
                   comp.os.os2.multimedia           (Usenet)

                 Saturday, 04-Sep-1999 to Friday, 10-Sep-1999

+----------------------------------------------------------------------------+

From: sachmo@horn.net                                   03-Sep-99 22:00:20
  To: All                                               04-Sep-99 11:08:13
Subj: Re: FAQ for all multimedia

From: sachmo@horn.net

On Fri, 3 Sep 1999 13:36:18, nospam@sancoatjpsdotnet.void (Sander 
Nyman) wrote:

> I was fortunate to have seen one of Jerry's OS/2 multimedia presentations
> a few months ago.  EXCELLENT!!!  If you are into multimedia, this is a DO
> NOT MISS!  In fact, he has updated, and expanded his presentation for
> SCOUG's Warp Expo West.
 
Sander Nyman

	Trouble is I'm on the East Coast and can't get off to make the trip.

	Happen to have his email eddress?

Gene
---------------
pequod@gate.net

The minstrel boy to the war is gone
In the ranks of death you'll find him;
One sword, at least, thy rights shall guard;
Words shall never sound in slavery!
            --Thomas Moore (1779-1852)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CyberGate, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            04-Sep-99 04:53:07
  To: All                                               04-Sep-99 11:08:14
Subj: AWE32 and CSP in DOS-VDM's?

From: mike.luther@ziplog.com

How can I enable the CSP feature for the Creative Sound cards in OS2
DOS-VDM sessions?

I have an AWE32 working, plays audio in OS/2, WIN-OS2, CD-ROM's et. al.,
but when trying to activate some of the older SB16 voice tools and the
Creative Software Developer's pack in DOS-VDM sessions, the SB16
routines and the SBTALKER routines collapse into SYS3170 errors as
speech starts!

It's apparently related to other I/O .. the play from files mode in the
start of programs works fine in DOS, as does the CD-ROM and so on.
However, if you try the TESTSB16 uility, everything works, 2 port and 4
port music et. al., until you get down to the TEST right/left, whereupon
that collapses immediately into SYS3170..

Further, the test program for SBAITSO# initializes fine, speaks to you
fine, then as soon as you begin tyoing I/O into the keyboard, it
collapses first into a print/screen mode collapse, dumping the screen to
the printer, and also subsequently tossing a SYS3170 error here too!

I note that CSP.SYS is a loadable driver, but on asking that you load it
with the required /P:220 port switch, the DOS-VDM session tells you that
it can't locate the CSP stuff.  Without CSP/ASP, it seems that more
modern tools for these units are useless too.. :(

As far as I know all the IRQ/Port/DMA conflicts have long ago been
resolved.  The drivers and the card all match at:

          Port  = 220
          IRQ   = 5
          LoDMA = 1
          HiDMA = 5
          Gport = 330

The hardware trace utility in SYSTEM does not reveal any conflict with
any of this and I'm certain that the network card and other cards aren't
in conflict.

It acts like, somehow, IRQ5 is being yanked as if LPT2/IRQ5 were in
vogue and mapped, as well as the standard LPT1/IRQ7 to the line printer,
but I've checked that and it isn't so ..

The SYS3170 popup is:

09-04-1999  04:20:34  SYS3170  PID 002f  TID 0001  Slot 0060
C:\OS2\PMSHELL.EXE
01e08000
00000000
EAX=00000003  EBX=00000004  ECX=00000000  EDX=00000000
ESI=00000040  EDI=0000061c
DS=0040  DSACC=1092  DSLIM=000003bf
ES=2020  ESACC=1092  ESLIM=00010fff
FS=0000  FSACC=****  FSLIM=********
GS=0000  GSACC=****  GSLIM=********
CS:EIP=e001:0000e171  CSACC=****  CSLIM=********
SS:ESP=ae46:000072a0  SSACC=****  SSLIM=********
EBP=00000000  FLG=000a2202

I feel like if I could enable the CSP function, I could get away from
the older developer's code in DOS that is causing this..

Any suggestions?


--> Sleep well; OS2's still awake! ;)

Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: jaylord@NOWHERE.com                               04-Sep-99 16:14:28
  To: All                                               04-Sep-99 16:39:02
Subj: Re: Aopen AW37 - DMA conflict

From: jaylord@NOWHERE.com (Jay Schamus)

In message <936318045.1@natureboy.dyn.tj> - derek.vance.steel@natureboy.dyn.tj
writes:
:>
:>Hello All.
:>
:>I have installed an Aopen AW37 (4235 chipset) into one of the OS/2
:> boxes, the driver from Crystal installed fine.
:>
:>Problem: During startup RM (Resource Manager?) says DMA 0 conflict.
:>
:>This machine already has: SCSI 2940UW, Hauppage Win/TV, Dlink 530TX,
:> Matrox G100. As you can see it is quite full, as a matter of fact
:> there are no slots of any kind left in it.
:>
:>
:>How can I get the AW37 to use a different DMA?
:>^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
:>
:>I know that when I was using an AWE32 pnp, that I could change the
:> dma being used by changing the config sys parameter, previously I
:> had to because the 2940UW was using the dma channel that the AWE32
:> was using.
:>
:>Is there something similiar that can be done for the Aopen AW37?
:>
:>

