
                   comp.os.os2.setup.misc           (Usenet)

                 Saturday, 28-Aug-1999 to Friday, 03-Sep-1999

+----------------------------------------------------------------------------+

From: barrowcl@flash.net                                27-Aug-99 23:01:02
  To: All                                               28-Aug-99 03:31:24
Subj: Compressed Drive

From: "George Barrowcliff" <barrowcl@flash.net>

Installing Warp 4 to HPFS formatted (with Warp 4) D: partition.  After
selecting D:, I get a warning message about a compressed drive might be
installed on this system ......
No compressed drive is installed, I have installed warp 4 3 times on
partition D and the install goes without any problems until the desktop
comes up.  The mouse works for a few clicks, then the system freezes up and
requires a cold boot.  Usually in about 5 seconds.  Win95 is in Partition C:
and will boot up via the boot manager without any problems.

Trying another install using FAT partition.

Any ideas?

GWB


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Bergen Brunswig (1:109/42)

+----------------------------------------------------------------------------+

From: whonea@codenet.net                                27-Aug-99 20:16:21
  To: All                                               28-Aug-99 03:31:25
Subj: Re: WARP 4 install on multi-primary drive

From: whonea@codenet.net (Will Honea)

On Thu, 26 Aug 1999 23:26:42, Raymond Heath 
<raymond.heath@pss.boeing.com> wrote:

> OK, at the risk of public ridicule for months and months, I am throwing
> myself at the mercy of the newsgroup.
> 
> Here's the problem: (Those of you OS sensitive people out there, skip
> the next couple of lines)
> I purged WIN98 because it refused to run half of my good ol' standby
> apps I depend on, and installed a stable version of WIN95 and associated
> system hardware drivers.
> My hard drive is a 4.3G divided into 4, with two primaries under System
> commander.
> With WIN95 on one primary and DOS6.22/win3.1 on the other, I attempted
> to install WARP 4 on the DOS primary with no luck after the first two
> disks, it couldn't find the CDROM drive.
> HERE is my drive map:
> C: primary WIN95
> C: primary DOS6.22
> D:
> E:
> F: IOMEGA ZIP
> G: first NEC CDROM
> H: second NEC CDROM
> I: third NEC CDROM
> J: forth NEC CDROM    6 X 4
> 
> My problem is, how do I get it to recognize the CDROM in it's current
> location so that I can install OS2/WARP 4?
> Ray in Seattle

This may or may not apply, but I had similar grief at one time trying 
to install Warp 4 with a NEC 4x changer: couldn't reliably find the 
CDROM.  As I recall, the first time this happened I just swapped the 
CD to each slot in turn until it was found and continued.  I do know 
that on one occasion I just flat could not get it to find the CD so I 
jumped out to the command line and started searching.  Somehow - and I
could not repeat this if I tried, the CDROM slot with the CD in it was
mapped as Q: - with hard drives C-F!.  Anyway, told it to continue 
with drive Q and it worked.

Enough BS.  The later IDE drivers solved the problem.  I think FP 6+ 
actually works, but you definitely need to replace the IBM1S506.ADD 
(and associated files) on the install disks with later versions, then 
add SET COPYFROMFLOPPY=1 in the config.sys on the install floppy.  
Installs from the changer now work just fine.

Someone want to pop up with the URL for the updated drivers, please?

Will Honea <whonea@codenet.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             27-Aug-99 17:13:26
  To: All                                               28-Aug-99 10:43:13
Subj: Re: Hey, all you OS/2 experts ........

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Thu, 26 Aug 1999 17:00:14 -0400, James Knott wrote:

>I've had some experience with four languages.  C, Pascal, Fortran and 
>Basic. Also did some assembler ;-)

Yes, but can you "speak" all four? Or just write them? <g>


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: yaztromo@idirect.com                              28-Aug-99 02:37:20
  To: All                                               28-Aug-99 10:43:13
Subj: Re: Anyone using a yamaha 4416s with os2????

From: Brad Barclay <yaztromo@idirect.com>

jerryw12 wrote:

> hi there
>
>         i have tried several cdrw software pkgs., but none seem to recognize 
my
> 4416, anyone had better luck?
>
>         what software are you using???

    I've been running a 4416S on an Asus SC-875PCI SCSI adapter since January
of
this year, and since getting it up and running it's worked flawlessly
(although I
did need to upgrade my SCSI driver before it recognized it properly).

    I'm using RSJ CD-Writer for OS/2 - v2.83.  Some people have reported
problems
with certain 4416S flash BIOS revisions, but my drive came with rev 1.0e built 
in
and it has always worked flawlessly under OS/2.

    Best of luck!

Brad BARCLAY


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: ndanger@cts.spamTHIS.com                          28-Aug-99 00:01:06
  To: All                                               28-Aug-99 10:43:13
Subj: LPT 2

From: "Nick Danger" <ndanger@cts.spamTHIS.com>

This oughta be easy, but it has me baffled.  I installed
a PCI-bus PnP parallel port, and I cannot get OS/2 to
recognize it. I told Hardware Manager to "detect
new cards", and I told it to "detect everything",
but it doesn't detect this.

I would not think parallel ports were a major
mystery. Anybody got any hints?


-----------------------------------
ROT13 this to reply: aqnatre@pgf.pbz
-----------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: World Wide Rants (1:109/42)

+----------------------------------------------------------------------------+

From: rsteiner@visi.com                                 28-Aug-99 02:22:06
  To: All                                               28-Aug-99 10:43:13
Subj: Re: Os2 Ver4, Graphics ???

From: rsteiner@visi.com (Richard Steiner)

Here in comp.os.os2.setup.misc, aldel@ibm.net (ALDEL) spake unto us, saying:

>Have Pent 11, with 4. Vid card.
>I can only get 16 colors.
>When I try for more the Comp locks up.
>It is supposed to handle Cirrus etc, but will not.
>
>Just want it to get 440, 256 colors.
>Tried install Svga, but that is no help.

What?  Restate the problem in more understandable terms, and we'll try
to assist you...

-- 
   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
                Save the Whales.  Collect the entire set!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: ivan@protein.bio.msu.su                           28-Aug-99 13:23:03
  To: All                                               28-Aug-99 10:43:13
Subj: Re: WARP 4 install on multi-primary drive

From: "Ivan Adzhubei" <ivan@protein.bio.msu.su>

In <QEnx3.148434$U42.435883@news1.rdc1.bc.home.com>, on 08/27/99 
   at 03:32 AM, baden@unixg.ubc.ca   (Baden Kudrenecky) said:

>In <37C5CD32.94238247@pss.boeing.com>, Raymond Heath
><raymond.heath@pss.boeing.com> writes: >OK, at the risk of public
>ridicule for months and months, I am throwing >myself at the mercy of
>the newsgroup.
>>
>>Here's the problem: (Those of you OS sensitive people out there, skip
>>the next couple of lines)
>>I purged WIN98 because it refused to run half of my good ol' standby
>>apps I depend on, and installed a stable version of WIN95 and associated
>>system hardware drivers.
>>My hard drive is a 4.3G divided into 4, with two primaries under System
>>commander.
>>With WIN95 on one primary and DOS6.22/win3.1 on the other, I attempted
>>to install WARP 4 on the DOS primary with no luck after the first two
>>disks, it couldn't find the CDROM drive.
>>HERE is my drive map:
>>C: primary WIN95
>>C: primary DOS6.22
>>D:
>>E:
>>F: IOMEGA ZIP
>>G: first NEC CDROM
>>H: second NEC CDROM
>>I: third NEC CDROM
>>J: forth NEC CDROM    6 X 4
>>
>>My problem is, how do I get it to recognize the CDROM in it's current
>>location so that I can install OS2/WARP 4?
>>Ray in Seattle

>   What you probably need is the updated ATA and IDE CD ROM support
>from hobbes:

>http://hobbes.nmsu.edu/pub/os2/system/drivers/filesys

And even if you happen to force install to recognize your CD drive, be
aware that OS/2 won't let you proceed with installation without having
OS/2 BootManager installed. And since your disk already has a full set
of primaries occupied, OS/2 fdisk won't offer you *any* partitions to be
set 'installable'. You need to have max 3 primaries and some spare space
to be able to install OS/2. Then you first install BootManager, then
fdisk will let you to choose one of the other partitions for
installation. You can remove BootManager later if you use
SystemCommander (as I did), but this way you won't be able to re-install
OS/2 in a case of some accident.

This is a very inconvinient "feature" of OS/2 fdisk and I'd love it to
be removed, but it's still here even in the latest OS/2 WSeb (Aurora)
fdisk.

Cheers,
Ivan

-- 
-----------------------------------------------------------
"Ivan Adzhubei" <ivan@protein.bio.msu.su>
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Moscow State University (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@null                                       28-Aug-99 10:35:28
  To: All                                               28-Aug-99 10:43:13
Subj: Re: RSJ Problem

From: nospam@null (Richard A Crane)

On Fri, 27 Aug 1999 00:17:52, ames@deltrak.demon.co.uk (Andrew Stephenson) 
wrote:


> THE PROCEDURE:
> 
> 1) Ensure the disk is in the drive properly.
> 
> 2) Open an OS/2 command line session and give the command
> 	trackcpy
>    NB: Like "trackcopy" but without an 'o'.
> 
> 3) When the '>' prompt appears, give the command
> 	blank cdr: 0
> 
> 4) Wait.  Apparently the time required varies with the type of
>    drive.  For Yamahas, it takes about as long as the original
>    recording (plus finalisation) took.  So go brew up a cup of
>    something legal and let the machine do its thing.
> 
> 5) When it has finished and the next '>' prompt appears, give
>    the command
> 	quit
> 
> And that's it.  The disk should now attach in the usual way.
> 
 Could I suggest "trackcpy && blank cdr:0 && quit"

A slightly shorter version (you don't have to check for it in the middle it
just
all runs)
Richard A Crane ph 08 8945 3252 fx 08 8945 5952
Check Copyright of this with the author you may suffer litigation or 
embarrassment.

ps Foolproof is not good enough ..... we're not dealing with fools

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: drowelf@nospamvnet.net                            28-Aug-99 07:08:03
  To: All                                               28-Aug-99 10:43:14
Subj: WinOS2 Video Problem at 1024x768x65K

From: "Eric A. Erickson" <drowelf@nospamvnet.net>

I've got a Toshiba Tecra 8000 that uses the NeoMagic 2200 chipset. Now
all works fine at 1024x768x16M colors, but the video response is a little
slow, 
so I cranked it down to 65K colors. OS/2 Video is much snappier at this 
level, but the WinOS2 stuff will no longer start. Both seamless and full
screen sessions just hang with no display output. I tried using the 'Win /B'
trick to find out what the problem is, but the BootLog shows normal loading
of stuff, until the display.drv driver where it appears to die. I checked out
the Win.Ini and System.Ini and can not see anything wrong there. 

I'm preplexed. Although 16M colors looks great the video perf is not that
great 65K works much better. 

Any help out there?
Elvish Software Foundry, Inc.    		- Internet:  drowelf@vnet.net
IBM Certified OS/2 Warp Engineer 	- IBMLink:   HONE81(ESFISA1)
IBM Certified OS2/ Warp Developer & Associate Visual Age C++ Developer
'Already where I want to be Today 	- Voice/Fax: (281)-398-2625 <-Newe'


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Elvish Software Foundry, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: bc074@torfree.net                                 28-Aug-99 12:20:20
  To: All                                               28-Aug-99 14:21:23
Subj: Installing  os/2 VERSION 2.1 ON a system with an APATA IDE CD-ROM

From: bc074@torfree.net (Charles Connolly)

I have that free disk that IBM gave of OS/2 ver 2.1 years ago, but I have
never Installed It because It requires a SCSI CD-ROM I think.

Is It possible to get a Driver that allows OS/2 to be Installed form this
old disk on my APATA CD-ROM based 200MMX to my Hard Drive. Use of HPFS
is not necessary.

-- Charles.

P.S. Please cc: reply to bc074@torfree.net


-- 
- Charles.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Toronto Free-Net (1:109/42)

+----------------------------------------------------------------------------+

From: madodel@ptdprolog.net                             28-Aug-99 13:17:21
  To: All                                               28-Aug-99 14:21:23
Subj: Re: OS/2 Friendly Internal Modem?

From: madodel@ptdprolog.net (Mark Dodel)

There was this post on Warpcast about a month ago for a PCI modem with
OS/2 support.  I haven't tried it yet so I can't vouch for it, but 
it's a real modem so it should work without a problem.  However being 
a real modem it's not cheap either.  I'm still using a 33.3 USR 
Sportster (from before there were stinking wintrash modems) myself.

Mark

****************************** WarpCast ******************************
Source: Chuck Pettus (cpettus@spectra.net)
Moderator: Dirk Terrell (admin@os2ss.com)
**********************************************************************
 
I've just experimented with a very new PCI modem 
from ACTIONTEC. It is a real modem, NOT a software,
winmodem, hsp, etc. psuedo modem emulator. It works
in DOS, OS2, LINUX, W3.x, W9x, etc. It was simple to
install and I had NO problems except for PCI slot
oversight in my haste to install. On my system, the
PCI slots have various IRQ's and I installed the 
modem in a PCI slot with IRQ=5; a conflict with my 
soundcard. I just switched PCI slots to IRQ=11 and 
all was OK. Detail info on this modem is at:
http://www.actiontec.com/products/modems/cwi/index.html


On Fri, 27 Aug 1999 18:50:07, "George Barrowcliff" 
<barrowcl@flash.net> wrote:

-)THe problem with external modems is I am using both com ports for
-)communication with some local hardware components and I didn't want to buy
-)extra com ports.
-)
-)
-)
-)doug.bissett at ibm.net (Doug Bissett) wrote in message ...
-)>On Wed, 25 Aug 1999 19:34:08, "George Barrowcliff"
-)><barrowcl@flash.net> wrote:
-)>
-)>> Does anyone have any recommendations for OS/2 friendly internal modems?
-)>> Preferably PCI.
-)>>
-)>>
-)>> TIA
-)>> George Barrowcliff
-)>>
-)>>
-)>
-)>Not PCI, but I have had excelent luck with US Robotics (pre 3COM)
-)>modems, models 00568500 (56K voice), 00178500 (56K voice) and 00568700
-)>(56K FAX). All of these have jumpers to configure them, and all work
-)>very well. I have had nothing but trouble with the follow on internal
-)>modems (post 3COM), that do not have jumpers. Your BEST bet, is
-)>actually an external modem, and make sure you avoid the Winmodems,
-)>like the plague thay are.
-)>
-)>Hope this helps...
-)>******************************
-)>From the PC of Doug Bissett
-)>doug.bissett at ibm.net
-)>The " at " must be changed to "@"
-)>******************************
-)
-)


//---------------------------------------------------------
// From the Desk of: Mark Dodel, RN, BSN, MBA
//             Healthcare Computer Consultant
//                   madodel@ptdprolog.net
//    http://home.ptd.net/~madodel
//
//  For a VOICE in the future of OS/2
//             http://www.os2voice.org/index.html
//---------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PenTeleData http://www.ptd.net (1:109/42)

+----------------------------------------------------------------------------+

From: ecmille@ibm.net                                   28-Aug-99 13:57:08
  To: All                                               28-Aug-99 14:21:24
Subj: Re: drive letter

From: ecmille@ibm.net (Ted Miller)

In message <37C6F3FD.1EAD1C36@euronet.be> - Jean- Marie Remacle
<jm.remacle@euronet.be> writes:
:>
:>I would like to assign a specific drive letter to my cd-rom.
:>Can someone tell me how to do ? A command in config.sys ?
:>OS/2 warp 4  fixpack 8.
:>I saw in the properties dialog of drive units the command
:>reservedriveletter, i tried with it but the system does recognize the cd
:>drive any more.
:>
:>Thank you for the help.
:>
:>J.M. Remacle  Genval  Belgium.


