Subj: DATMAN software under os/2?

From: elmar schmeisser <etschmeisser@tasc.com>

Assembled gurus:

Corresponding with Kan Yabumoto of Pixelab, Inc.
(http://www.datman.com), he writes:

"We heard a year or so ago that some OS/2 experts succeeded in running
DATMAN-DOS under OS/2.  But, we do not have details.."

Deja-news does not catalog any such occasion.  The relevent item seems
to be that DATMAN-DOS uses a real mode driver for aspi : 

"That is, DATMAN-DOS is a TSR which behaves very much like MSCDEX.EXE
both of which are "Network Redirector" in order to assign a drive letter
to the system and all file I/O API goes through the pretty much
"undocumented" INT 2FH."

Does anyone have any imformation on this?

thanks
-- 
p.s. this server gets only about 30% of the news posts.  E-mail in
parallel to 
elmar.schmeisser@hedo.brooks.af.mil would be greatly appreciated.

- elmar
--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: warped with os/2 (1:109/42)

+----------------------------------------------------------------------------+

From: anon@anonymous.co.uk                              10-Sep-99 19:52:21
  To: All                                               10-Sep-99 19:59:23
Subj: Re: Req: Old software Lotus 123G v2.0 -> v2.1 update

From: anon@anonymous.co.uk (Steve)

On Thu, 09 Sep 1999 18:39:12 -0400, letoured@sover.net wrote:

Hi

If you do remember I'd be most grateful. I knocked up a quick
request  letter with the intention of emailing it to Lotus but I can't
even find an email address for customer support. 

Their customer support page offers a list of local support centers
you click on UK, and get a blank page.  Same result for Denmark,
Finland, France, Italy etc.

So I tried the US link. Great... I get a page. So I go to the 'contact
us' page and try to use the links to fill in the forms there. Clicking
on the 'Product Form' link throws up a "Error 500 HTTP Web Server:
Lotus Notes Exception - Invalid document identifier" message.
Ckicking on the 'Inquiry Form' link produces the same message as does
the 'Lotus Web Site Form' link.

Typical big company web site. To contact us click on this link, now
this, and this. 10 links later and you're back where you started.

Do you happen to know if Lotus has any support centers in the UK or do
you know an email address for the UK (or US) support center ?.

If you remember that path please drop me a line or write back here.
I really need this update.

Thanks

Steve 

>Most of the old Lotus stuff is archived in some obscure place. I don't
>remember what they call it, but I've found it a few times in the past --
>twice by accident, and once because I knew where to look.  Unfortunately,
>I don't remember the path right now. 

<snip>
>
>_____________
>Ed Letourneau <letoured@sover.net>
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Customer of Planet Online (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  10-Sep-99 20:21:27
  To: All                                               10-Sep-99 19:59:23
Subj: Re: DB2 and NETQOS2

From: prather@infi.net (Jerry Prather)

In message
<wrssqnivfvozarg.fhthu11.pminews@news-s01.ny.us.ibm.net> - "Jeff
Davis" <Jeff.davis.no@spam.ibm.net> writes:
:>
:>Does anybody have this working on a standalone system (no NIC card) 
:>Following some advice from Darin and by taking a shot in the dark I now get
:>the message that it has started but I still can't search I get the message
:>"NetQ message: The specified NetQuestion server is not available. (rc=33)"
On
:>the other hand my Visualage Java search now works.  What I did based on info
:>from Darin and SNIFFLE was to assign a TCP address to LAN 0 even though I
:>don't have a NIC card.  As a result I have the following 
:>localhost 127.0.0.1
:>
:>LAN0 127.0.0.1 mask 255.255.255.0 
:>
:>TCP 4.1, Fixpack 11 and JAVA 1.1.8
:>
:>The rest of DB2 seems fine so I will struggle to get JAVA to red and write
to
:>DB2.
:>
:>Help or suggestions on NETQ would be cheerfully appreciated.

You're farther along than I am.  DB2 apparently installed OK.  I
was able to get the sample database installed (supposedly).  I
then installed the documentation and the control center.  First
Steps opens up and says that I can view the database by pressing
a button.  The hard drives whirr, but nothing happens except that
I get an error:
    [JDBC Driver] CL1061E.  Error opening socket. 
SQLSTATE=08S01.

I looked at the Net.Question thread, but I don't think I'm far
along enough for that to be applicable yet.  Like you, I'm on a
stand alone machine and would like to install and communicate
with VAJava 2.0.

Good luck,

Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           10-Sep-99 20:28:28
  To: All                                               10-Sep-99 19:59:23
Subj: Re: BOOTOS2 doesn't work for me!!!!! Help!!!!!

From: doug.bissett"at"ibm.net (Doug Bissett)

On Thu, 9 Sep 1999 19:35:19, kenkahn@us.ibm.com wrote:

> I'm open for suggestions.  One I've been thinking of
> is to have BOOTOS2 prompt the user while processing
> each BASEDEV driver and ask if it should be added.
> Optionally, or additionally, I could allow for an
> alternate text file that would list those drivers
> in your CONFIG.SYS that you didn't want added to a
> boot disk.  Maybe we could come up with a minimal
> file of this type that I would distribute (my AWE64
> card only has DEVICE drivers, no BASEDEVs).
>  
> --
>  
> Kenneth Kahn - IBM P/390 Software Development (and
> BOOTOS2 Author)
>  

Something does need to be done, and not just with BOOTOS2 (EXCELLENT 
piece of work, by the way).