I know in the 1.73 drivers you could add a /o to the end of the cwadudio.sys
line in config.sys to override PnP, but looking at the 2.07 drivers I see no
mention of it, so I'm not sure it still works.  Of course, why have all those
settings in that line if they can never have any effect.  By the way, did you
make sure you enabled full hardware detection for your next bootup in hardware
manager properties? 


|
| Jay Schamus
| jaylord@NOWHERE.com (replace 'NOWHERE' with 'gemair')
|
| "Meanwhile to the northwest, storm clouds gather over the
|  new Barad-Dur.  The Dark Lord stirs..."
|

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: neobasic@aol.com                                  04-Sep-99 16:28:26
  To: All                                               04-Sep-99 16:39:02
Subj: FREE 16 high-quality FLI/FLC videos

From: neobasic@aol.com (NeoBASIC)

FREE 16 high-quality FLI/FLC videos
http://members.aol.com/neobasic

Click Files | [00.00] FREE FLC & FLC Videos
_______________________________________________________
Programming Is Easy When You Make It NeoBASIC!

NeoBASIC Cut & Paste Programming
http://members.aol.com/neobasic 
VOICE MAIL & FAX: (516) 514-4128

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AOL http://www.aol.com (1:109/42)

+----------------------------------------------------------------------------+

From: dave@nospam.freeserve.co.uk                       04-Sep-99 18:33:20
  To: All                                               04-Sep-99 20:09:00
Subj: Netscape and mpeg

From: "Dave Saville" <dave@nospam.freeserve.co.uk>

I am trying to get the netscape plug ins to work - yes I know I am an idiot
:-)

Without the plug ins it goes to the netscape plugin pages when you try and
open a mpg file. 
With the plugins it says it can't open the multimedia device and it does not
like the file.

The plugin readme goes on about an openmpeg page in the multimedia setup
notebook - 
but I do not have such a page. Any ideas???

Warp4 at FP9 Netscape 2/99+latest fp

TIA

Regards

Dave Saville

NB switch saville35 for nospam in address


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Customer of Planet Online (1:109/42)

+----------------------------------------------------------------------------+

From: never@tvol.it                                     05-Sep-99 09:44:01
  To: All                                               05-Sep-99 10:23:21
Subj: QuickCam VC USB

From: never@tvol.it (Zamp)

Hi

Did you know any app. support for subj ?

Conoscete se qualche applicazione supporta la Quickcam USB ?

Thanks.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Centro Servizi Interbusiness (1:109/42)

+----------------------------------------------------------------------------+

From: never@tvol.it                                     05-Sep-99 13:04:22
  To: All                                               05-Sep-99 14:48:26
Subj: QuickCam USB

From: never@tvol.it (Zamp)

Hi
 
Did you know any app. support for subj ?
 
Conoscete se qualche applicazione supporta la Quickcam USB ?
 
Thanks.
 
 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Centro Servizi Interbusiness (1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       04-Sep-99 13:07:06
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Which photography applications work well with OS/2 for postprocessi

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

On Thu, 02 Sep 1999 20:21:26 +0300 (EES), esko.kauppinen@ibm.net wrote:
>On Wed, 01 Sep 1999 20:55:38 GMT, whkleinw@ccmaui.com wrote:
>
>>I just got a digital camera today and now I have to find a good
>>application to postprocess my photographs (PhotoShop, etc.).
>>Which applications will run under OS/2?  How do they run (OS/2
>>application, DOS application, Win3.1 Application)?
>
>I use PMView to have a first look and maybe to little adjust the
>colors and brightness.
>
>Then I save it and open it with Embellish. With it I add some 
>text and arrows etc. 

Exactly what I did yesterday!! Need a easy to use app for 
the exact purpose!!

I seem to be going for PMview as well!!

Cheers
Chris



-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: khpeter@onr.com                                   05-Sep-99 12:52:20
  To: All                                               06-Sep-99 04:16:14
Subj: Re: Which photography applications work well with OS/2 for postprocessi

From: khpeter@onr.com

In <c1.2b5.2S40Q8$08j@SCOTGATE2.DEMON.CO.UK>, on 09/04/99 
   at 01:07 PM, chris@scotgate2.demon.co.uk (Chris H Lindley) said:

>On Thu, 02 Sep 1999 20:21:26 +0300 (EES), esko.kauppinen@ibm.net wrote:
>>On Wed, 01 Sep 1999 20:55:38 GMT, whkleinw@ccmaui.com wrote:
>>
>>>I just got a digital camera today and now I have to find a good
>>>application to postprocess my photographs (PhotoShop, etc.).
>>>Which applications will run under OS/2?  How do they run (OS/2
>>>application, DOS application, Win3.1 Application)?
>>
>>I use PMView to have a first look and maybe to little adjust the
>>colors and brightness.
>>
>>Then I save it and open it with Embellish. With it I add some 
>>text and arrows etc. 

>Exactly what I did yesterday!! Need a easy to use app for 
>the exact purpose!!

>I seem to be going for PMview as well!!

>Cheers
>Chris

Another tool might be Photographics pro from True Spectra.  They have quit
marketing it but instead have placed it as a FREE download on their
support web site  http://www.truespectra.com/support.html until the end of
the year.