Hello

I'm at fixpak 8 and the command in my config.sys is, RESERVEDRIVELETTER=Q,
which makes the system see my cd-rom as 'R'. If it doesn't work for you there
must be something else wrong.

Ted Miller
ecmille@ibm.net


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          28-Aug-99 15:28:03
  To: All                                               28-Aug-99 16:46:26
Subj: Re: drive letter

From: piquant00@uswestmail.net (Annie K.)

On Fri, 27 Aug 1999 20:24:17, Jean- Marie Remacle <jm.remacle@euronet.be> 
wrote:

: I would like to assign a specific drive letter to my cd-rom.
: Can someone tell me how to do ? 

 Open up your Drives object's Properties notebook, click 'Reserved.'

-- 
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ntr.net Corporation (1:109/42)

+----------------------------------------------------------------------------+

From: none@nowhere.com                                  28-Aug-99 15:31:26
  To: All                                               28-Aug-99 16:46:26
Subj: Re: LPT 2

From: none@nowhere.com (andy peerand)

On Sat, 28 Aug 1999 07:01:12, "Nick Danger" <ndanger@cts.spamTHIS.com>
wrote:

> I would not think parallel ports were a major
> mystery. Anybody got any hints?
> 

you need to go into your bios and make sure the new card is not  using
the same port address as lpt1.

andy

.. I did NOT escape, they gave me a day pass.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: lcs@nowhere.com                                   28-Aug-99 10:53:06
  To: All                                               28-Aug-99 16:46:26
Subj: Re: What 56K modem for OS/2 ?

From: "Rick Lindsay" <lcs@nowhere.com>

On Mon, 09 Aug 1999 08:07:47 -0400, c@my.sig wrote:

>On 08/08/99 at 11:59 PM, "Rick Lindsay" <lcs@nowhere.com> said:
>
>>IBM has an excellent PCI 56k voice/data/fax modem on the market for $99
>>with OS/2 driver.
>
>What's the model info, please.
>Andrey Lasichuk (andrey@promobility.net)

33L4680 I think, see our web page, Pricing, then Parts.  It is listed there.


Rick Lindsay, Lindsay Computer Systems, http://www.jumpnet.com/~lcs
Austin, Texas. 512-719-5257.  Asus based systems, Asus Products. 
                                    Advanced Systems.
           This message is SHAREWARE, please register...



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Lindsay Computer Systems (1:109/42)

+----------------------------------------------------------------------------+

From: phillipd@antares.cloudnet.com                     28-Aug-99 16:29:23
  To: All                                               28-Aug-99 16:46:26
Subj: Re: Installing  os/2 VERSION 2.1 ON a system with an APATA IDE CD-ROM

From: Phillip Davenport <phillipd@antares.cloudnet.com>

Charles Connolly <bc074@torfree.net> wrote:

> Is It possible to get a Driver that allows OS/2 to be Installed form this
> old disk on my APATA CD-ROM based 200MMX to my Hard Drive.

This should work -
</ftp://hobbes.nmsu.edu/pub/os2/system/drivers/storage/atapi.zip/>

  p

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Cloudnet - St. Cloud, MN (320) 240-8243 (1:109/42)

+----------------------------------------------------------------------------+

From: gemorga2@vt.edu                                   28-Aug-99 17:58:11
  To: All                                               28-Aug-99 21:13:09
Subj: System Upgrade Renders OS/2 Warp 4 Unbootable

From: gemorga2@vt.edu

I recently did the following hardware changes to my system:

Old Hardware:

VX Chipset Socket 7 Motherboard w/IBM 6x86 120 mhz
Matrox Millenium I w/8mb RAM (PCI)
Adaptec 2940UW PCI to UW SCSI controller
    IBM Ultrastar 2XP 4.5 GB hard drive UW SCSI
    Toshiba 6.7X SCSI  CD-ROM
    NEC 6xi SCSI CD-ROM
    Quantum Fireball ST 2.1 GB Ultra Narrow HD
SoundBlaster AWE32 ISA PnP
Intel EtherExpress PRO 100B PCI
48 MB worth of Fast Page Mode 72 pin simms

New Hardware:

Abit BX6 2.0 w/1/5/2 (AGP/PCI/ISA)
ASUS Socket 370 to Slot 1 adapter
Intel Celeron 366 (66 mhz x 5.5)
64 MB Micron Technology PC100 SDRAM (one DIMM)
Diamond Stealth S220 4MB (the Millenium appears to have died)
Adaptec 2940UW PCI to UW SCSI controller
    IBM Ultrastar 2XP 4.5 GB hard drive UW SCSI
    Toshiba 6.7X SCSI  CD-ROM
    NEC 6xi SCSI CD-ROM
    Quantum Fireball ST 2.1 GB Ultra Narrow HD
SoundBlaster AWE32 ISA PnP
Intel EtherExpress PRO 100B PCI


I realize that this is a drastic change in hardware.  OS/2 is in a
primary partition (HPFS) on the IBM drive which is booted using Boot
Magic (I have a lot of OSes)  Win95 works fine (after installing new
drivers)  WinNT Workstation 4.0 SP5 worked fine after installing the
Diamond drivers.

While booting OS/2, some network initialization fails (I don't think
it can find the PCI bus since it may not recognize the bridge chipset)
and core dumps slightly after trying to init networking.  I never see
the desktop.

What I wanted to do was go into the "Safe Mode" for OS/2 and apply
whatever driver changes that are necessary.  My new system is so fast
that I can't hit the F-key to get the boot options menu.  Once I was
able to hit F2 and boot the previous version of OS/2 but I could not
remember what I should do from there.

Which F-key gives me the menu with options???

Thank you for any help.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Virginia Tech, Blacksburg, Virginia, USA (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      28-Aug-99 14:59:01
  To: All                                               28-Aug-99 21:13:09
Subj: Re: Installing os/2 VERSION 2.1 ON a system with an APATA IDE CD-ROM

From: nospam@savebandwidth.invalid     (John Thompson)

In <FH6CyH.Dr1.0.queen@torfree.net>, bc074@torfree.net (Charles Connolly)
writes:

>I have that free disk that IBM gave of OS/2 ver 2.1 years ago, but I have
>never Installed It because It requires a SCSI CD-ROM I think.
>
>Is It possible to get a Driver that allows OS/2 to be Installed form this
>old disk on my APATA CD-ROM based 200MMX to my Hard Drive. Use of HPFS
>is not necessary.

It's going to be tricky because OS/2 v2.1 predates the 
availability of ATAPI CDROM devices. You *might be able to make 
it work by using the newer drivers that do support ATAPI, but 
you'd still have the problem of having the wrong drivers copied 
from the CD onto your HD.  

-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: jm.remacle@euronet.be                             28-Aug-99 18:34:16
  To: All                                               28-Aug-99 21:13:09
Subj: Re: drive letter

From: Jean- Marie Remacle <jm.remacle@euronet.be>

Thank you for your advice. I now understand that i have to indicate the
letter preceding the actual letter i want to assign to the cd-rom. As i
had assigned z the computer did not recognize the cd, i changed to Y and
it works.

Jean-Marie.
Ted Miller a crit :
> 
> In message <37C6F3FD.1EAD1C36@euronet.be> - Jean- Marie Remacle
> <jm.remacle@euronet.be> writes:
> :>
> :>I would like to assign a specific drive letter to my cd-rom.
> :>Can someone tell me how to do ? A command in config.sys ?
> :>OS/2 warp 4  fixpack 8.
> :>I saw in the properties dialog of drive units the command
> :>reservedriveletter, i tried with it but the system does recognize the cd
> :>drive any more.
> :>
> :>Thank you for the help.
> :>
> :>J.M. Remacle  Genval  Belgium.
> 
> Hello
> 
> I'm at fixpak 8 and the command in my config.sys is, RESERVEDRIVELETTER=Q,
> which makes the system see my cd-rom as 'R'. If it doesn't work for you
there
> must be something else wrong.
> 
> Ted Miller
> ecmille@ibm.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EuroNet Internet (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           28-Aug-99 19:47:11
  To: All                                               28-Aug-99 21:13:09
Subj: Re: System Upgrade Renders OS/2 Warp 4 Unbootable

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Sat, 28 Aug 1999 17:58:23, gemorga2@vt.edu wrote:

> I recently did the following hardware changes to my system:
> 
> Old Hardware:
> 
> VX Chipset Socket 7 Motherboard w/IBM 6x86 120 mhz
> Matrox Millenium I w/8mb RAM (PCI)
> Adaptec 2940UW PCI to UW SCSI controller
>     IBM Ultrastar 2XP 4.5 GB hard drive UW SCSI
>     Toshiba 6.7X SCSI  CD-ROM
>     NEC 6xi SCSI CD-ROM
>     Quantum Fireball ST 2.1 GB Ultra Narrow HD
> SoundBlaster AWE32 ISA PnP
> Intel EtherExpress PRO 100B PCI
> 48 MB worth of Fast Page Mode 72 pin simms
> 
> New Hardware:
> 
> Abit BX6 2.0 w/1/5/2 (AGP/PCI/ISA)
> ASUS Socket 370 to Slot 1 adapter
> Intel Celeron 366 (66 mhz x 5.5)
> 64 MB Micron Technology PC100 SDRAM (one DIMM)
> Diamond Stealth S220 4MB (the Millenium appears to have died)
> Adaptec 2940UW PCI to UW SCSI controller
>     IBM Ultrastar 2XP 4.5 GB hard drive UW SCSI
>     Toshiba 6.7X SCSI  CD-ROM
>     NEC 6xi SCSI CD-ROM
>     Quantum Fireball ST 2.1 GB Ultra Narrow HD
> SoundBlaster AWE32 ISA PnP
> Intel EtherExpress PRO 100B PCI
> 
> 
> I realize that this is a drastic change in hardware.  OS/2 is in a
> primary partition (HPFS) on the IBM drive which is booted using Boot
> Magic (I have a lot of OSes)  Win95 works fine (after installing new
> drivers)  WinNT Workstation 4.0 SP5 worked fine after installing the
> Diamond drivers.
> 
> While booting OS/2, some network initialization fails (I don't think
> it can find the PCI bus since it may not recognize the bridge chipset)
> and core dumps slightly after trying to init networking.  I never see
> the desktop.
> 
> What I wanted to do was go into the "Safe Mode" for OS/2 and apply
> whatever driver changes that are necessary.  My new system is so fast
> that I can't hit the F-key to get the boot options menu.  Once I was
> able to hit F2 and boot the previous version of OS/2 but I could not
> remember what I should do from there.
> 
> Which F-key gives me the menu with options???
> 
> Thank you for any help.

ALT-F1 should call up the meu options.

Just press and hold down the keys after selecting the
operating system at boot time.

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: luistino@my-deja.com                              28-Aug-99 20:49:11
  To: All                                               29-Aug-99 05:35:21
Subj: Re: What 56K modem for OS/2 ?

From: luistino <luistino@my-deja.com>


Rick Lindsay wrote:

> On Mon, 09 Aug 1999 08:07:47 -0400, c@my.sig wrote:
>
> >On 08/08/99 at 11:59 PM, "Rick Lindsay" <lcs@nowhere.com> said:
> >
> >>IBM has an excellent PCI 56k voice/data/fax modem on the market for $99
> >>with OS/2 driver.
> >
> >What's the model info, please.
> >Andrey Lasichuk (andrey@promobility.net)
>
> 33L4680 I think, see our web page, Pricing, then Parts.  It is listed there.

33L4585 and it  is not a voice modem

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: sachmo@horn.net                                   29-Aug-99 00:10:20
  To: All                                               29-Aug-99 10:42:25
Subj: Re: CDW as a backup medium

From: sachmo@horn.net

Ah, my favorite bitch topic - backup! More specifically, reliable 
backup. With that warning, pardon me if I start to ramble.

Having been burned by practically all backup methods since the Atari 
tape loader appeared on the scene, I'm highly dubious as to quality of
same. I also consider backup the weakest link in computerdom for the 
same reason.

Magnetic tape is questionable since I live in an area of extreme 
humidity and high temperature most of the year. it's also aggravated 
by the presence of feline fur that floats everywhere regardless of 
efforts to keep it at a minimum. If you're owned by a feline, you 
might appreciate that fact. :-) Floppies are too small to hold both 
data and programs today on one diskette. If you zip or otherwise 
bridge across two or more, you run a risk of one being bad along with 
the same conditions that affect tape.

I had thought of MO and might still go that route. I was in hopes of 
Castlewood's ORB. From what I've read so far, it's also dubious. CD-RW
is too pricey for my pocketbook regardless of the value of the data.

Current solution is a dedicated HDD to backup partitioned to daily, 
weekly, and monthly backups along with a lot of praying, voodoo, and 
finger crossing. Acts of Nature (hurricane, lightning) and the local 
power utility are more worrisome to me than the chance of a drive 
failure. Really important data gets saved to multiple floppies and 
hard copy. So far, it's been the most foolproof solution.

Gene
---------------
pequod@gate.net

The minstrel boy to the war is gone
In the ranks of death you'll find him;
One sword, at least, thy rights shall guard;
Words shall never sound in slavery!
            --Thomas Moore (1779-1852)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CyberGate, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jaj01@earthlink.net                               28-Aug-99 19:37:08
  To: All                                               29-Aug-99 10:42:25
Subj: FIXED!!-> Can't access any HELP files!

From: "James A. Jones" <jaj01@earthlink.net>

I finally found out what was preventing OS/2 Warp 4 from accessing any
HELP or INF files. Somehow, HPMGRMRI.DLL was missing from the \OS2\DLL
directory. This is the "Help manager resource dll" that works along with
HELPMGR.DLL. I have no idea how it could have been deleted. Good thing I
had another Warp 4 system running on my other machine, or I would have
never found it. Thanks to all who offered suggestions!

P.S. If you ever want to secure a Warp 4 system to prevent users from
accessing any help files, INF files, tutorial, or Regedit2, HPMGRMRI.DLL
is the file to delete.