It is difficult to make a blanket statement about what is, or is not, 
required. I have a Parallel port ZIP drive, and need to add the 
driver, and  a line in CONFIG.SYS, after creating the BootOS2 
diskettes (it is a "DEVICE=" statement). I also have a SCSI adapter 
(for a scanner), which does get automatically added, but is totally 
useless in a diskette boot situation. In addition, the sound card, 
LAN, and USB drivers may, or may not, be required, depending on what 
you are doing.

The other MAJOR problem, is that a lot of user's have no idea about 
what line in CONFIG.SYS loads what support, and it would be almost 
impossible to account for all (or even most) of the possibilities, in 
your program.

Perhaps, what is required, is a pre-processor, that will strip out all
of the BASEDEV statements, and put them into a file, with a 
description, if they are a standard (well known) device, or "Unknown" 
if they are not in a basic list of devices (another file, that could 
be editable, so user's can add their own device descriptions -> 
perhaps, a second file for user definitions <-). <Perhaps, you could 
make use of the 'ConfigMaint/2'  package (there is a comprehensive 
list of BASEDEV devices in there), I suspect that the authors of that 
are just as interested as you are to get this thing working.>The user 
could then be prompted to remove any of those lines that (s)he knows 
are not required, with a suggestion to remove any "Unknown" lines 
first, if they are not sure. 

A similar approach could be used for "DEVICE=" statements, so devices 
like the PP ZIP drive could be picked up automatically (not all that 
easy, since you may need more than just the driver file to make it 
work). 

Then, you just install what is left in the list, with a warning that 
the user should *TEST* the results, to be sure that it works, as 
expected.

The whole thing sounds like a lot of work, but the only other option, 
I can think of, is to increase the storage size of the diskettes (I 
don't think you can boot from XDF format diskttes, but that extra 400K
would make a big difference), which gets you into another whole "bag 
of snakes", unless you can figure out a way to spread the joy over 
more diskettes (I expect that this is impossible, since you haven't 
done it).

I am down to 1024 bytes left on my first disk, so I expect to have the
"problem" in the near future.

A couple of other things, while I have your attention:

You use generic settings for the HPFS.IFS, and DISKCACHE statements. I
always change them to match what I normally use. It is not really all 
that important, but it does speed things up when I do things like 
restore, or CHKDSK.

There are a couple of files that you need to pull off of the CD. This 
can be bypassed by puting those files on the hard disk, and pulling 
them from there. It would be nice, if you could specify the location, 
and, if the files are not already there, to copy them to the hard 
disk, from the CD, for later use (or, do this automatically, so the CD
is required only for the first try).

Thanks for a GREAT program, and thanks for listening...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           10-Sep-99 20:28:29
  To: All                                               10-Sep-99 19:59:23
Subj: Re: IBM Anti Virus

From: doug.bissett"at"ibm.net (Doug Bissett)

On Fri, 10 Sep 1999 12:00:49, Bob Germer <bobg.REMOVEME.@pics.com> 
wrote:

> The second solution would be for a group of users, SOHO's, etc. to form a
> non-profit corporation, pool our money, and buy one copy of the software
> and the requisite licenses. This is afterall an "enterprise" CD with
> server versions, etc. as well as workstation versions. I was informed that
> the user licenses were not based on a physical site, but on the total
> number of licenses an enterprise wanted for its total number of
> workstations, servers, etc.  they wished to protect.
>  
> This would reduce the cost of each copy to around $75 per copy. The site
> license is $39. The cost of copying the CD and shipping one each would
> raise the end user price to $75 or so after adding the distributed cost of
> forming a non-profit company, opening a bank account, etc.
> 

I support whatever you think is best. 

I am beginning to think that *WE*, the OS/2 user's, could be an 
"ENTERPRISE". If we ALL pool our dollars (invest $80 in the 
"company"), we could buy a single copy, with a few thousand licences 
(should be even cheaper than $80). All that would be required, is to 
set up a site with the original disk, available on a FTP server 
(password protected, so you need to pay your bucks to become a part of
the "enterprise"). I suspect that there would be some legal thing to 
prevent that, but it might be worth investigating. Perhaps BMT micro, 
or IB would take that on (IB already sells site licenses etc.). After 
all, even IBM wouldn't buy more than one copy of the CD (well, they 
might, but they shouldn't), and would just make it available on their 
intranet for all who need it.

It might also be possible to do the same thing with OS/2 itself, after
all, IBM is only interested in selling, and supporting, large 
"enterprises", and a few thousand user's would be as big as any 
"enterprise". (A COMMON share, gets you access to NAV, a PREFERED 
share gets you access to OS/2, or something like that). All you would 
need is a set of install disks that would get you connected to the 
internet, and do a CID install of OS/2.

I am sure that the technical details can be worked out (the legal 
details might be more difficult). There are a LOT of very knowledgable
people in the OS/2 community. (Then again, why limit this to just the 
OS/2 community, the more site licences we can get, the lower the cost 
should be, and the software is already on the CD).

A great name for the company, would be "The Starship Enterprise", but 
I am sure that there would be legal problems with that <g>.

Perhaps. we can use IBM's, and Symantec's, lack of cooperation to nail
them to the wall <g>...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

+============================================================================+