Download and follow the instructions to register it.  The result is a full
featured copy of a very well respected graphich program for OS/2.

-- 
-----------------------------------------------------------
"Kurt Petersen" khpeter@onr.com
Happily warped from Austin TX.
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Onramp Access, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: torsten.balle.koefoed@somewhere.dk                06-Sep-99 18:23:17
  To: All                                               06-Sep-99 16:46:13
Subj: Yamaha YMF724 drivers

From: torsten.balle.koefoed@somewhere.dk (Torsten Balle Koefoed)

Has anyone tried the new Yamaha YMF724 drivers?

Yours etc.
  Torsten Balle Koefoed

(Replace servername in address with: writeme<dot>com)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CyberCity Internet (1:109/42)

+----------------------------------------------------------------------------+

From: rjerant@no_spam,austin.rr.com                     06-Sep-99 18:51:05
  To: All                                               06-Sep-99 19:51:14
Subj: Re: Aopen AW37 - DMA conflict

From: rjerant@no_spam,austin.rr.com (Rich Jerant)

On Sat, 04 Sep 1999 16:14:56 GMT, jaylord@NOWHERE.com (Jay Schamus)
wrote:

>In message <936318045.1@natureboy.dyn.tj> -
derek.vance.steel@natureboy.dyn.tj
>writes:
>:>
>:>Hello All.
>:>
>:>I have installed an Aopen AW37 (4235 chipset) into one of the OS/2
>:> boxes, the driver from Crystal installed fine.
>:>
>:>Problem: During startup RM (Resource Manager?) says DMA 0 conflict.
>:>
:>    snip....
>:>
>:>How can I get the AW37 to use a different DMA?
>:>^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
>:>
>:>I know that when I was using an AWE32 pnp, that I could change the
>:> dma being used by changing the config sys parameter, previously I
>:> had to because the 2940UW was using the dma channel that the AWE32
>:> was using.
>:>
>:>Is there something similiar that can be done for the Aopen AW37?
>:>
>:>
>
>I know in the 1.73 drivers you could add a /o to the end of the cwadudio.sys
>line in config.sys to override PnP, but looking at the 2.07 drivers I see no
>mention of it, so I'm not sure it still works.  Of course, why have all those
>settings in that line if they can never have any effect.  By the way, did you
>make sure you enabled full hardware detection for your next bootup in
hardware
>manager properties? 
I think Joe removed the /o option because if you boot with full
hardware detection the resource manager will come up with good system
resources. Make sure you go to the resouece manager's properties and
enable full hardware detection for your next boot. That should
straighten things out...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@nospam.noway.com                           06-Sep-99 17:53:22
  To: All                                               07-Sep-99 05:46:02
Subj: ESS ES1978S

From: "Roberto F. Salomon" <nospam@nospam.noway.com>

Has anyone got this card to work under OS/2?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: nospam (1:109/42)

+----------------------------------------------------------------------------+

From: rjlockie@home.com                                 06-Sep-99 22:35:18
  To: All                                               07-Sep-99 05:46:03
Subj: Re: QuickCam VC USB

From: rjlockie@home.com (Bob Lockie)

In message <VKgw72RDdCmL-pn2-f4LwuF0b9dn1@dmb24.tvol.it> - never@tvol.it
(Zamp)5 Sep 1999 09:44:02 GMT writes:
:>
:>Hi
:>
:>Did you know any app. support for subj ?
:>
:>Conoscete se qualche applicazione supporta la Quickcam USB ?

There is no USB version of the driver.

OS/2 and WinNT support the parallel version only.

http://www.shadow.net/~senja/qv2indx.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              06-Sep-99 20:14:03
  To: All                                               07-Sep-99 15:25:24
Subj: Re: How to ...

From: "J. R. Fox" <jr_fox@earthlink.net>

Martin Racette wrote:
> 
> On Thu, 2 Sep 1999 17:52:09,
> jdc0014@InfoNET.st-johns.nf.ca (John
> Hong) wrote:
> 
> > Martin Racette (racette@cablevision.qc.ca) wrote:
> >
> > : I would like to know How to copy the
> > : content of an Audio cassette (music), to
> > : a CD-R while using RSJ
> >
> >       I don't think there is a way to do that directly onto a CDR
> > program.  Basically it would be a two-step process, get Digital Audio in
> > your Multimedia directory to store the song in .WAV file format first.
> > I've yet to try this, but you should be able to play the song on your
> > stereo and have it hooked up to your soundcard in the in-line plug and to
> > record with Digital Audio with the source being in-line.
> >
> >
> 
> So basicly I hvae to do it on a song per
> song ! :-/
> 
> //-------------------------

I don't really know what I'm talking about here, but you may
want to check out a shareware OS/2 program called TWAVE.  There
are a couple users on Compuserve who I think are using this to
put tracks from LPs and reel-to-reel tapes into digital form -- 
probably .WAV files on the h/d, which could then be converted
into MP3 format, or whatever.  I suspect that TWAVE works with
CDs too.  Of course, you'd then have to go from your h/d to a
new cd using RSJ.  I doubt you'll find a one-step solution.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: C.J.@btsoftware.com                               07-Sep-99 10:52:08
  To: All                                               07-Sep-99 15:25:24
Subj: Check Out  DCITU

From: "C.J." <C.J.@btsoftware.com>

DCITU 
*********

Digital Camera Image Transfer Utility.