-- 
 ----------
"Bill Gates is a white Persian cat and a monocle away
from becoming another James Bond villain."
"No Mr Bond, I expect you to upgrade." -Dennis Miller
 ----------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: jbrush@aros.net                                   28-Aug-99 18:38:22
  To: All                                               29-Aug-99 10:42:25
Subj: Anyone with UMAX 610P scanner

From: jbrush@aros.net

I bought one, and it runs well under WinOS2 with one exception:

I need the copy facility, but it won't work because when it tries to
print, it says the device is in use and the printer screen gives me the
big red X. 

I have to shut down the copier to get the output to go to the printer.
Frustrated is not the word for it as I ditched a Microtek E3 which is
totally useless under OS/2, in hopes of being able to use the UMAX like a
lot of folks say.

I have tried every setting I can think of in the settings for the session.
The question is simply, does the copier work for anyone like it should or
is there still no way to use a scanner under OS/2?

P.S. I appreciate all the referrals to CFM and that one photosuite that IB
sells, but CFM is a piece of over-priced crap, and the photosuite is just
flat overpriced. Since there is no demo to allow me to see if it scans any
better than CFM, then no way am I gonna pay all that money. SANE is
supposed to work on and E3, but it doesn't. 

Thanks for any printable advice :)

Regards,

John



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ArosNet Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: Stefan.Schwarzer@tu-clausthal.de                  29-Aug-99 03:16:15
  To: All                                               29-Aug-99 10:42:25
Subj: MySQL server 3.22.19b doesn't start

From: Stefan Schwarzer <Stefan.Schwarzer@tu-clausthal.de>

Hi,

to install MySQL 3.22.19b, I unzipped the binary zip file to
e:/mysql2. Calling install.cmd on the command line doesn't seem
to cause any trouble; a folder on the WPS is also created.

However, if I try to start the server mysqld, I get the message

990827 22:31:14  Can't start server : UNIX Socket : Protocol family not
supported
990827 22:31:14  Aborting

I checked my loopback configuration (ping localhost works whether
I'm online or not) but the problem persists.

Some configuration data:

- Warp 4 (German) with fixpack 10
- TCP/IP 4.0(?)
- emx 0.9d
- HPFS on D: (boot drive) and E: (MySQl installation drive)

Any help would be fine. :-) 

Best regards
 Stefan

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: . (1:109/42)

+----------------------------------------------------------------------------+

From: aldel@ibm.net                                     29-Aug-99 04:26:17
  To: All                                               29-Aug-99 10:42:25
Subj: Re: Os2 Ver4, Graphics ???

From: aldel@ibm.net

Thanks for the reply:
I am using Os2/v4 on a Pentium 11 with
a 4 meg video card, & 15 inch svga monitor.
The best display color setting I can get is 640-480-16.
I want to get  256 colors instead of 16.
I changed the Vga setting to svga.
That does not help.
I had os2 vers 3 for some yrs and used the svga
and Cirrus setting on the install util. it worked fine
I could get 256 color display or what ever I needed.
When I do this with Warp 4, the computer locks up.
I tried all I can think of but nothing works.
The comp locks and I have to Control & F1 -F3
to get it working agn.
How can I change 16 color setting to 256 and survive???.
Help much appreciated.

It took 82 yrs to get this dumb.
Albert.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          29-Aug-99 04:43:01
  To: All                                               29-Aug-99 15:49:07
Subj: Re: FIXED!!-> Can't access any HELP files!

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Sun, 29 Aug 1999 00:37:17, "James A. Jones" <jaj01@earthlink.net> a 
crit dans un message:

> I finally found out what was preventing OS/2 Warp 4 from accessing any
> HELP or INF files. Somehow, HPMGRMRI.DLL was missing from the \OS2\DLL
> directory. This is the "Help manager resource dll" that works along with
> HELPMGR.DLL. I have no idea how it could have been deleted. Good thing I
> had another Warp 4 system running on my other machine, or I would have
> never found it. Thanks to all who offered suggestions!

Nice of you to post the fix, and glad you worked it out, but next time, 
when you email people to get help with this, you should make sure your 
return mailbox works, and you should read these groups to check for 
feedback that was posted when the email bounced.

admin@earthlink.net says "jaj01@earthlink.net" isn't a valid email.

And I'm not sure it needs to be cross-posted like it was, but I'll keep it 
just like it is so you're more likely to read this. 

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                29-Aug-99 05:28:04
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Fonts

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <wnaqnavryffbasnyhaznvygryvnpbz.fh5gji0.pminews@news1.telia.com>, "Jan
Danielsson" <Jan.Danielsson@falun.mail.telia.com> writes:
>I have made the C64 font for OS/2 with the font editor. How do I register it
>with OS/2 so I can use it with EPM or lxpm?

   I don't know about M$ font (TT) support, but with Type 1
fonts, you just use your "System Setup --> Font Palette --> Edit
Font -->Add" menus.

baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                29-Aug-99 05:36:10
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Os2 Ver4, Graphics ???

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <37c8b174.468483@news-s01.ny.us.ibm.net>, aldel@ibm.net writes:
>Thanks for the reply:
>I am using Os2/v4 on a Pentium 11 with
>a 4 meg video card, & 15 inch svga monitor.

   It would really help to know what manufacturer and model your
video card is.  When you first boot the computer, the video's
BIOS should list your video card, but it may go by really fast.
Barring that, the auto-detection in OS/2 should work for most
common video cards, and you could try typing "dspinstl" at a
command prompt, and just keep on clicking on the recognised
hardware until done, and then re-boot.  After, open up the
"System Setup --> System" object, and on the first one or two
pages, should be settings to adjust all your video settings, for
which you have to re-boot again to take effect.

>The best display color setting I can get is 640-480-16.
>I want to get  256 colors instead of 16.
>I changed the Vga setting to svga.
>That does not help.
>I had os2 vers 3 for some yrs and used the svga
>and Cirrus setting on the install util. it worked fine
>I could get 256 color display or what ever I needed.
>When I do this with Warp 4, the computer locks up.
>I tried all I can think of but nothing works.
>The comp locks and I have to Control & F1 -F3
>to get it working agn.
>How can I change 16 color setting to 256 and survive???.
>Help much appreciated.
>
>It took 82 yrs to get this dumb.
>Albert.

   I am glad that you're staying with OS/2!  Good Luck.


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: 050812@sprint.ca                                  29-Aug-99 03:06:08
  To: All                                               29-Aug-99 15:49:08
Subj: [HELP] I'm sooo confused about OS/2 Warp packages!

From: "050812" <050812@sprint.ca>

This is a multi-part message in MIME format.

------=_NextPart_000_001E_01BEF1CB.75D3C320
Content-Type: text/plain;
	charset="iso-8859-1"
Content-Transfer-Encoding: quoted-printable

I really like to try OS/2 Warp (version 3), but I can't seem to choose which
package to get.
Can anyone enlighten me a bit please?

1) so what's the difference between this "blue box" and "red box" thing?
2) what's the difference between "OS/2 Warp" and "OS/2 Warp Connect"?
3) do I really need this winos2 thing if I'm installing OS/2 on my new pc
(without any existing os)?
4) is there any more *confusing* packages that I'm not even aware of?

Thanks for the clearfication!


Edward

------=_NextPart_000_001E_01BEF1CB.75D3C320
Content-Type: text/html;
	charset="iso-8859-1"
Content-Transfer-Encoding: quoted-printable

<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN">
<HTML><HEAD>
<META content="text/html; charset=iso-8859-1" http-equiv=Content-Type>
<META content="MSHTML 5.00.2314.1000" name=GENERATOR>
<STYLE></STYLE>
</HEAD>
<BODY bgColor=#ffffff>
<DIV><FONT size=2>I really like to try OS/2 Warp (version 3), but I can't seem 

to choose which package to get.</FONT></DIV>
<DIV><FONT size=2>Can anyone enlighten me a bit please?</FONT></DIV>
<DIV>&nbsp;</DIV>
<DIV><FONT size=2>1)&nbsp;so what's the difference between this "blue box" and 

"red box" thing?</FONT></DIV>
<DIV><FONT size=2>2) what's the difference between "OS/2 Warp" and "OS/2 Warp 
Connect"?</FONT></DIV>
<DIV><FONT size=2>3) do I really need this winos2 thing if I'm installing OS/2 

on my new pc (without any existing os)?</FONT></DIV>
<DIV><FONT size=2>4) is there any&nbsp;more *confusing* packages that I'm not 
even aware of?</FONT></DIV>
<DIV>&nbsp;</DIV>
<DIV><FONT size=2>Thanks for the clearfication!</FONT></DIV>
<DIV>&nbsp;</DIV>
<DIV>&nbsp;</DIV>
<DIV><FONT size=2>Edward</FONT></DIV></BODY></HTML>

------=_NextPart_000_001E_01BEF1CB.75D3C320--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sprint Canada Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: rpeterse@ix.netcom.com                            29-Aug-99 00:53:02
  To: All                                               29-Aug-99 15:49:08
Subj: Re: PCMCIA on Dell Latitude CPi D233ST - OS/2 Warp 4 P&P-NOT!!!

From: Randy Petersen <rpeterse@ix.netcom.com>

In <Hi4x3.146738$U42.415183@news1.rdc1.bc.home.com>, on 08/26/99
   at 05:31 AM, baden@unixg.ubc.ca   (Baden Kudrenecky) said:

>In <37c36028$1$ecrgrefr$mr2ice@nntp.ix.netcom.com>, Randy Petersen
<rpeterse@ix.netcom.com> writes:

>   Maybe this won't directly help, but I got a Xircom PS-CE2-10
>network card, and USR Sportster 28.8 modem working after
>screwing around a lot, and finding the answer at some other
>site, which I can't recall now.

>   The answer lay in the CONFIG.SYS, and my relevant lines read:

>BASEDEV=PCMCIA.SYS
>BASEDEV=IBM2MAT1.SYS /C0=15 /IG0=2
>DEVICE=D:\OS2\BOOT\AUTODRV2.SYS D:\OS2\AUTODRV2.INI
>DEVICE=D:\IBMCOM\MACS\XPSNDIS.OS2

>   The /IG0=2 switch was the key to disable PCMCIA auto
>detection.

Thanks, but that does nothing but tell the socket services driver to ignore 
my Ethernet card.  The /C0=15 tells the socket services driver to communicate 
status change to the card services driver using IRQ15 - the newer drivers out 
now (PC Card Director & PlayAtWill) don't use an IRQ so that would be ignored.

>>The GOOD news and the BAD news...
>>
>>OS/2 Warp 4 works great on my Dell Latitude CPi-D233ST laptop
>>   Sound is fine.
>>   Video is fine
>>   >4GB Hard drive is fine.
>>Exception to the rule is that
>>   PCMCIA (TI1131 CardBus PCMCIA chipset) DOES NOT WORK.
>>
>>
>>I've had it with PLAYING around with OS/2 Warp 4 PCMCIA Plug & Pray.
>>I've wasted a week so far and refuse to waste any more of my time 
>>alpha-testing.
>>
>>
>>PLEASE - If anyone has any of the following PCMCIA cards working under 
>>         Warp 4 on a Dell Latitude CPi-D233ST laptop, tell me how. 
>>         I don't have time right now to play around, so I'd appreciate 
>>         hearing only from those that have it working.  If nobody does, 
>>         then maybe it's time we petitioned IBM to get it working.
>>
>>
>>PCMCIA CARDS:
>>   1) Linksys Combo (not really) PCMCIA Ethernet Card (Model: EC2T)
>>   2) 3Com Megahertz 56K Global Modem PC Card (Model: 3CCM156)
>>   3) Adaptec SlimSCSI APA-1460A (Part#:997400)
>>
>>
>>NOTES: 
>>   a) Of course, these all work just fine under Microcrash '95.
>>   b) No, I cannot use another laptop, this is my employer's.
>>
>>
>>Here are the drivers and the relevant hex-dump of each I've used.
>>Please don't waste my time by asking me to try one of these again.
>>
>>
>>          SS2PCIC2.SYS   19,543 .a..    7-17-1998 20:12:30
>>Comments: Locks hard on bootup load
>>HEX-DUMP:-----------------------------------------------------------------
>>000003C0  zzIBM OS/2 PCMCIA Socket Services Device Driver, Version 1.36zzP
>>00000400  CMCIA Socket Services Release 2.1zzCopyright 1993,1995 IBM Corp.
>>00000440  zzAll rights reserved.zzzIBM Socket Service for Intel 82365SL co
>>00000480  mpatible: Internal Revision 0.36.36zzzzz6zzzzzzzzzzzzzzzzzzzzzzz
>>__________________________________________________________________________
>>
>>
>>          ibm2ss14.sys   16,167 .a..    9-28-1998  2:07:00
>>Comments: Loads but doesn't show cards inserted/removed
>>HEX-DUMP:-----------------------------------------------------------------
>>00000340  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzIBM OS/2 Socket Services Device Dr
>>00000380  iver, Version 2.07zzPC Card standardzzCopyright 1998 IBM Corp.zz
>>000003C0  All rights reserved.zzzIBM Socket Service for ThinkPad Series (P
>>__________________________________________________________________________
>>
>>
>>          ibm2ss14.sys   29,069 .a..    1-06-1999 10:57:36
>>Comments: Loads and show cards inserted/removed but doesn't work.
>>HEX-DUMP:-----------------------------------------------------------------
>>000000C0  zzzzazzzzzm4@zn4'zzzPzzzzIBM2SS14zzzzzzz?z"zzz?zzzzz3@#IBM:10.01
>>00000100  1#@ PCCard IBM2SS14 Chip Driver for OS/2zzzzzzzzzzzzzzzzzzzzzzzz
>>00000140  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>00000180  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>000001C0  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>00000200  zzzzzzzzzzICSS014$zzzzzzzzzzzzzzzzPCMCIA$ zzzzzzzzzzzzzzzzzzzzzz
>>00000240  zzzzzzzzzzzzzzJzyzzzzzzzzzbzzzzz:z2zzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>00000280  zzzzzzzzzz;zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>000002C0  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>00000300  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>00000340  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzIBM OS/2 Socket Services Device Dr
>>00000380  iver, Version 3.00zzPC Card standardzzCopyright 1998 IBM Corp.zz
>>000003C0  All rights reserved.zzzIBM Socket Service for ThinkPad Series (P
>>00000400  CI) : Internal Revision 1.00.03zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>__________________________________________________________________________
>>
>>
>>          SS2INTEL.SYS   19,455 .a..    8-19-1999  5:35:08
>>Comments: Gives error about not loading, no reason why.
>>HEX-DUMP:-----------------------------------------------------------------
>>000000C0  zzzzazLzzzB$@zB$zSS2INTELzzzzzH@#OEM:9.23#@ OS/2 PCCard Driver f
>>00000100  or Intel compatible CardBus controllerszzzzzzzzzzzzzzzzzzzzzzzzz
>>00000140  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>00000180  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>000001C0  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>00000200  zzzzzzzzzzICSS001$zzzzzzzzzzzzzzzzPCMCIA$ zzzzzzzzzzzzzzzzzzzzzz
>>00000240  zzzz@zzzzz'z*z'zzzzzzz-zzzizfzzzxzzzzzzzzzzzzzzzzzzzzzzzzzzzzzTz
>>00000280  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>000002C0  zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>00000300  zzzzzzzzzzzzzzzzzzzzzzzzzzz'z>zzEzUzzzzzzzzzzzz`zpzzz|z}zzzzzzzp
>>00000340  zezTzzz|z|z|z|z|z|z|zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz@zzz zzzzzzz
>>00000380  z@zzzzzzzz !" zzzzzzzzzzzzzzz (0zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>000003C0  zzOS/2 PCMCIA Socket Services Device Driver, Version BETA #3zzPC
>>00000400  MCIA Socket Services Release 2.1zz<<<< For Evaluation Purpose On
>>00000440  ly >>>>zzzSocket Service for Intel PCIC compatible CardBus contr
>>00000480  oller: Internal Revision 0.05.01zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
>>__________________________________________________________________________
>>
>>
>>Thanks in advance for any tips or help you can offer.
>>
>>Randy Petersen <rpeterse@ix.netcom.com>
>>
>>/*----------------------------------------------------------------------*
>>  Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
>>  Please also email replies to: Randy Petersen <rpeterse@ix.netcom.com>
>>  Now Very Happily Warping along with Warp 3.0 Connect at fixpack #40.
>>  SPAMMERS don't bother me, I direct them to the void at /dev/nul.
>>*----------------------------------------------------------------------*/