This program allows images to be transferred from various digital cameras to
an OS/2-based computer. The transfer is accomplished using the standard
serial port  cable usually supplied with the camera. Currently supported
cameras include various
models from Kodak, Agfa, Epson, Olympus, Sanyo, Sierra and Toshiba. 
More information on the camera models is available from DCITU Beta
Information Page 

Check it out and download DCITU for a free trial period from:
http://www.btsoftware.com/os2/dcitu.htm


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: C.J. (1:109/42)

+----------------------------------------------------------------------------+

From: sporadic@my-deja.com                              07-Sep-99 16:15:26
  To: All                                               07-Sep-99 20:34:10
Subj: Re: Ensoniq ES1371 Driver

From: sporadic@my-deja.com

Well, since no one had a solution, I decided to swap the cards myself
(had time to kill with long weekend and all.)

I managed to isolate the ES1371 on a dedicated IRQ (15, since I am
running a SCSI based system, the secondary IDE channel is disabled.)
However, OS/2 still could not detect the device.  I tried the ALT-F1 and
redetect, and having the Hardware Manager detect all hardware and newly
install hardware.  For whatever reason, it just won't see the card.

Regards,

Jimmy


In article <37cf1fe6$1$fnaqyva$mr2ice@news.connecti.com>,
  sandlin@connecti.com wrote:
> In <7qmcq5$r63$1@nnrp1.deja.com>, on 09/02/99
>    at 05:40 PM, sporadic@my-deja.com said:
>
> >I am having some problem with the newly released ES1371 driver.  The
> >problem I think I'm having is that OS/2 can't see the board because
of
> >the shared IRQs.
>
> Just to let you know you aren't alone!
>
> I have the FIC-503+ with an AMD K6-2 @ 350 MHz, Diamond Viper V330
> (another not quite supported board), Eagle Tape Accelerate and TR3
drive,
> Info Products Scanner and interface, and Atlas 33.6 modem.  And of
course,
> the Ensoniq sound card (love the sound in Win95 - wish I could get it
in
> Warp).
>
> Somewhere, we must have a driver blocking the system from finding the
> board.  I have full hardware detection run each time I reboot.  Yet
only
> the sound card isn't recognized.
>
> If you get an answer offline, be sure to post it here, too!
>
> -- --------------------------------------------------------
> John B. Sandlin
> sandlin@connecti.com
> AOL Instant Messenger: CapnPBX
> ICQ: 8735342   <http://wwp.icq.com/8735342>
> -----------------------------------------------------------
>
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         07-Sep-99 17:14:11
  To: All                                               07-Sep-99 20:34:10
Subj: Re: How to ...

From: racette@cablevision.qc.ca (Martin Racette)

On Tue, 7 Sep 1999 00:14:07, "J. R. Fox"
<jr_fox@earthlink.net> wrote:

> Martin Racette wrote:
> > 
> > On Thu, 2 Sep 1999 17:52:09,
> > jdc0014@InfoNET.st-johns.nf.ca (John
> > Hong) wrote:
> > 
> > > Martin Racette (racette@cablevision.qc.ca) wrote:
> > >
> > > : I would like to know How to copy the
> > > : content of an Audio cassette (music), to
> > > : a CD-R while using RSJ
> > >
> I don't really know what I'm talking about here, but you may
> want to check out a shareware OS/2 program called TWAVE.  There
> are a couple users on Compuserve who I think are using this to
> put tracks from LPs and reel-to-reel tapes into digital form -- 
> probably .WAV files on the h/d, which could then be converted
> into MP3 format, or whatever.  I suspect that TWAVE works with
> CDs too.  Of course, you'd then have to go from your h/d to a
> new cd using RSJ.  I doubt you'll find a one-step solution.
> 
> <jf>
> 

Thanks for the infornation, I'll check 
that later on and let you now :-)

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  07-Sep-99 17:54:03
  To: All                                               07-Sep-99 20:34:11
Subj: Re: How to ...

From: prather@infi.net (Jerry Prather)

In message <37D458CF.283E@earthlink.net> - "J. R. Fox"
<jr_fox@earthlink.net> writes:
:>I don't really know what I'm talking about here, but you may
:>want to check out a shareware OS/2 program called TWAVE.  There
:>are a couple users on Compuserve who I think are using this to
:>put tracks from LPs and reel-to-reel tapes into digital form -- 
:>probably .WAV files on the h/d, which could then be converted
:>into MP3 format, or whatever.  I suspect that TWAVE works with
:>CDs too.  Of course, you'd then have to go from your h/d to a
:>new cd using RSJ.  I doubt you'll find a one-step solution.

PMFJI but this looked interesting to me as well.  I grabbed it
from the net and read the documentation.  A quick try-out later
and I registered it.  This is going to permit me to do some neat
things!

Thanks for the pointer.


Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: maxwarpyyy@xxxquasarbbs.com                       07-Sep-99 19:17:19
  To: All                                               07-Sep-99 20:34:11
Subj: Re: ESS ES1978S

From: maxwarpyyy@xxxquasarbbs.com (Massimo)

On Mon, 6 Sep 1999 20:53:45, "Roberto F. Salomon" 
<nospam@nospam.noway.com> wrote:

> Has anyone got this card to work under OS/2?