>baden

>baden@unixg.ubc.ca
>http://baden.nu/
>OS/2, Solaris & Linux

/*----------------------------------------------------------------------*
  Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
  Please also email replies to: Randy Petersen <rpeterse@ix.netcom.com>
  Now Very Happily Warping along with Warp 3.0 Connect at fixpack #40.
  SPAMMERS don't bother me, I direct them to the void at /dev/nul.
*----------------------------------------------------------------------*/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: rpeterse@ix.netcom.com                            29-Aug-99 01:00:12
  To: All                                               29-Aug-99 15:49:08
Subj: Re: PCMCIA Cardbus driver sort of working on Dell Latitude CPi-D233ST

From: Randy Petersen <rpeterse@ix.netcom.com>

In <QWgv3.284$JK3.796@read2.inet.fi>, on 08/20/99
   at 06:15 PM, osmo.vuorio@sonera.fi (osmo vuorio) said:

>In article <37bcd608$2$ecrgrefr$mr2ice@nntp.ix.netcom.com>, Randy Petersen
<rpeterse@ix.netcom.com> says:
>..
>>keeping the laptop from locking up when booted.  Actually the laptop still 
>>locks up if I load the Linksys Ethernet os2 ndis2 driver.

>This may be due the defaul Irq5.. Manually rework protocol.ini.

I disabled the soundchip through BIOS, rem'd out the sound driver from 
config.sys and changed PROTOCOL.INI to port 300 and irq 5.
No help, either locks at ndis2 driver load if card inserted on boot or 
locks when card inserted after boot.  Tried at port 320 and irq 5 also.

>Adaptec 1460 may like to stay on Irq10. Where'is the soundchip?

Soundchip is at IRQ5.

>The case of modem recognition is yet another unknown dilemma.

>Osmo


/*----------------------------------------------------------------------*
  Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
  Please also email replies to: Randy Petersen <rpeterse@ix.netcom.com>
  Now Very Happily Warping along with Warp 3.0 Connect at fixpack #40.
  SPAMMERS don't bother me, I direct them to the void at /dev/nul.
*----------------------------------------------------------------------*/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: larry926@mindspring.com                           29-Aug-99 06:12:03
  To: All                                               29-Aug-99 15:49:08
Subj: boot manager

From: "Larry Osborne" <larry926@mindspring.com>

I had finally got warp 4 installed and working on my computer.  I put win98
in another partition.  When I rebooted after the 98 installation my boot
manager no longer shows up.  I tried using the utility disks that I made for
os/2 but fdisk keeps saying that the partition table maay be corrupted.  I
tried the fddisk/newmbr and it returns an error no. 3.  Any suggestions?

Larry


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: Jan.Danielsson@falun.mail.telia.com               29-Aug-99 10:12:00
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Fonts

From: "Jan Danielsson" <Jan.Danielsson@falun.mail.telia.com>

>>I have made the C64 font for OS/2 with the font editor. How do I register it
>>with OS/2 so I can use it with EPM or lxpm?
>
>   I don't know about M$ font (TT) support, but with Type 1
>fonts, you just use your "System Setup --> Font Palette --> Edit
>Font -->Add" menus.

Been there, done that, didn't produce any results. :-(

It seems that the 'add font' function you mention looks for some file which
defines the font. ...if so, is it possible to make one for a *.fnt file?


 /j



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telia Internet (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    29-Aug-99 05:54:00
  To: All                                               29-Aug-99 15:49:08
Subj: Re: boot manager

From: dcasey@ibm.net (Dan Casey)

In article <7qb0mh$1ab$1@nntp8.atl.mindspring.net>,
"Larry Osborne" <larry926@mindspring.com> wrote:
>I had finally got warp 4 installed and working on my computer.  I put win98
>in another partition.  When I rebooted after the 98 installation my boot
>manager no longer shows up.  I tried using the utility disks that I made for
>os/2 but fdisk keeps saying that the partition table maay be corrupted.  I
>tried the fddisk/newmbr and it returns an error no. 3.  Any suggestions?

Windows Install "disables" the Boot Manager partition. Run FDISK from
within WIn98 and set the Boot Manager partition as ACTIVE and reboot.
It should work fine.


--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: derek.vance.steel@natureboy.dyn.tj                29-Aug-99 08:41:25
  To: All                                               29-Aug-99 15:49:08
Subj: WangDat 3100 DAT, is it a good one?

From: derek.vance.steel@natureboy.dyn.tj

Hello Will.

21 Jul 99 21:57, Will Smith wrote to All:


 WS> I had one and had it required repair 2 times in the 6 years that
 I
 WS> had it.  I didn't get it fixed the second time it failed, less
 than a
 WS> year after the first repair. I don't know that the 3100 is still
 in
 WS> production.  I think anything that you find for sale is going to
 be
 WS> refurbished.  I do not know what the current pricing is, but
 with the
 WS> 3100's limited capacity <2 gig> and its slow speed <Max 10
 mb/min>,
 WS> you may want to look at something that is DDS2 or DDS3
 compatible.
 WS> The 3100 also does not support data compression. I would
 recommend
 WS> that you look at the HP line of DAT drives.


If you do get an HP, make sure that you clean it about once every 10
 backups.

The heads tend to wear on DAT drives, particular HP.

I found out hard way, when it required servicing because of my poor
 maintenance habits (the repair tech slapped my fingers with the bill
 - ouch)

As far as performance though, the dat drive was a dream. Backmaster
 and the HP6000 would back up and verify my 2.1 gig drive in 45
 minutes, with an average speed of 30 - 40 megs per minute.


Derek


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Starfire Couriers (1:109/42)

+----------------------------------------------------------------------------+

From: derek.vance.steel@natureboy.dyn.tj                29-Aug-99 08:41:26
  To: All                                               29-Aug-99 15:49:08
Subj: Java - IRC program, Where?

From: derek.vance.steel@natureboy.dyn.tj

Hello David.

22 Jul 99 16:04, David T. Anderson wrote to All:


 DA> I have both Java 102 and Java 117 set up on my system.  I use a
 few
 DA> Java applications (ICQ and IRC) regularly and they work quite
 well, as
 DA> well as the Java support in Netscape for OS/2.  No real
 problems.

Where did you get the Java IRC program?

I finally was able to get the JAVA version of ICQ running.... Lets
 see I read the instructions carefully after updating the version of
 Java.

I was impressed with ICQ running, and would like to a java IRC
 client.


Derek


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Starfire Couriers (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             29-Aug-99 12:19:08
  To: All                                               29-Aug-99 15:49:08
Subj: Where is MMPM2 driver?

From: rgibson@ix.netcom.com (Ron Gibson)

Where is the MMPM2 driver for Warp 3 (FP40)?

I'm still using an ancient PAS 16 and I wanted to play audio CD's and
can't figure a way to do it with a native OS/2 application.  I
downloaded something off of Hobbes and when I try to use it I get this
can't load MMPM2 driver.  Well, no wonder.  It's not there but I see an
MMPM2.INI file????

Interesting to note that an old DOS application that came with the card
called musicbox works just fine in the background and it's a TSR!

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: gczerw@home.No-Spam.com                           29-Aug-99 12:24:04
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Java - IRC program, Where?

From: gczerw@home.No-Spam.com (George Czerw)

There is a Java IRC client at the following IBM Alphaworks site:

http://www.alphaworks.ibm.com/tech/irc


It was updated in 6/99.

George

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: jms%email.de%email.de%email.de@b...               29-Aug-99 12:35:11
  To: All                                               29-Aug-99 15:49:08
Subj: Re: apm does not work like I want

Message sender: jms%email.de%email.de%email.de@bromo.email.ch

From: jms%email.de%email.de%email.de@bromo.email.ch (Jens)

Hi Doug,

thanks for your information. The BIOS I have (ASUS P2B  board) has got
not very much to configure. The BIOS on my old board had a lot more 
switches.
Maybe I look for a tool which can access hidden BIOS switches.

Jens

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: JMS Consulting (1:109/42)

+----------------------------------------------------------------------------+

From: cshapiro@lvcm.com                                 29-Aug-99 05:56:21
  To: All                                               29-Aug-99 15:49:09
Subj: network printer setup

From: Charles Shapiro <cshapiro@lvcm.com>

I am trying to set up a Canon BJC-6000 on a peer-peer
network.  

OS/2 / WIN98 / WIN98 machines.  No problem from WIN98 to
WIN98
machines, but from the OS/2 to the WIN98 machines I can not
get 
it set up properly.  I have a HP Laserjet hooked up to one
of the 
WIN98 machines, and the Canon is on the other.  I had no
problems
setting up the Laserjet from OS/2 to WIN98, but this Canon
is a different
story.  I am not sure which drivers I used to install the
Laserjet on
the OS/2 machine, but the properties window has some network
stuff in it,
while the Canon does not after it's installed.

The Canon printer turns itself on automatically when it
see's a print job
coming and I can get it to do that (turn on), from the OS/2
machine, but
it doesn't print.  I am using the OMNI drivers off IBM's
Device Driver Page
(recently updated) to try and get this printer installed.

I have not bothered to call Canon as I know they do NOT
support OS/2 (own a BJC-610)
also and could never get any support for it either.  Why I
didn't just get an HP
Deskjet I don't know, which would have probably  worked fine
like the Laserjet does.

Appreciate any help you might have to offer.

 
..Chip..

---


                          Stop Smoking with Lifesign
                            Scientifically Proven
                            Visit www.at.pair.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT Products (1:109/42)

+----------------------------------------------------------------------------+

From: khalsa@ibm.net                                    29-Aug-99 10:01:19
  To: All                                               29-Aug-99 15:49:09
Subj: Install prob:Warp3 on 1.2GbHD

From: Satnam Singh <khalsa@ibm.net>

I am installing from diskettes.  The computer is a 486 which previously
had a 400MB boot HD with OS2 and a 1.6GB hard drive (2 partitions, 250MB
and 1.3GB).  The 400MB HD died, so I want to install OS2 on the 250MB
partition of the 1.6GB HD.

DOS/Win31 installed fine.  OS2 hangs on Disk 1  (the next disk after the
"install boot" disk) after the VGA OS2 screen and after "Loading etc".
I'm left with a flashing cursor in the top left corner.  I tried using
the original disk 1, I tried using the alternate disk 1 I made back in
Dec 94 (I think there was a keyboard.sys problem on the orig back then)
and I tried using an updated disk 1 with the new idedasd stuff that I
successfully used on a Pentium 300 install last January.

The 486 has a Promise 2300+ controller that uses its own driver, but it
does work with the IBM supplied driver.

Also, the CMOS setting for the drive is set to normal, not LBA, yet it
has always worked fine (all 1.6GB available).  Can there be a difference
now that I'm attempting to make it the boot drive?

Any suggestions?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          29-Aug-99 13:58:06
  To: All                                               29-Aug-99 15:49:09
Subj: Re: boot manager

From: piquant00@uswestmail.net (Annie K.)

On Sun, 29 Aug 1999 10:12:07, "Larry Osborne" <larry926@mindspring.com> 
wrote:

:I had finally got warp 4 installed and working on my computer.  I put win98
:in another partition.  When I rebooted after the 98 installation my boot
:manager no longer shows up.  I tried using the utility disks that I made for
:os/2 but fdisk keeps saying that the partition table maay be corrupted.  I
:tried the fddisk/newmbr and it returns an error no. 3.  Any suggestions?

 Is your Win98 partition FAT32? That may be causing the problem.

 Boot your Win98, run its fdisk to reset the Boot Manager partition 
active, and let us know what happens.

-- 
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    29-Aug-99 14:26:10
  To: All                                               29-Aug-99 15:49:09
Subj: Re: Java - IRC program, Where?

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

George Czerw (gczerw@home.No-Spam.com) wrote:
: There is a Java IRC client at the following IBM Alphaworks site:

: http://www.alphaworks.ibm.com/tech/irc

	Also, check out http://www.tucows.com, they have a considerably 
large Java depository.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: dtander@agts.net                                  29-Aug-99 14:42:27
  To: All                                               29-Aug-99 15:49:09
Subj: Re: Java - IRC program, Where?

From: dtander@agts.net (David T. Anderson)

On Sun, 29 Aug 1999 08:41:53, derek.vance.steel@natureboy.dyn.tj 
wrote:

> Hello David.
> 22 Jul 99 16:04, David T. Anderson wrote to All:
> 
> 
>  DA> I have both Java 102 and Java 117 set up on my system.  I use a  few
>  DA> Java applications (ICQ and IRC) regularly and they work quite  well, 

> Where did you get the Java IRC program?
> 
Hi Derek -- I'm using the Alphaworks Java IRC client  
[http://www.alphaworks.com]

It's available for free and I like it a lot...

David T. Anderson
Calgary, Alberta
http://www.agt.net/public/dtander/

Using ProNews/2 for OS/2 Warp

**NOSPAM**  To email me, remove the 's' from my address...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: ispalten@austin.rr.com                            29-Aug-99 15:11:16
  To: All                                               29-Aug-99 15:49:09
Subj: Re: [HELP] I'm sooo confused about OS/2 Warp packages!

From: Irv Spalten <ispalten@austin.rr.com>

Blue and Red indicates the contents of the package, Blue for 'complete'
from IBM, Red for 'incomplete' if you want to use Windows 3.x programs
and requires MS Windows 3.x on the system prior to OS/2 Install. 

'Base' vs. 'Connect' is the same packaging with respect to Blue and Red,
but Connect adds networking components. Base OS features are the same.
If you look at both boxes (if you can) you can see the content
differences. Not running a network, and I mean a real network vs. a
Dial-up (which is in both), you may not need Connect (but Connect does
contain some network applications you could use with a Dial-up I
recall).

Suggestion, forgo either of these and get Warp 4. Warp 3 and Warp 3
Connect are out of support, and there are no longer FP's available for
it past FP 40. Warp 4 is still under support. Unless your desire is
nothing more than try it out and you can get Warp 3 cheap, it may not
fit your needs in the future.

Irv

> 050812 wrote:
> 
> I really like to try OS/2 Warp (version 3), but I can't seem to choose
> which package to get.
> Can anyone enlighten me a bit please?
> 
> 1) so what's the difference between this "blue box" and "red box"
> thing?
> 2) what's the difference between "OS/2 Warp" and "OS/2 Warp Connect"?
> 3) do I really need this winos2 thing if I'm installing OS/2 on my new
> pc (without any existing os)?
> 4) is there any more *confusing* packages that I'm not even aware of?
> 
> Thanks for the clearfication!
> 
> 
> Edward

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bunzel@fh-muenchen.de                             29-Aug-99 17:59:12
  To: drowelf@nospamvnet.net                            29-Aug-99 16:52:16
Subj: Re: WinOS2 Video Problem at 1024x768x65K

To: "Eric A. Erickson" <drowelf@nospamvnet.net>
From: Martin Bunzel FH <bunzel@fh-muenchen.de>

You can change the settings in your system.ini for win-OS/2 for the
display

fdisplay.drv
and sdisplay.drv

to the old 1024x768x16M colors.

One of the is the one form full screen mode. He'll have to work as he
did in the old 1024x768x16M colors sessions. You can also rechange the
colors for all to 16M and look at the settings in the system.ini (it's
in the [Winos/2-install drive]\os2\winos2 directory.)

Martin

Eric A. Erickson schrieb:
> 
> I've got a Toshiba Tecra 8000 that uses the NeoMagic 2200 chipset. Now
> all works fine at 1024x768x16M colors, but the video response is a little
slow,
> so I cranked it down to 65K colors. OS/2 Video is much snappier at this
> level, but the WinOS2 stuff will no longer start. Both seamless and full
> screen sessions just hang with no display output. I tried using the 'Win /B'
> trick to find out what the problem is, but the BootLog shows normal loading
> of stuff, until the display.drv driver where it appears to die. I checked
out
> the Win.Ini and System.Ini and can not see anything wrong there.
> 
> I'm preplexed. Although 16M colors looks great the video perf is not that
> great 65K works much better.
> 
> Any help out there?
> Elvish Software Foundry, Inc.                   - Internet: 
drowelf@vnet.net
> IBM Certified OS/2 Warp Engineer        - IBMLink:   HONE81(ESFISA1)
> IBM Certified OS2/ Warp Developer & Associate Visual Age C++ Developer
> 'Already where I want to be Today       - Voice/Fax: (281)-398-2625 <-Newe'

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Fachhochschule Mnchen (1:109/42)

+----------------------------------------------------------------------------+

From: bunzel@fh-muenchen.de                             29-Aug-99 18:01:18
  To: jm.remacle@euronet.be                             29-Aug-99 16:52:17
Subj: Re: drive letter

To: Jean- Marie Remacle <jm.remacle@euronet.be>
From: Martin Bunzel FH <bunzel@fh-muenchen.de>

it you set as a first and second statement in config.sys
set reservedriveletter=D
set reservedriveletter=E

and D was your CD-drive, normally the drive letter for the drive has to
change to become drive F!

Martin

Jean- Marie Remacle schrieb:
> 
> I would like to assign a specific drive letter to my cd-rom.
> Can someone tell me how to do ? A command in config.sys ?
> OS/2 warp 4  fixpack 8.
> I saw in the properties dialog of drive units the command
> reservedriveletter, i tried with it but the system does recognize the cd
> drive any more.
> 
> Thank you for the help.
> 
> J.M. Remacle  Genval  Belgium.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Fachhochschule Mnchen (1:109/42)

+----------------------------------------------------------------------------+

From: bunzel@fh-muenchen.de                             29-Aug-99 18:05:15
  To: drowelf@nospamvnet.net                            29-Aug-99 16:52:17
Subj: Re: WinOS2 Video Problem at 1024x768x65K

To: "Eric A. Erickson" <drowelf@nospamvnet.net>
From: Martin Bunzel FH <bunzel@fh-muenchen.de>

You can change the settings in your system.ini for win-OS/2 for the
display

fdisplay.drv
and sdisplay.drv

to the old 1024x768x16M colors.

One of the is the one form full screen mode. He'll have to work as he
did in the old 1024x768x16M colors sessions. You can also rechange the
colors for all to 16M and look at the settings in the system.ini (it's
in the [Winos/2-install drive]\os2\winos2 directory.)

Martin

Eric A. Erickson schrieb:
> 
> I've got a Toshiba Tecra 8000 that uses the NeoMagic 2200 chipset. Now
> all works fine at 1024x768x16M colors, but the video response is a little
slow,
> so I cranked it down to 65K colors. OS/2 Video is much snappier at this
> level, but the WinOS2 stuff will no longer start. Both seamless and full
> screen sessions just hang with no display output. I tried using the 'Win /B'
> trick to find out what the problem is, but the BootLog shows normal loading
> of stuff, until the display.drv driver where it appears to die. I checked
out
> the Win.Ini and System.Ini and can not see anything wrong there.
> 
> I'm preplexed. Although 16M colors looks great the video perf is not that
> great 65K works much better.
> 
> Any help out there?
> Elvish Software Foundry, Inc.                   - Internet: 
drowelf@vnet.net
> IBM Certified OS/2 Warp Engineer        - IBMLink:   HONE81(ESFISA1)
> IBM Certified OS2/ Warp Developer & Associate Visual Age C++ Developer
> 'Already where I want to be Today       - Voice/Fax: (281)-398-2625 <-Newe'

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Fachhochschule Mnchen (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             29-Aug-99 17:17:02
  To: All                                               29-Aug-99 16:52:17
Subj: Re: CDW as a backup medium

From: rgibson@ix.netcom.com (Ron Gibson)

On Sun, 29 Aug 1999 00:10:41, sachmo@horn.net wrote:

> Ah, my favorite bitch topic - backup! More specifically, reliable 
> backup. With that warning, pardon me if I start to ramble.

Same here.
 
> same. I also consider backup the weakest link in computerdom for the 
> same reason.

Yep.
 
> Magnetic tape is questionable since I live in an area of extreme 
> humidity and high temperature most of the year. it's also aggravated 
> by the presence of feline fur that floats everywhere regardless of 
> efforts to keep it at a minimum. If you're owned by a feline, you 
 
> Current solution is a dedicated HDD to backup partitioned to daily, 
> weekly, and monthly backups along with a lot of praying, voodoo, and 
> finger crossing. Acts of Nature (hurricane, lightning) and the local 
> power utility are more worrisome to me than the chance of a drive 
> failure. Really important data gets saved to multiple floppies and 
> hard copy. So far, it's been the most foolproof solution.
 
Add a removable rack mount.  I can give you an address for an outfit I
got one for $15.  It's cold swap.  I love this setup.  No more tapes for
me...

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: lazydogbbs@yahoo.com                              29-Aug-99 17:23:17
  To: All                                               29-Aug-99 16:52:17
Subj: Re: network printer setup

From: lazydogbbs@yahoo.com (lazydog)

Hello Charles,

I can't fix your printer problem but I wanted to say Hi to you.
It has been a long time........

......Seth
(From - Harvey's Home of The LazyDOG! BBS, no, I shut down a long
time ago, sure miss it)




In message <37C92E0A.C53120FC@lvcm.com> - Charles Shapiro
<cshapiro@lvcm.com> writes:
:>
:>
:>I am trying to set up a Canon BJC-6000 on a peer-peer
:>network.  
:>
:>OS/2 / WIN98 / WIN98 machines.  No problem from WIN98 to
:>WIN98
:>machines, but from the OS/2 to the WIN98 machines I can not
:>get 
:>it set up properly.  I have a HP Laserjet hooked up to one
:>of the 
:>WIN98 machines, and the Canon is on the other.  I had no
:>problems
:>setting up the Laserjet from OS/2 to WIN98, but this Canon
:>is a different
:>story.  I am not sure which drivers I used to install the
:>Laserjet on
:>the OS/2 machine, but the properties window has some network
:>stuff in it,
:>while the Canon does not after it's installed.
:>
:>The Canon printer turns itself on automatically when it
:>see's a print job
:>coming and I can get it to do that (turn on), from the OS/2
:>machine, but
:>it doesn't print.  I am using the OMNI drivers off IBM's
:>Device Driver Page
:>(recently updated) to try and get this printer installed.
:>
:>I have not bothered to call Canon as I know they do NOT
:>support OS/2 (own a BJC-610)
:>also and could never get any support for it either.  Why I
:>didn't just get an HP
:>Deskjet I don't know, which would have probably  worked fine
:>like the Laserjet does.
:>
:>Appreciate any help you might have to offer.
:>
:> 
:>...Chip..
:>
:>---
:>
:>
:>                          Stop Smoking with Lifesign
:>                            Scientifically Proven
:>                            Visit www.at.pair.com




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: BASS Fishing Nut - Nascar Fan GO #6 - (1:109/42)

+----------------------------------------------------------------------------+

From: bunzel@fh-muenchen.de                             29-Aug-99 17:50:12
  To: larry926@mindspring.com                           29-Aug-99 16:52:17
Subj: Re: boot manager

To: Larry Osborne <larry926@mindspring.com>
From: Martin Bunzel FH <bunzel@fh-muenchen.de>

Try out running fdisk within a dos box in Win98; change the active
Partition to the one from the boot manager (it's described as non-dos
Partition with app. 1 MB disk usage); reboot. If it doesn't work, reboot
with the installation disks from warp and run setup until the menu
option appears to quit setup to an OS/2 prompt. Then run fdisk from your
diskettes and reinstall the boot manager (delete the old one and then
select the residing disk space to install it for a second time. It'll
work.

Martin

Larry Osborne schrieb:
> 
> I had finally got warp 4 installed and working on my computer.  I put win98
> in another partition.  When I rebooted after the 98 installation my boot
> manager no longer shows up.  I tried using the utility disks that I made for
> os/2 but fdisk keeps saying that the partition table maay be corrupted.  I
> tried the fddisk/newmbr and it returns an error no. 3.  Any suggestions?
> 
> Larry

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Fachhochschule Mnchen (1:109/42)

+----------------------------------------------------------------------------+

From: lyn@zolotek.REMOVE-SPAM.com                       29-Aug-99 19:14:20
  To: All                                               29-Aug-99 19:53:18
Subj: Re: MySQL server 3.22.19b doesn't start

From: lyn@zolotek.REMOVE-SPAM.com

On Sun, 29 Aug 1999 02:16:30, Stefan Schwarzer 
<Stefan.Schwarzer@tu-clausthal.de> wrote:

> Hi,
> 
> to install MySQL 3.22.19b, I unzipped the binary zip file to
> e:/mysql2. Calling install.cmd on the command line doesn't seem
> to cause any trouble; a folder on the WPS is also created.
> 
> However, if I try to start the server mysqld, I get the message
> 
> 990827 22:31:14  Can't start server : UNIX Socket : Protocol family not
supported
> 990827 22:31:14  Aborting
> 
> I checked my loopback configuration (ping localhost works whether
> I'm online or not) but the problem persists.
> 
> Some configuration data:
> 
> - Warp 4 (German) with fixpack 10
> - TCP/IP 4.0(?)
> - emx 0.9d
> - HPFS on D: (boot drive) and E: (MySQl installation drive)
> 
> Any help would be fine. :-) 
> 
> Best regards
>  Stefan

Hi Stefan

I have an older version, which works OK - these are copied from the 
os/2 windows:

[E:\mysql2\bin]mysqld -Sg -l
mysqld  Ver 3.21.33b-log for ibm-os2 on i386
OS/2 Port by Antony T Curtis <antony.curtis@olcs.net>
mysqld: ready for connections

and then from a second window (issuing 'mysqladmin'):

mysqladmin  Ver 6.9 Distrib 3.21.33b, for ibm-os2 on i386
TCX Datakonsult AB, by Monty

Server version          3.21.33b-log
Protocol version        10
Connection              Localhost via UNIX socket
UNIX socket             \socket\mysql.sock
Uptime:                 35 sec

Running threads: 1  Questions: 1  Opened_tables: 0  Flush tables: 1  
Open tables
: 0

This is on Warp4, fp 6, hpfs, tcpip 4.1 (?) from the Aurora CD, emx 
0.9d. I don't understand this bit about Unix socket protocols - 
everything I've read says that OS/2 does not support this, and uses 
INET style sockets only, yet a netstat -s shows (besides a number of 
AF_INET sockets), an AF_OS2 socket which is the mysql.sock. This used 
to work before installing the Aurora tcpip stuff, with just the 
standard version off the Warp4 CD. Sorry I can't be of more help, but 
if you want to try with 
this version of MySQL, and can't find it, I'll send it to you if you 
want. All I did was to unzip it - there's no install.cmd with this 
version.

Cheers
Lyn St George
lyn at zolotek dot com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jbrush@aros.net                                   29-Aug-99 13:36:29
  To: All                                               29-Aug-99 19:53:19
Subj: Re: [HELP] I'm sooo confused about OS/2 Warp packages!

From: jbrush@aros.net


>1) so what's the difference between this "blue box" and "red box" thing?

The blue box package includes a full blown Win3.1 package built in. This
means that if you want to run windows 3.1 programs, its all there in the
box for you to use. You do not need your own copy of W3.1

The Red package does not include any windows 3.1 software, so if you want
to run Win3.1 from within OS/2, you need to all ready have a copy of
win3.1 on your machine. If you do have windows intstalled on your drive,
OS/2 ver 3 Red Spine will incorporate that version of Windows into your
OS/2 package to make them run together seamlessly. 

Why? In addition to licensing details, red was cheaper than blue, since it
did not include windows (IBM didn't have to pay M$ a royalty fee for that
copy)

>2) what's the difference between "OS/2 Warp" and "OS/2 Warp Connect"?

OS/2 Warp does not come out of the box with any networking capability. It
DOES contain a bonus pak CD which allows to you connect to the internet
via TCPIP, but networking with other PC's or servers is not available.

OS/2 Warp Connect comes with built in networking support for Novell, and
other networks, including TCPIP for internet access.

The blue and red thing also applies to Warp, and Warp connect.

 3)do I really need this winos2 thing if I'm installing OS/2 on my new pc
>(without any existing os)?

If you do not wish to run any W3.1 software, you don't need winos2,
therefore warp Red, either connect or plain, will work fine for you.

 4) is there any more *confusing* packages that
>I'm not even aware of?

I think that is all of them, assuming you are no longer confused :-)

Things to be aware of:

Early releases of Warp3 do not come out of the box with support for PPP
connections, which most ISPs require. There are patches and updates to get
you there. IBM will no longer release fixpaks for warp3. I think the last
one was 40. Fixpaks are easy to install, long time to download. The later
ones will make Warp3 Y2K Ok.