There're drivers (also updated) from ESS.

You can find it here:

ftp.quasarbbs.com/os2/drivers/audio/ess

But my experience with that chipset is a wps hanging on startup and 
nothing more...

Anyway someones says (Ess programmer too..) they works fine.

See you. 

Massimo S.
  IBM OS/2 Warp 4
  Certified Engineer
  Sys Admin/Web Master
--------------------------
 http://www.dinosoft.it
 http://www.itline.it/os2
 http://www.quasarbbs.com
Efnet #Os2ita irc.telia.no
--------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: OS/2 at home! (1:109/42)

+----------------------------------------------------------------------------+

From: sandlin@connecti.com                              07-Sep-99 19:16:05
  To: All                                               08-Sep-99 05:26:21
Subj: Re: Ensoniq ES1371 Driver

From: sandlin@connecti.com

In <7r3dnb$ne4$1@nnrp1.deja.com>, on 09/07/99 
   at 04:15 PM, sporadic@my-deja.com said:

>I managed to isolate the ES1371 on a dedicated IRQ (15, since I am
>running a SCSI based system, the secondary IDE channel is disabled.)
>However, OS/2 still could not detect the device.  I tried the ALT-F1 and
>redetect, and having the Hardware Manager detect all hardware and newly
>install hardware.  For whatever reason, it just won't see the card.

I'm curious which chipset and CPU you have on that ABIT motherboard.  I
have an AMD K6-2 and the VIA MVP3 chipset.  I'm wondering if there is a
driver I should have or shouldn't have loaded, if this is an Intel
CPU/chipset thing, or what.  The card works well in Win95.  But in Win95 I
had to load an AMD specific Bus Master driver (not available for OS/2 as
far as I can tell) for the VIA chipset.

-- --------------------------------------------------------
John B. Sandlin 
sandlin@connecti.com
AOL Instant Messenger: CapnPBX
ICQ: 8735342   <http://wwp.icq.com/8735342>
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rappleby@cadvision.com                            07-Sep-99 20:42:10
  To: All                                               08-Sep-99 05:26:21
Subj: HomePage Publisher Training?

From: rappleby@cadvision.com (Ray Appleby)

Is there a manual or tutorial for HomePage Publisher?

Best Regards,
Ray Appleby                     rappleby@cadvision.com
[Team OS/2]                 Multitasking at OS/2 Warp4 Speed.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CADVision Development Corporation (http://www.cad
(1:109/42)

+----------------------------------------------------------------------------+

From: cstumpf@monmouth.com                              07-Sep-99 22:53:03
  To: All                                               08-Sep-99 05:26:21
Subj: Re: HomePage Publisher Training?

From: "Chris Stumpf" <cstumpf@monmouth.com>

The only docs, I know of are the help files that come with it and the faq on
the developer's website.


On 7 Sep 1999 20:42:20 -0700, Ray Appleby wrote:

:>Is there a manual or tutorial for HomePage Publisher?
:>
:>Best Regards,
:>Ray Appleby                     rappleby@cadvision.com
:>[Team OS/2]                 Multitasking at OS/2 Warp4 Speed.


		Chris Stumpf
		C.S.E. Computer Services
		Computer Consultant (OS/2, Lan, Wan, CTI)
		Serenity Systems Channel Partner
		IBM Certified Systems Expert - OS/2 Warp 4
		

web:    http://cse.anterras.net
email:	cse@anterras.net
phone: (732)918-2480



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Monmouth Internet (1:109/42)

+----------------------------------------------------------------------------+

From: btjin@home.com                                    08-Sep-99 03:50:28
  To: All                                               08-Sep-99 10:38:27
Subj: Dive and EnDive.  What's the diff?

From: btjin@home.com

Anyone know this answer to this?  Is EnDive (from Matrox) any better 
than regular DIVE?  I know it won't work with OpenMPEG or DIVE (under 
PMMPEG 3.3.2) when I have this option checked (i.e. I can't see 
anything when an MPEG is being played, just a black screen).

Burton Tjin

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: protch@irit.fr                                    08-Sep-99 10:27:14
  To: All                                               08-Sep-99 14:43:00
Subj: Re: Yamaha YMF724 drivers

From: Walter Protch <protch@irit.fr>


Torsten Balle Koefoed wrote:
> 
> Has anyone tried the new Yamaha YMF724 drivers?
> 
> Yours etc.
>   Torsten Balle Koefoed
> 

Yep !
I did but unfortunatelly I discovered I had an other trouble
with OS/2
He can't manage well plug and play so he can't give the card an IRQ
so as with may AHA1520 Grrrrr !!!!


-- 
======================================
Walter PROTCH
protch@irit.fr
______________________________________
Ainsi va la vie, ainsi va la FORCE !
======================================

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IRIT-UPS, Toulouse, France (1:109/42)

+----------------------------------------------------------------------------+

From: DPartridge@baltimore.com                          08-Sep-99 09:45:22
  To: All                                               08-Sep-99 14:43:00
Subj: Drivers for ESS Technology Canyon3D?