If you want to grab a cheap copy and see what OS/2 is all about, Warp3
will get you there. If you want the latest, bestest support, and want to
keep up with Netscape releases as well as Java, then Warp3 will leave you
behind. However, nearly every piece of software written for Warp4 will run
in Warp3, at least up to today. I have no idea what the future will bring.

You can get a full copy of OS/2 Warp4, with built in Voice Dictation, (an
early version, not as spiffy as the latest stuff) windows support (meaning
3.1 is built in), Java and a host of other niceties, from Indelible Blue
for $85  This is the academic version. Its all there except the microphone
for voice. All you need is  a student ID. (Most people know at least one
person in some kind of schooling. Its a great deal)

Too avoid any confusion. Warp4 only comes in one version. There is no red,
no blue, no networking left out, nothing like that. Warp 4 contains its
own version of W3.1 software, full networking capability, and with the
application of the latest fixpak and Java, you will be right there at the
top looking down at the rest of the windows world :-)

More questions? We are open 24hrs. Usually.

Regards,

John

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ArosNet Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  29-Aug-99 17:26:15
  To: All                                               29-Aug-99 19:53:19
Subj: Re: Anyone with UMAX 610P scanner

From: mchasson@ibm.net

In <37c882f8$1$woehfu$mr2ice@news.aros.net>, on 08/28/99 at 06:38 PM,
   jbrush@aros.net said:

>I bought one, and it runs well under WinOS2 with one exception:

>I need the copy facility, but it won't work because when it tries to
>print, it says the device is in use and the printer screen gives me the
>big red X. 

>I have to shut down the copier to get the output to go to the printer.
>Frustrated is not the word for it as I ditched a Microtek E3 which is
>totally useless under OS/2, in hopes of being able to use the UMAX like a
>lot of folks say.

>I have tried every setting I can think of in the settings for the
>session. The question is simply, does the copier work for anyone like it
>should or is there still no way to use a scanner under OS/2?

>John

I dont use it for copying since I have a copying machine here.  But I do
recall using it to try it out and it worked.  But, I have the scanner on
LPT2 and the Printer on LPT1.  If you have the slot for it, an LPT2 card
is just a couple of bucks and lets you set up the printer independently.


-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: rjfreem@ibm.net                                   29-Aug-99 12:37:23
  To: All                                               30-Aug-99 03:42:10
Subj: Re: System Upgrade Renders OS/2 Warp 4 Unbootable

From: rjfreem@ibm.net

In <37c8209e.51781228@news.vt.edu>, on 08/28/99 
   at 05:58 PM, gemorga2@vt.edu said:

The boot blob can be accessed at 558mHz with ALT -F2 using my 76 yr old
fingers. RJF

>I recently did the following hardware changes to my system:

>Old Hardware:

>VX Chipset Socket 7 Motherboard w/IBM 6x86 120 mhz
>Matrox Millenium I w/8mb RAM (PCI)
>Adaptec 2940UW PCI to UW SCSI controller
>    IBM Ultrastar 2XP 4.5 GB hard drive UW SCSI
>    Toshiba 6.7X SCSI  CD-ROM
>    NEC 6xi SCSI CD-ROM
>    Quantum Fireball ST 2.1 GB Ultra Narrow HD
>SoundBlaster AWE32 ISA PnP
>Intel EtherExpress PRO 100B PCI
>48 MB worth of Fast Page Mode 72 pin simms

>New Hardware:

>Abit BX6 2.0 w/1/5/2 (AGP/PCI/ISA)
>ASUS Socket 370 to Slot 1 adapter
>Intel Celeron 366 (66 mhz x 5.5)
>64 MB Micron Technology PC100 SDRAM (one DIMM)
>Diamond Stealth S220 4MB (the Millenium appears to have died) Adaptec
>2940UW PCI to UW SCSI controller
>    IBM Ultrastar 2XP 4.5 GB hard drive UW SCSI
>    Toshiba 6.7X SCSI  CD-ROM
>    NEC 6xi SCSI CD-ROM
>    Quantum Fireball ST 2.1 GB Ultra Narrow HD
>SoundBlaster AWE32 ISA PnP
>Intel EtherExpress PRO 100B PCI


>I realize that this is a drastic change in hardware.  OS/2 is in a
>primary partition (HPFS) on the IBM drive which is booted using Boot
>Magic (I have a lot of OSes)  Win95 works fine (after installing new
>drivers)  WinNT Workstation 4.0 SP5 worked fine after installing the
>Diamond drivers.

>While booting OS/2, some network initialization fails (I don't think it
>can find the PCI bus since it may not recognize the bridge chipset) and
>core dumps slightly after trying to init networking.  I never see the
>desktop.

>What I wanted to do was go into the "Safe Mode" for OS/2 and apply
>whatever driver changes that are necessary.  My new system is so fast
>that I can't hit the F-key to get the boot options menu.  Once I was able
>to hit F2 and boot the previous version of OS/2 but I could not remember
>what I should do from there.

>Which F-key gives me the menu with options???

>Thank you for any help.



-- 
-----------------------------------------------------------
rjfreem@ibm.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: "operagost"@e-mail.com (remove t...               29-Aug-99 22:29:20
  To: All                                               30-Aug-99 03:42:11
Subj: Re: NetGear NIC

Message sender: "operagost"@e-mail.com (remove the - )

From: Stephen Eickhoff <"operagost"@e-mail.com (remove the - )>

I avoided Netgear (aka BayNetworks) like a leper because they are the
only network hardware manufacturer I have ever seen which does not
advertise OS/2 compatibility. However, I did find in the specs for the
FA310TX (I believe that's your card) that NDIS 2.0 and Netware drivers
are available:

http://netgear.baynetworks.com/support/support.shtml/#nc

Good luck. Buy a Linksys next time.

Lucky wrote:

> HiI am having a problem with finding the OS/2 device driver for
> NetGear FX310 TX PCI 10/100 Ethernet card.Can anybody help me on
> that? Thanks in advance  Lucky

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jbrush@aros.net                                   29-Aug-99 16:28:13
  To: All                                               30-Aug-99 03:42:11
Subj: Re: Anyone with UMAX 610P scanner

From: jbrush@aros.net

>I dont use it for copying since I have a copying machine here.  But I do
>recall using it to try it out and it worked.  But, I have the scanner on
>LPT2 and the Printer on LPT1.  If you have the slot for it, an LPT2 card
>is just a couple of bucks and lets you set up the printer independently.

Thanks. That is where I am going this week. 

FWIW, I also cannot access the parallel ZIP drive with the scanner on the
same port either, so, its off to the computer store.

Regards,

John




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ArosNet Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    29-Aug-99 22:57:24
  To: All                                               30-Aug-99 03:42:11
Subj: FAT32 IFS tips...

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

	First things first...hats off to Henk Kelder for a *swank* FAT32 
driver for OS/2. :-)

	Anyhow, I have my FAT32 driver installed exactly the way I saw it 
in the fat32.txt file (ie. BASEDEV=PARTFLT.FLT /P 0b /W)

	My hard drive is setup as the following:

Win95 - Primary Partition - FAT32
OS/2 - Primary Partition - HPFS
Logical Partition - FAT32
Boot Manager - Primary Partition

	Now, when I launch OS/2, C: is OS/2, but it didn't hide the C: 
Win95 partition.  I can in fact read/write to it.  I didn't really want 
that, though.  Basically, I wanted the Win95/OS2 primary partitions 
completely hidden from one another.  So that made my original D: 
partition into an E: partition (now that Win95 was D:).
	Any chance I can setup the driver so that I only see C: belonging 
to OS/2, and D: belonging to the logcal FAT32 partition?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: chmims@ibm.net                                    29-Aug-99 19:30:04
  To: All                                               30-Aug-99 03:42:11
Subj: IBM Home and Away Credit Card Adapter and OS/2

From: "Charles Mims" <chmims@ibm.net>

I am having trouble getting the IBM multifunction H & A Credit Card Adapter
to work in OS/2.  I am using the ss2intel.sys PCMCIA controller driver.  The
card is recognized, but I am unable to get either the modem or ethernet to
function.  After installing the card and drivers I get error messages when I
boot-up, but all they say are they cannot find certain LTU00xx error messages
which leaves me in the dark.

What is especially frustrating is after much work I got the card working in
Win95, and Linux just recognized and started using it with almost no effort
(at least the ethernet).  It is a card that comes with very specific
instructions and drivers for installing it in OS/2 but  so far no luck.  If
any one is using the card successfully in OS/2 I would appreciate knowing the
secret.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           30-Aug-99 01:45:01
  To: All                                               30-Aug-99 05:29:12
Subj: Re: OS/2 Friendly Internal Modem?

From: doug.bissett"at"ibm.net (Doug Bissett)

On Fri, 27 Aug 1999 18:50:07, "George Barrowcliff" 
<barrowcl@flash.net> wrote:

> THe problem with external modems is I am using both com ports for
> communication with some local hardware components and I didn't want to buy
> extra com ports.
>  

That does present a bit of a problem. There are also USB modems, that 
will work, if you have the correct type of USB adapter (sorry, I don't
have all of the details, but there has been a lot of discussion about 
that in some of the newsgroups). Otherwise, you may be able to pick up
some "old stock" USR internal modems, or some other brand. The basic 
"rule" seems to be "if it has jumpers it will, probably, work". If it 
does not have jumpers, it MIGHT work, if you can convince your Plug 
and Pray system to properly detect it, and configure it consistently 
(this can be a big challenge, at times). You may also need to add 
parameters to the COM.SYS line (or SIO.SYS, if you use that), in 
CONFIG.SYS (do HELP COM.SYS for more info).

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: drowelf@nospamvnet.net                            29-Aug-99 20:57:21
  To: All                                               30-Aug-99 05:29:12
Subj: Re: WinOS2 Video Problem at 1024x768x65K

From: "Eric A. Erickson" <drowelf@nospamvnet.net>

On Sun, 29 Aug 1999 17:59:25 +0200, Martin Bunzel FH wrote:

>You can change the settings in your system.ini for win-OS/2 for the
>display
>
>fdisplay.drv
>and sdisplay.drv
>
>to the old 1024x768x16M colors.
>
>One of the is the one form full screen mode. He'll have to work as he
>did in the old 1024x768x16M colors sessions. You can also rechange the
>colors for all to 16M and look at the settings in the system.ini (it's
>in the [Winos/2-install drive]\os2\winos2 directory.)
>
>Martin

That did not work too well. Setting the colors to 65K and the
WinOS2 Settings to 16M results in corrupted WinOs2 Display.

Elvish Software Foundry, Inc.    		- Internet:  drowelf@vnet.net
IBM Certified OS/2 Warp Engineer 	- IBMLink:   HONE81(ESFISA1)
IBM Certified OS2/ Warp Developer & Associate Visual Age C++ Developer
'Already where I want to be Today 	- Voice/Fax: (281)-398-2625 <-Newe'


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Elvish Software Foundry, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: larry926@mindspring.com                           29-Aug-99 22:24:18
  To: All                                               30-Aug-99 05:29:13
Subj: Re: boot manager

From: "Larry Osborne" <larry926@mindspring.com>

I want to thank all the people that responded to my post.  I went into dos
in win98 and made the non-dos partition active and my boot manager is now
working like a charm.  Again, Thank You all.

Larry

>"Larry Osborne" <larry926@mindspring.com> wrote:
>>I had finally got warp 4 installed and working on my computer.  I put
win98
>>in another partition.  When I rebooted after the 98 installation my boot
>>manager no longer shows up.  I tried using the utility disks that I made
for
>>os/2 but fdisk keeps saying that the partition table maay be corrupted.  I
>>tried the fddisk/newmbr and it returns an error no. 3.  Any suggestions?



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                30-Aug-99 03:45:16
  To: All                                               30-Aug-99 05:29:13
Subj: Re: network printer setup

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <37C92E0A.C53120FC@lvcm.com>, Charles Shapiro <cshapiro@lvcm.com> writes:
>
>I am trying to set up a Canon BJC-6000 on a peer-peer
>network.  

   All that you should have to do, is once the printer is set up
as a resource on the Windows machine, is to drag off a "Network
Printer" template and fill in the blanks.  The Canon printer
should be listed on the server machine.


>OS/2 / WIN98 / WIN98 machines.  No problem from WIN98 to
>WIN98
>machines, but from the OS/2 to the WIN98 machines I can not
>get 
>it set up properly.  I have a HP Laserjet hooked up to one
>of the 
>WIN98 machines, and the Canon is on the other.  I had no
>problems
>setting up the Laserjet from OS/2 to WIN98, but this Canon
>is a different
>story.  I am not sure which drivers I used to install the
>Laserjet on
>the OS/2 machine, but the properties window has some network
>stuff in it,
>while the Canon does not after it's installed.
>
>The Canon printer turns itself on automatically when it
>see's a print job
>coming and I can get it to do that (turn on), from the OS/2
>machine, but
>it doesn't print.  I am using the OMNI drivers off IBM's
>Device Driver Page
>(recently updated) to try and get this printer installed.
>
>I have not bothered to call Canon as I know they do NOT
>support OS/2 (own a BJC-610)
>also and could never get any support for it either.  Why I
>didn't just get an HP
>Deskjet I don't know, which would have probably  worked fine
>like the Laserjet does.
>
>Appreciate any help you might have to offer.
>
> 
>...Chip..
>
>---
>
>
>                          Stop Smoking with Lifesign
>                            Scientifically Proven
>                            Visit www.at.pair.com


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                30-Aug-99 03:49:07
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Where is MMPM2 driver?

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <eleS4DQ3N6dS-pn2-cusonTzExf4v@tam-fl7-01.ix.netcom.com>,
rgibson@ix.netcom.com (Ron Gibson) writes:
>Where is the MMPM2 driver for Warp 3 (FP40)?
>
>I'm still using an ancient PAS 16 and I wanted to play audio CD's and

   That is my favourite sound card.

>can't figure a way to do it with a native OS/2 application.  I
>downloaded something off of Hobbes and when I try to use it I get this
>can't load MMPM2 driver.  Well, no wonder.  It's not there but I see an
>MMPM2.INI file????
>
>Interesting to note that an old DOS application that came with the card
>called musicbox works just fine in the background and it's a TSR!

   You probably don't have MMPM (multimedia) support installed.
Go into "Selective Install", and install MMPM.  For the PAS, I
use DMA 6, IRQ 12, and for the SB side, DMA 1 and IRQ 5.


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: derek.vance.steel@natureboy.dyn.tj                30-Aug-99 02:41:22
  To: All                                               30-Aug-99 05:29:13
Subj: Largest possible eide disk with the new idedasd.exe??

From: derek.vance.steel@natureboy.dyn.tj

Hello UUCP.