From: DPartridge@baltimore.com

Hi there,

I'm interested to see if anyone knows if there are drivers for
OS/2 for the ESS Technology Canyon3D chipset and in particular
for the Terratec SoundSystem DMX.  News of actual drivers or
of work in progress would be of great interest

--
David C. Partridge
Dpartridge@nospam.baltimore.com
David_C_Partridge@nospam.compuserve.com


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: mamodeo@stny.rr.com                               08-Sep-99 12:50:01
  To: All                                               08-Sep-99 20:57:23
Subj: Re: Dive and EnDive.  What's the diff?

From: Marty <mamodeo@stny.rr.com>

btjin@home.com wrote:
> 
> Anyone know this answer to this?  Is EnDive (from Matrox) any better
> than regular DIVE?  I know it won't work with OpenMPEG or DIVE (under
> PMMPEG 3.3.2) when I have this option checked (i.e. I can't see
> anything when an MPEG is being played, just a black screen).

EnDIVE is supposedly hardware accelerated DIVE.  DIVE is simply direct
video access.  EnDIVE allows the hardware to scale bitmaps in hardware. 
The Matrox implementation of EnDIVE is broken and shouldn't be used.

- Marty

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Global Services North -- Burlington, Vermont,
(1:109/42)

+----------------------------------------------------------------------------+

From: seansmith@racemark.com                            08-Sep-99 13:41:00
  To: All                                               08-Sep-99 20:57:23
Subj: FS/FT: SB16 Wave Effects (CT4171 ViBRA16x)

From: "Sean Smith" <seansmith@racemark.com>

    I'm looking to sell or trade this SB16 Wave Effects for a comparable
sound card which will work under OS/2 WARP 4.  I can't get this one to work.
I would be willing to trade for a standard (non-ViBRA16) SB16PnP or other
decent sound card of a similar value to the SB16WE.

    Sean



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: sporadic@my-deja.com                              08-Sep-99 18:42:26
  To: All                                               08-Sep-99 20:57:23
Subj: Re: Ensoniq ES1371 Driver

From: sporadic@my-deja.com

Hi John,

Since it look like we are the only two people using the ES1731, feel
free to email me directly if you wish.

The ABit BH6 is an Intel BX chipset (Pentium II/III) Slot 1 design.  The
AMD K6-2/Via MVP3 Win9x drivers shouldn't matter, since they are needed
to tell Win9x how to access the IDE controller, and for the motherboard
devices to be recognized by the Device Manager.  As far as I know, OS/2
usually doesn't need specific processor/chipset drivers.

Since I moved the ES1371 to a slot where it is NOT sharing an IRQ, and
OS/2 is still not seeing it (in the Hardware Manager), I don't think
it's a driver conflict.  When it was sharing IRQs with other devices,
then I was more incline to believe it's a driver conflict, or OS/2
inability to see devices sharing IRQ's.  However, the fact that OS/2
can't detect the device at all troubles me.

If I get a chance this weekend, I'm going to play around with it a bit
more.

Regards,

Jimmy


In article <37d5ab9e$1$fnaqyva$mr2ice@news.connecti.com>,
  sandlin@connecti.com wrote:
> In <7r3dnb$ne4$1@nnrp1.deja.com>, on 09/07/99
>    at 04:15 PM, sporadic@my-deja.com said:
>
> >I managed to isolate the ES1371 on a dedicated IRQ (15, since I am
> >running a SCSI based system, the secondary IDE channel is disabled.)
> >However, OS/2 still could not detect the device.  I tried the ALT-F1
and
> >redetect, and having the Hardware Manager detect all hardware and
newly
> >install hardware.  For whatever reason, it just won't see the card.
>
> I'm curious which chipset and CPU you have on that ABIT motherboard.
I
> have an AMD K6-2 and the VIA MVP3 chipset.  I'm wondering if there is
a
> driver I should have or shouldn't have loaded, if this is an Intel
> CPU/chipset thing, or what.  The card works well in Win95.  But in
Win95 I
> had to load an AMD specific Bus Master driver (not available for OS/2
as
> far as I can tell) for the VIA chipset.
>
> -- --------------------------------------------------------
> John B. Sandlin
> sandlin@connecti.com
> AOL Instant Messenger: CapnPBX
> ICQ: 8735342   <http://wwp.icq.com/8735342>
> -----------------------------------------------------------
>
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: green.eggs@and.spam                               09-Sep-99 01:57:14
  To: All                                               09-Sep-99 12:44:11
Subj: FT: SB16 Wave Effects (CT4170 ViBRA16XV) card

From: green.eggs@and.spam (Wildfire)

	I'd like to trade this SB16 for an older one without the ViBRA16 
chipset.  I've tried two different SB16's with the ViBRA16 chipsets 
and niether work under OS/2.  I know sound works with OS/2 WARP since 
I isntalled my CS4232 card and it works fine but is not compatible 
with my EMU8000 MIDI sound card in DOS/Windows 3.1.

	Anyone who would like to trade, please e-mail me at;

	wildfire@capital.net or
	seansmith@racemark.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: rjerant@no_spam,austin.rr.com                     09-Sep-99 04:09:00
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Drivers for ESS Technology Canyon3D?