13 Aug 99 11:59, "R. Pronk" <R.Pronk@twi.tudelft.nl> wrote to All:

 RP> Hi all,

 RP> does anyone know how big the largest possible eide disk can be
 now
 RP> with the new idedasd.exe. It says larger than 8.4G, but does
 that
 RP> finally means unlimited??



I am using it with a 17 gig drive at the moment, Quantum I think.  It
 actually formats out to 16.8 under HPFS

Its not my drive, I installed it into the neighbours OS/2 machine
 which functions as the web and ftpserver.

After installing the 17 gig drive, I did have to update the IDE
 drivers before more than 8.x gigs would show up on fdisk.

We have lan running between apartments in the building, sharing space
 and the ADSL connection

Live Long and Prosper,



Derek


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Starfire Couriers (1:109/42)

+----------------------------------------------------------------------------+

From: sachmo@horn.net                                   30-Aug-99 05:43:06
  To: All                                               30-Aug-99 05:29:13
Subj: Re: CDW as a backup medium

From: sachmo@horn.net

On Sun, 29 Aug 1999 17:17:04, rgibson@ix.netcom.com (Ron Gibson) 
wrote:

> Add a removable rack mount.  I can give you an address for an outfit I
> got one for $15.  It's cold swap.  I love this setup.  No more tapes for
> me...

	Do it to me. Thanks.

Gene
---------------
pequod@gate.net

The minstrel boy to the war is gone
In the ranks of death you'll find him;
One sword, at least, thy rights shall guard;
Words shall never sound in slavery!
            --Thomas Moore (1779-1852)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CyberGate, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: janswa@algonet.se                                 30-Aug-99 08:56:03
  To: All                                               30-Aug-99 12:22:13
Subj: Re: Fonts

From: janswa@algonet.se (Jan Swartling)

On Sun, 29 Aug 1999 10:12:00, "Jan Danielsson" 
<Jan.Danielsson@falun.mail.telia.com> wrote:

> >>I have made the C64 font for OS/2 with the font editor. How do I register
it
> >>with OS/2 so I can use it with EPM or lxpm?
> >
> >   I don't know about M$ font (TT) support, but with Type 1
> >fonts, you just use your "System Setup --> Font Palette --> Edit
> >Font -->Add" menus.
> 
> Been there, done that, didn't produce any results. :-(
> 
> It seems that the 'add font' function you mention looks for some file which
> defines the font. ...if so, is it possible to make one for a *.fnt file?
> 
Jan, 

I really don't know much on fonts, but I think that in order to 
install a Type 1 you have to have at least two files:

 *.PFB which is the font outline description
 *.AFM which describe the fonts metric details

When the *.AFM is installed I believe it is converted to an *.OFM file
like the ones you see in the '/PSFONTS' directory.

In Windows environment the *AFM file is called *.PFM. If you have 
*.PFM files you can convert to AFM with the program 'PFM2AFM.ZIP' or 
'PFMAFM.ZIP' which you can find on OS2BBS or possibly Hobbes.

There is also a program called 'FONTFOLDER' which help the user to 
handle all the fonts. It's on OS2BBS as 'FBTF30A.ZIP'.

Jan Swartling
 Blue Soft
 Sweden

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Blue Soft (1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            30-Aug-99 09:32:15
  To: All                                               30-Aug-99 12:22:13
Subj: Re: IBM Home and Away Credit Card Adapter and OS/2

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On Sun, 29 Aug 1999 19:30:09 -0500 (CDT), Charles Mims <chmims@ibm.net> wrote:
>I am having trouble getting the IBM multifunction H & A Credit Card
>Adapter to work in OS/2.  I am using the ss2intel.sys PCMCIA controller
>driver.  The card is recognized, but I am unable to get either the
>modem or ethernet to function.  After installing the card and drivers I
>get error messages when I boot-up, but all they say are they cannot
>find certain LTU00xx error messages which leaves me in the dark.
>
>What is especially frustrating is after much work I got the card
>working in Win95, and Linux just recognized and started using it with
>almost no effort (at least the ethernet).  It is a card that comes with
>very specific instructions and drivers for installing it in OS/2 but so
>far no luck.  If any one is using the card successfully in OS/2 I would
>appreciate knowing the secret.


I do, and since it took some time to get it right I uploaded the
description as homeaway.zip (or so) to http://ftp-os2.nmsu.edu, where it
still resides and can be found easily with the search function of the
site. It's a neat card.

             Good luck!  Stefan

-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      30-Aug-99 01:30:06
  To: All                                               30-Aug-99 12:22:13
Subj: Re: IBM Home and Away Credit Card Adapter and OS/2

From: nospam@savebandwidth.invalid     (John Thompson)

In <puzvzfvozarg.fh92m90.pminews@news-s01.ny.us.ibm.net>, "Charles Mims"
<chmims@ibm.net> writes:

>I am having trouble getting the IBM multifunction H & A Credit Card Adapter
>to work in OS/2.  I am using the ss2intel.sys PCMCIA controller driver.  The
>card is recognized, but I am unable to get either the modem or ethernet to
>function.  After installing the card and drivers I get error messages when I
>boot-up, but all they say are they cannot find certain LTU00xx error messages
>which leaves me in the dark.
>
>What is especially frustrating is after much work I got the card working in
>Win95, and Linux just recognized and started using it with almost no effort
>(at least the ethernet).  It is a card that comes with very specific
>instructions and drivers for installing it in OS/2 but  so far no luck.  If
>any one is using the card successfully in OS/2 I would appreciate knowing the
>secret.

I just got both modem and ethernet working on my wife's laptop
(Compaq Contura Aero 4/25).  Took a heck of a lot of persistence
it it finally works!  I had the modem worked for quite some time
before this without much trouble at all, but found I had to ditch
the SIO.SYS comm drivers I had been using and use the COM.SYS 
driver that shipped with the card.  This machine uses
BASEDEV=SSVLSI.SYS instead of SS2INTEL.SYS but otherwise ought to
be similar:

Here is the relevent part of CONFIG.SYS:

DEVICE=C:\IBMCOM\PROTOCOL\LANPDD.OS2
DEVICE=C:\IBMCOM\PROTOCOL\LANVDD.OS2
DEVICE=C:\IBMCOM\LANMSGDD.OS2 /I:C:\IBMCOM
DEVICE=C:\IBMCOM\PROTMAN.OS2 /I:C:\IBMCOM
CALL=C:\IBMCOM\PROTOCOL\NETBIND.EXE
run=c:\ibmcom\lanmsgex.exe

DEVICE=C:\MPTN\PROTOCOL\SOCKETS.SYS
DEVICE=C:\MPTN\PROTOCOL\AFOS2.SYS
DEVICE=C:\MPTN\PROTOCOL\AFINET.SYS
DEVICE=C:\MPTN\PROTOCOL\ifndis.sys
run=c:\mptn\bin\afnbini.exe
device=c:\mptn\protocol\afnb.sys
RUN=C:\MPTN\BIN\CNTRL.EXE
CALL=C:\OS2\CMD.EXE /Q /C C:\MPTN\BIN\MPTSTART.CMD
run=c:\ibmcom\protocol\nbtcp.exe
REM DEVICE=C:\TCPIP\BIN\INET.SYS
REM DEVICE=C:\TCPIP\BIN\IFNDISNL.SYS
DEVICE=C:\TCPIP\BIN\VDOSTCP.VDD
DEVICE=C:\TCPIP\BIN\VDOSTCP.SYS
DEVICE=C:\IBMCOM\PROTOCOL\NETBEUI.OS2
device=c:\ibmcom\protocol\tcpbeui.os2
DEVICE=C:\IBMCOM\PROTOCOL\NETBIOS.OS2
device=c:\ibmcom\macs\FME_NDIS.OS2 /v

In /IBMCOM/PROTOCOL.INI I gave up trying to assign I/O address, 
IRQ, etc and just let the driver figure it out dynamically on 
boot:

[FME_NDIS_NIF]

;IBM Home and Away PC Card
  DriverName = FME_CS$
;        COMPORT = 2
;        INTERRUPT = 3
        PCMCIA
;       COMIOBASE = 0x4F8

I think that's why I need to use the provided COM.SYS driver as 
it has been modified to accept dynamically assigned resources 
while SIO.SYS and the stock COM.SYS didn't know what to do inthat
situation.


-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             30-Aug-99 11:45:18
  To: All                                               30-Aug-99 12:22:13
Subj: Re: Where is MMPM2 driver?

From: rgibson@ix.netcom.com (Ron Gibson)

On Mon, 30 Aug 1999 03:49:14, baden@unixg.ubc.ca   (Baden Kudrenecky) 
wrote:

> >I'm still using an ancient PAS 16 and I wanted to play audio CD's and
 
>    That is my favourite sound card.

I like it too.  Rugged and easy to use.  Playing CD's while not a
necessity is a nice luxury.  With a cupole of amplified Labtec speakers
it sounds like a nice stereo system. 
 
> >can't figure a way to do it with a native OS/2 application.  I
> >downloaded something off of Hobbes and when I try to use it I get this
> >can't load MMPM2 driver.  Well, no wonder.  It's not there but I see an
> >MMPM2.INI file????

>    You probably don't have MMPM (multimedia) support installed.
> Go into "Selective Install", and install MMPM.  For the PAS, I
> use DMA 6, IRQ 12, and for the SB side, DMA 1 and IRQ 5.
 
No, I've got it installed and FP40 for for Warp 3.  

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            30-Aug-99 12:04:07
  To: All                                               30-Aug-99 12:22:13
Subj: Re: IBM Home and Away Credit Card Adapter and OS/2

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On Mon, 30 Aug 1999 01:30:13 GMT, John Thompson
<nospam@savebandwidth.invalid> wrote:
>In <puzvzfvozarg.fh92m90.pminews@news-s01.ny.us.ibm.net>, "Charles
>Mims" <chmims@ibm.net> writes:
>
>>I am having trouble getting the IBM multifunction H & A Credit Card
>>Adapter to work in OS/2.  I am using the ss2intel.sys PCMCIA
>>controller driver.  The card is recognized, but I am unable to get
>>either the modem or ethernet to function.  After installing the card
>>and drivers I get error messages when I boot-up, but all they say are
>>they cannot find certain LTU00xx error messages which leaves me in the
>>dark.

 [ cut ]

>I just got both modem and ethernet working on my wife's laptop (Compaq
>Contura Aero 4/25).  Took a heck of a lot of persistence it it finally
>works!  I had the modem worked for quite some time before this without
>much trouble at all, but found I had to ditch the SIO.SYS comm drivers
>I had been using and use the COM.SYS driver that shipped with the card.
>This machine uses BASEDEV=SSVLSI.SYS instead of SS2INTEL.SYS but
>otherwise ought to be similar:

[snip]

>I think that's why I need to use the provided COM.SYS driver as 
>it has been modified to accept dynamically assigned resources 
>while SIO.SYS and the stock COM.SYS didn't know what to do inthat
>situation.

That seems to be correct, and it also is a possible drawback, as now you
can't use any additional com ports at speeds higher than what ever Warp
3 had. IIRC, Warp 4 introduced higher com port speeds useful for 56kB
modems / ISDN compressed etc. Not my problem now, but may be one day.
OTHO, I'll probably go ISDN router and just use the ethernet portion of
the card then.

         Cheers, Stefan


-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: Frank@get-lost.spam                               30-Aug-99 13:37:18
  To: All                                               30-Aug-99 16:56:26
Subj: Re: Running Viper 550 PCI under Warp 3 FP 39?

From: Frank@get-lost.spam (Frank)

On Wed, 25 Aug 1999 09:58:00, Christian Placzek <C.Placzek@gmx.de> 
wrote:

> Hello,
> 
> I 've tried to install the Viper 550 with GRADD-driver from NVidia. It
> works, but I only get 57Hz on a resolution of 1600x1200. Is this a
> Problem of GRADD? I have manualy edit the C:\os2\video.cfg but it
> changes nothing. 
> 
> Any hints?
>

Try changing your monitor type to a (better) compatible one.

On my 15" LG Electronics 57M I use type DDC 2 GSM 15051.

Greeetings,


Frank

The box said:"Requires Windows 95/98, NT or better" .......... So I 
too installed OS/2.


Reply per Email to franklyware@-NOSPAM-beer.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: sgfarris@aracnet.com                              30-Aug-99 16:51:07
  To: All                                               30-Aug-99 16:56:27
Subj: Fixpack 7 = no ide cdrom?

From: sgfarris@aracnet.com (Steve Farris)

I've been struggling to recreate my machine.  I installed a new 8 gig drive
and replaced my trusty old and slow scsi cd with a shiny new fast ide cd
drive.

Install works fine, I have access to the cd drive.  But after applying
fixpack 7, The cd has disappeared.  when I turn on verbose mode for the
drivers, os2cdrom.dmd says it can't load.  I've tried replacing files from
a backup.  I've tried several different install routes.  Nothing seems to
work.  When I go to selective install, the cd is in the options so nothing
happens when I say ok. 

I guess I will try deselecting the drive from setup and then reinstalling
it.  I might also try replacing the drivers with the original install
drivers.  Any thought out there as to how to proceed?  Would fixpack 11
help?  I didn't see any of the cd drivers in the fixpack files.  I need fp
7 because it allows access to my zip as a normal removable drive (didn't
like all the workarounds I was using before the fixpack came out...).

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: aracnet.com (1:109/42)

+----------------------------------------------------------------------------+

From: bunzel@fh-muenchen.de                             30-Aug-99 20:42:15
  To: drowelf@nospamvnet.net                            30-Aug-99 16:56:28
Subj: Re: WinOS2 Video Problem at 1024x768x65K

To: "Eric A. Erickson" <drowelf@nospamvnet.net>
From: Martin Bunzel FH <bunzel@fh-muenchen.de>

...don't know if it works for all adapters and for Win-OS/2
window-settings. In full screen mode, it should be possible to run a
different display setting.

Martin

Eric A. Erickson schrieb:
> 
> On Sun, 29 Aug 1999 17:59:25 +0200, Martin Bunzel FH wrote:
> 
> >You can change the settings in your system.ini for win-OS/2 for the
> >display
> >
> >fdisplay.drv
> >and sdisplay.drv
> >
> >to the old 1024x768x16M colors.
> >
> >One of the is the one form full screen mode. He'll have to work as he
> >did in the old 1024x768x16M colors sessions. You can also rechange the
> >colors for all to 16M and look at the settings in the system.ini (it's
> >in the [Winos/2-install drive]\os2\winos2 directory.)
> >
> >Martin
> 
> That did not work too well. Setting the colors to 65K and the
> WinOS2 Settings to 16M results in corrupted WinOs2 Display.
> 
> Elvish Software Foundry, Inc.                   - Internet: 
drowelf@vnet.net
> IBM Certified OS/2 Warp Engineer        - IBMLink:   HONE81(ESFISA1)
> IBM Certified OS2/ Warp Developer & Associate Visual Age C++ Developer
> 'Already where I want to be Today       - Voice/Fax: (281)-398-2625 <-Newe'

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Fachhochschule Mnchen (1:109/42)

+----------------------------------------------------------------------------+

From: jkross@TIRED_OF_SPAM@oxford.net                   30-Aug-99 20:43:05
  To: All                                               30-Aug-99 21:34:14
Subj: Re: Fixpack 7 = no ide cdrom?