From: rjerant@no_spam,austin.rr.com (Rich Jerant)

Hi David
No unfortunatly none of our Canyon 3D customers  have expressed
interest OS/2 drivers. Which is really too bad because the DMX card is
really nice. I wrote the Win 95/98 driver and was very impressed by
it.
Rich   
On Wed, 08 Sep 1999 09:45:45 GMT, DPartridge@baltimore.com wrote:

>Hi there,
>
>I'm interested to see if anyone knows if there are drivers for
>OS/2 for the ESS Technology Canyon3D chipset and in particular
>for the Terratec SoundSystem DMX.  News of actual drivers or
>of work in progress would be of great interest


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           09-Sep-99 17:52:04
  To: All                                               09-Sep-99 17:03:11
Subj: Re: Drivers for ESS Technology Canyon3D?

From: doug.bissett"at"ibm.net (Doug Bissett)

On Thu, 9 Sep 1999 04:09:00, rjerant@no_spam,austin.rr.com (Rich 
Jerant) wrote:

> No unfortunatly none of our Canyon 3D customers  have expressed
> interest OS/2 drivers. Which is really too bad because the DMX card is
> really nice. I wrote the Win 95/98 driver and was very impressed by
> it.
> Rich   
> 

Now, here is a self defeating attitude. ** Os/2 user's have not shown 
an interest in the card because there are no OS/2 drivers **. On the 
other hand, OS/2 user's keep on asking (perhaps "begging" is a better 
word) for ANY card that is supported, properly, under OS/2. So far, 
cards using the Crystal chip set (Cirrus logic) are winning the race, 
because they DO have OS/2 drivers, that DO work, quite well.

It would be interesting to know just how many Crystal based cards were
sold, because of the OS/2 support. 

I, personally, have bought 4 of them (not just for OS/2 systems 
either), and will continue to buy them, as long as they have the best 
OS/2 support (they work very well in the "other" op systems as well). 
When someone comes up with something better, I will buy that product.

Just my C$.03 ($.02 US)...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: djohnson@isomedia.com                             09-Sep-99 16:09:25
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Aureal and Generic WINOS2 driver

From: "David T. Johnson" <djohnson@isomedia.com>

lamikr wrote:
> 
> I am planning to buy Aureal soundcard but I would also like to have
> sound support under winos2. Has anybody tested generic sound-driver
> for winos2 which I have heard should be available on hobbes?
> 
> Mika

I have an Aureal Vortex 1 soundcard and use the generic Win-OS2 driver. 
It works as advertised and makes the various windows system sounds but I
have not been able to get it to play sound with Real Player 5.0. 
Basically, it produces sound in Real Player for about 8 seconds and then
stops.   The OS/2 sound, however, is very nice.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: sandlin@connecti.com                              09-Sep-99 18:40:15
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Drivers for ESS Technology Canyon3D?

From: sandlin@connecti.com

In <SKfw30zmCGmZ-pn2-KbPxtwfYnr9e@localhost>, on 09/09/99 
   at 05:52 PM, doug.bissett"at"ibm.net (Doug Bissett) said:

>Now, here is a self defeating attitude. ** Os/2 user's have not shown  an
>interest in the card because there are no OS/2 drivers **. On the  other
>hand, OS/2 user's keep on asking (perhaps "begging" is a better  word)
>for ANY card that is supported, properly, under OS/2. So far,  cards
>using the Crystal chip set (Cirrus logic) are winning the race,  because
>they DO have OS/2 drivers, that DO work, quite well.

I got my current sound card before OS/2 had PCI sound drivers - because I
have no ISA slots in which to put an ISA sound card.  So I made do with
only having sound in Win95.  Then the Asound ALS300 popped up and gave it
a shot.  And now the ES1371 driver showed up and I put my original PCI
sound card back in.  But still no joy.

-- --------------------------------------------------------
John B. Sandlin    sandlin@connecti.com
** New user?  Want to learn the ropes?
** Crusty old Guru?  Want to brush up your Netiquette?
** Check out: http://www.albion.com/netiquette/
-- --------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rjerant@no_spam,austin.rr.com                     10-Sep-99 06:03:12
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Drivers for ESS Technology Canyon3D?

From: rjerant@no_spam,austin.rr.com (Rich Jerant)

On 9 Sep 1999 17:52:08 GMT, doug.bissett"at"ibm.net (Doug Bissett)
wrote:

>On Thu, 9 Sep 1999 04:09:00, rjerant@no_spam,austin.rr.com (Rich 
>Jerant) wrote:
>
>> No unfortunatly none of our Canyon 3D customers  have expressed
>> interest OS/2 drivers. Which is really too bad because the DMX card is
>> really nice. I wrote the Win 95/98 driver and was very impressed by
>> it.
>> Rich   
>> 
>
>Now, here is a self defeating attitude.
Why is that self defeating? This is a buisness, we sell pci audio
devices to other companies who put them on pc motherboards and sound
cards. We write whatever driver support they ask for.... OS/2
included. If none of them request OS/2 drivers for a particluar chip
we don't write them.  Does this make me happy ?? No not at all I would
MUCH RATHER write OS/2 drivers than Win95/98, NT or WIN 2000 drivers,
but it's a buisness, I don't do this for religous reasons I do it
cause they pay me.

> ** Os/2 user's have not shown  an interest in the card because there are no
OS/2 drivers
Actually OS/2 drivers for the Canyon3D don't make much sense. The
Canyon 3D was designed to accelerate direct 3D streams, OS/2 has no
clue about 3d sound and never will. The DMX card is a great card but
very expensive, for OS/2 save your money get a $9.00 Solo1 based card
which has OS/2 drivers.
.
> **. On the other hand, OS/2 user's keep on asking (perhaps "begging" is a
better 
>word) for ANY card that is supported, properly, under OS/2. So far, 
>cards using the Crystal chip set (Cirrus logic) are winning the race, 
>because they DO have OS/2 drivers, that DO work, quite well
Yes I agree Joe Nord has done a teriffic job on Crystal's drivers. But
ALL of our PCI chips have OS/2 drivers except for M2E and Canyon 3D. 
    
>
>It would be interesting to know just how many Crystal based cards were
>sold, because of the OS/2 support. 
And this number would mean what ??
Let's say that 50 percent of all personal computers that have sound
and run os/2 have a crystal based audio solution... It's stilll a very
small percentage of the all personal computers that have sound. The
sad fact is that OS/2 just doesn't have enough market share to justify
the resource required to support it. 
>
>I, personally, have bought 4 of them (not just for OS/2 systems 
>either), and will continue to buy them, as long as they have the best 
>OS/2 support (they work very well in the "other" op systems as well). 
>When someone comes up with something better, I will buy that product.
And as a American I support your freedom of choice. But if you are
looking for someone to whine at because the best PC Operating System
is dying a slow and painful death, go whine at IBM. It is their fault
nobody cares about OS/2  not mine.....

Rich  



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: DPartridge@baltimore.com                          10-Sep-99 10:59:17
  To: All                                               10-Sep-99 10:22:08
Subj: Drivers for ESS Technology Canyon3D?

From: DPartridge@baltimore.com

I'm not posting the message reply sequences for this.  Let me say
a few words.

Yes I understand this is a business, but is the technology considered
sufficiently proprietry that the source for the drivers is a commercial
secret, or would ESS be prepared to consider releasing the source for
the Win?? drivers to allow others to attempt the port to platforms
such as (e.g.) OS/2 and Linux.  I'm sure there are folks out there who
have the knowledge to write such drivers (no I'm not really one of them)
and in any case I don't have a copy of MS C6 which would be needed to
write an OS/2 driver (which are 16 bit).

3D sound for OS/2 - I don't honestly give a fig - my interest is not
in gaming, but in a high quality sound card for which there is a least
basic OS/2 support.   If I want to play DVD videos with 5.1 sound, I
can always boot up NT.  Win95/98 need not apply.
--
David C. Partridge
Dpartridge@nospam.baltimore.com
David_C_Partridge@nospam.compuserve.com


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         10-Sep-99 16:52:09
  To: All                                               10-Sep-99 17:01:24
Subj: RealAudio Problem

From: racette@cablevision.qc.ca (Martin Racette)

Hi guys,

I've got a really weird problem with 
RealAudio, I can play local files 
correctly, but as soon as it has to go 
to the Internet for the data, my entire 
computer locks upnad I have to do a 
RESET to make the system work again.

It was working about a month ago 
perfectly well, and a couple of days ago
I tried it again and the problem 
started, I tried to re-install it 
several times to no avail

My system is P-II Celeron 400Mhz with 
128Mb RAM, Warp 4 FP11

BTW. don't tell me that its FP11, 
because it was working OK shortly after 
I installed FP11

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           10-Sep-99 20:29:02
  To: All                                               10-Sep-99 19:59:23
Subj: Re: Drivers for ESS Technology Canyon3D?

From: doug.bissett"at"ibm.net (Doug Bissett)

On Fri, 10 Sep 1999 06:03:24, rjerant@no_spam,austin.rr.com (Rich 
Jerant) wrote:

> But if you are
> looking for someone to whine at because the best PC Operating System
> is dying a slow and painful death, go whine at IBM. It is their fault
> nobody cares about OS/2  not mine.....
> 

It is not entirely YOUR fault, it is not entirely IBM's fault, and a 
LOT of people "care about OS/2". Fortunately, there are people who go 
out of their way to supply what the OS/2 community requires (Ray Gwinn
is the one who comes to mind). Unfortunately, a lot of companies (IBM,
Creative Labs, ESS, and many, many, more) will not release the proper 
specs for their products, so that someone, like Ray Gwinn, can even 
begin to think about writing drivers. It also becomes a "cost" item, 
for various companies, where no-one can justify the initial cost of 
writing the drivers.

Of course, the BASIC problem, is that there is no "standard" way that 
these devices work. Even cards from the same manufacturer (using the 
same chip sets) don't always work in the same way. This is great for 
the manufacturers (they get to sell a new card every couple of years),
but it is not very good for the consumer, who needs to finance all of 
this. It also makes it more difficult to write generic drivers, or any
driver, for these devices. It would seem that writing a Win9x driver 
is cheaper than trying to standardize the way that the cards work. On 
the other hand, it is too expensive to write OS/2 drivers, and, of 
course, anyone doing that wants to keep the cost to a minimum, so the 
end result is something that does the basic requirements, and hardly 
ever supports all of the card's features.

I think that "self defeating" is a very appropriate description of 
this whole thing.
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

+============================================================================+