From: jkross@TIRED_OF_SPAM@oxford.net (John Ross)

In message <37cab4b5.262651@news.aracnet.com> - sgfarris@aracnet.com (Steve
Farris) writes:
:>
:>I've been struggling to recreate my machine.  I installed a new 8 gig drive
:>and replaced my trusty old and slow scsi cd with a shiny new fast ide cd
:>drive.
:>
:>Install works fine, I have access to the cd drive.  But after applying
:>fixpack 7, The cd has disappeared.  when I turn on verbose mode for the
:>drivers, os2cdrom.dmd says it can't load.  I've tried replacing files  

	If you install the CD-ROM on an IDE channel you must jumper the drive as
master if it is the only device.	With older versions of IDE1s506.add it didn't
matter.

-john ross

http://www.oxford.net/~jkross

Remove "@I_hate_spam" from address to reply.... 

              
--
"Usenet is like a herd of performing elephants with diarrhea --
massive, difficult to redirect, awe-inspiring, entertaining, and a
source of mind-boggling amounts of excrement when you least expect
it."--spaf@cs.purdue.edu (1992)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Organization of Irate People (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  30-Aug-99 18:24:00
  To: All                                               30-Aug-99 21:34:15
Subj: What did I do wrong this time???

From: mchasson@ibm.net

My CDRom drive is fairly new and was working fine up until today when
after putting in new speakers, I started playing around with the MM setup
and then clicked on the CDPM object which I had never used in my life, and
now...The drive door will not open.  It just blinks at me a few times when
I push the button.

I shut down, and I did a power off and all the usual things for balky
physical devices, but nothing works.   Surely this is not the end for
Rico.

Suggestions please

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             30-Aug-99 22:49:16
  To: All                                               31-Aug-99 03:52:24
Subj: Re: CDW as a backup medium

From: rgibson@ix.netcom.com (Ron Gibson)

On Mon, 30 Aug 1999 05:43:13, sachmo@horn.net wrote:

> > Add a removable rack mount.  I can give you an address for an outfit I
> > got one for $15.  It's cold swap.  I love this setup.  No more tapes for
> > me...
 
> 	Do it to me. Thanks.
 
> pequod@gate.net

Here it is... 

http://st5.yahoo.com/directron/hard-drives-hard-drive-accessories.html



                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: cshapiro@lvcm.com                                 30-Aug-99 17:30:26
  To: All                                               31-Aug-99 03:52:24
Subj: Re: network printer setup

From: Charles Shapiro <cshapiro@lvcm.com>

Baden Kudrenecky wrote:
> 
> In <37C92E0A.C53120FC@lvcm.com>, Charles Shapiro <cshapiro@lvcm.com> writes:
> >
> >I am trying to set up a Canon BJC-6000 on a peer-peer
> >network.
> 
>    All that you should have to do, is once the printer is set up
> as a resource on the Windows machine, is to drag off a "Network
> Printer" template and fill in the blanks.  The Canon printer
> should be listed on the server machine.

Yes, one would think it would be just that easy, but it
never is for me
especially with Canon printers (previously had a BJC-610).  

I was able to get the BJC-6000 working, but it shows up as a
local printer
while it shows the HP laser (not on the OS/2 machine either)
as a network
printer using UNC names (\\machinename\printer).  This might
be a driver 
thing as Canon support for OS/2 sucks, while HP seems to be
alot better!

Now that I have the Canon printer working it hosed (or
something did) the 
Laser as it now only wants to print garbage and it worked
flawlessly before 
I got the Canon working. :)

Maybe I need to install the Canon on LPT1 also (as the Laser
is)?

Thanks for the reply, I will see what else I can screw up
trying
to get BOTH printers working!  <g>


-- 
..Chip..

---


                          Stop Smoking with Lifesign
                            Scientifically Proven
                            Visit www.at.pair.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT Products (1:109/42)

+----------------------------------------------------------------------------+

From: infoxchg@cajun.net                                30-Aug-99 19:58:07
  To: All                                               31-Aug-99 03:52:25
Subj: Re: OS2 Fixpacks

From: "Steven Cox" <infoxchg@cajun.net>

On Tue, 24 Aug 1999 18:11:18 GMT, Mark Dodel wrote:

>At an OS/2 commend prompte type
>
>VER /R
>
>the output will be something like 
>
>"The Operating System/2 Version is 4.00
>Revision 9.033"
>

I did the online installation of fixpack 11.  I had not done a fixpack before
& this was real easy.  While it was D/L files it asked me if I would like to
read the instructions.  I clicked yes I discovered it said to install Fixpack
5 first in order to prevent problems with some device drivers.  I continued
hoping my system was new enough to have the latest drivers.

When I rebooted after the install was complete, it trapped on an ES18681
device driver for my sound card.  I then booted to a command promt, opened
config.sys in Tedit and REMed out the ESS driver section.

I then rebooted.  All seems fine without sound.  My revision is now 9.035.  I
read the instructions again & it says to get updated drivers from the Driver
Pack online.  However, when I go to the web page it only has Warp 3 drivers. 
It says Warp 4 supports this device from the install CD.

What do I do now??  Should I try to reinstall the drivers with selective
install??

What else do I need to do insure I am Y2K ok?  I know I need to check all my
programs to insure I have Y2K ok versions.   Is there anything else I need to
do to OS/2?

Any help is appreciated.
Steven


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          31-Aug-99 01:58:18
  To: All                                               31-Aug-99 05:26:03
Subj: Re: CDW as a backup medium

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 30 Aug 1999 22:49:32, rgibson@ix.netcom.com (Ron Gibson) a crit 
dans un message:

> On Mon, 30 Aug 1999 05:43:13, sachmo@horn.net wrote:
> 
> > > Add a removable rack mount.  I can give you an address for an outfit I
> > > got one for $15.  It's cold swap.  I love this setup.  No more tapes for
> > > me...
> 
> Here it is... 
> 
> http://st5.yahoo.com/directron/hard-drives-hard-drive-accessories.html
> 

Anybody figure out how to get one of these rigs to run off my laptop, too? 
I can't imagine a better world than one which lets me plug a major HD into 
my laptop for files transfer, etc.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          31-Aug-99 02:10:12
  To: All                                               31-Aug-99 05:26:03
Subj: Re: What did I do wrong this time???

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 30 Aug 1999 22:24:00, mchasson@ibm.net a crit dans un message:

> My CDRom drive is fairly new and was working fine up until today when
> after putting in new speakers, I started playing around with the MM setup
> and then clicked on the CDPM object which I had never used in my life, and
> now...The drive door will not open.  It just blinks at me a few times when
> I push the button.
> 
> I shut down, and I did a power off and all the usual things for balky
> physical devices, but nothing works.   Surely this is not the end for
> Rico.

My guess would be that one of the \MMOS2\*.INI files is the cause, either 
MMPM2.INI or, possibly, CD.INI. Check for very recent datestamps on these, 
and the one that shows the recent change will probably be your feller.

Anybody who knows better how to handle this, jump in anytime.

First, try booting to floppies (probably) and copying them to another name,
then deleting the originals, and reboot. The system will probably make new 
ones, I hope, or at least complain about not finding them.

If that doesn't help, maybe you've got copies of these from a backup? Or, 
then, do a complete reinstall of the Multimedia stuff from Selective 
Install.



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: lcs@nowhere.com                                   30-Aug-99 21:53:18
  To: All                                               31-Aug-99 05:26:04
Subj: Re: What 56K modem for OS/2 ?

From: "Rick Lindsay" <lcs@nowhere.com>

On Sat, 28 Aug 1999 10:53:12 -0500 (CDT), Rick Lindsay wrote:

>33L4680 I think, see our web page, Pricing, then Parts.  It is listed there.

It is 33L4618, and somehow it disappeared from our web site...



Rick Lindsay, Lindsay Computer Systems, http://www.jumpnet.com/~lcs
Austin, Texas. 512-719-5257.  Asus based systems, Asus Products. 
                                    Advanced Systems.
           This message is SHAREWARE, please register...



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Lindsay Computer Systems (1:109/42)

+----------------------------------------------------------------------------+

From: vonhend@ibm.net                                   30-Aug-99 20:56:22
  To: All                                               31-Aug-99 05:26:04
Subj: Can the 1024 Cylinder Limit Be Circumvented?

From: Mark Von Hendy <vonhend@ibm.net>

First, thanks to all who responded to my question about pinball.sys.  I
got great responses both from this group and the corresponding NT
group.  So now I am trying to reinstall NT and OS/2 in larger
partitions.  After struggling with various sizes of partitions, I did a
little arithmetic to discover that 1024 cylinders limits me to 502 MB
for all my boot partitions.  I would really like to have O/S partitions
larger than 251 MB.  Is there any way to beat the 1024 cylinder limit
that plagues Warp 3.0?

Thanks.

Mark Von Hendy
vonhend@ibm.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jscott@csolve.net                                 31-Aug-99 03:30:22
  To: All                                               31-Aug-99 11:04:19
Subj: Re: Fixpack 7 = no ide cdrom?

From: JohnS <jscott@csolve.net>

You may have the same problem on a later FP as well. I just tried the 
latest DASD package (9908) that says that it can be loaded over the
FP6 install.  My CD is a slave on drive 1 with a IDE as master on the
same drive.  The CD disappeared  AND  my drive bay activity light is
now permamently on.
Pent 100, HX chipset, 3 IDE drives, 1 atapi CD, 1 SCSI drive, 1 SCSI
JAZZ.

Reverting to the FP6 files fixed the problem.





John Ross wrote:
> 
> In message <37cab4b5.262651@news.aracnet.com> - sgfarris@aracnet.com (Steve
> Farris) writes:
> :>
> :>I've been struggling to recreate my machine.  I installed a new 8 gig
drive
> :>and replaced my trusty old and slow scsi cd with a shiny new fast ide cd
> :>drive.
> :>
> :>Install works fine, I have access to the cd drive.  But after applying
> :>fixpack 7, The cd has disappeared.  when I turn on verbose mode for the
> :>drivers, os2cdrom.dmd says it can't load.  I've tried replacing files
> 
>         If you install the CD-ROM on an IDE channel you must jumper the
drive as
> master if it is the only device.        With older versions of IDE1s506.add
it didn't
> matter.
> 
> -john ross
> 
> http://www.oxford.net/~jkross
> 
> Remove "@I_hate_spam" from address to reply....
> 
> 
> --
> "Usenet is like a herd of performing elephants with diarrhea --
> massive, difficult to redirect, awe-inspiring, entertaining, and a
> source of mind-boggling amounts of excrement when you least expect
> it."--spaf@cs.purdue.edu (1992)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sympatico (1:109/42)

+----------------------------------------------------------------------------+

From: rjlockie@home.com                                 31-Aug-99 04:53:05
  To: All                                               31-Aug-99 11:04:19
Subj: Re: Can the 1024 Cylinder Limit Be Circumvented?

From: rjlockie@home.com (Bob Lockie)

In message <37CAF00C.56683E4D@ibm.net> - Mark Von Hendy <vonhend@ibm.net>
writes:
:>
:>First, thanks to all who responded to my question about pinball.sys.  I
:>got great responses both from this group and the corresponding NT
:>group.  So now I am trying to reinstall NT and OS/2 in larger
:>partitions.  After struggling with various sizes of partitions, I did a
:>little arithmetic to discover that 1024 cylinders limits me to 502 MB
:>for all my boot partitions.  I would really like to have O/S partitions
:>larger than 251 MB.  Is there any way to beat the 1024 cylinder limit
:>that plagues Warp 3.0?

It is a BIOS limitation.

Not really old BIOSes have an option to format your drive as LBA.

Large Block Addressing is a way to fake the OS out.

OS/2 can boot with large partitions if you don't use the IBM Boot Manager.

There are ways to hack around.

I think the System Commander boot manager gets around this.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: rjlockie@home.com                                 31-Aug-99 04:56:15
  To: All                                               31-Aug-99 11:04:19
Subj: NS4.61 install problem

From: rjlockie@home.com (Bob Lockie)

I tried to install Beta2 and it failed to unpack some file (it didn't say)
with
a data error.

I tried both the 56-bit and 128-bit versions.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                31-Aug-99 07:21:18
  To: All                                               31-Aug-99 11:04:19
Subj: Re: Where is MMPM2 driver?

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <eleS4DQ3N6dS-pn2-cRpKkwiUPz5h@tam-fl2-06.ix.netcom.com>,
rgibson@ix.netcom.com (Ron Gibson) writes:
>On Mon, 30 Aug 1999 03:49:14, baden@unixg.ubc.ca   (Baden Kudrenecky) 
>wrote:
>
>> >I'm still using an ancient PAS 16 and I wanted to play audio CD's and
> 
>>    That is my favourite sound card.
>
>I like it too.  Rugged and easy to use.  Playing CD's while not a
>necessity is a nice luxury.  With a cupole of amplified Labtec speakers
>it sounds like a nice stereo system. 
> 
>> >can't figure a way to do it with a native OS/2 application.  I
>> >downloaded something off of Hobbes and when I try to use it I get this
>> >can't load MMPM2 driver.  Well, no wonder.  It's not there but I see an
>> >MMPM2.INI file????
>
>>    You probably don't have MMPM (multimedia) support installed.
>> Go into "Selective Install", and install MMPM.  For the PAS, I
>> use DMA 6, IRQ 12, and for the SB side, DMA 1 and IRQ 5.
> 
>No, I've got it installed and FP40 for for Warp 3.  

   Your MMPM may just be corrupted.  Try "Selective Uninstall"
for MMPM, re-boot, and then "Selective Install" MMPM again.


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: mohd.k.yusof@bohm.anu.edu.au                      31-Aug-99 18:39:06
  To: All                                               31-Aug-99 11:04:19
Subj: 3 Mouse Buttons (Logitech) on PS/2 port

From: mohd.k.yusof@bohm.anu.edu.au (Khairil Yusof)

Hmm.. didn't notice this until I missed a menu in Xfree86/2 that was activated 

by the third mouse button.

Is there a parameter to specify 3 mouse buttons for a Logitech mouse on a PS/2 

port? It seems that PCLOGIC.SYS only detects my mouse if it is connected to a 
serial port.

With the default drivers on a PS/2 port, it only gives me 2 buttons.

Any help would be much appreciated,
Thanks.

Khairil


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Australian National University (1:109/42)

+----------------------------------------------------------------------------+

From: terence@nikoyo.com                                31-Aug-99 04:43:00
  To: All                                               31-Aug-99 11:04:19
Subj: HOWTO install OS2 Warp 4 on harddisk > 4G

From: Terence Cheng <terence@nikoyo.com>

After Reading newsgroups I understand that fixpak is needed on OS2 to
support HD > 4G. However, I can't find out the procedure of how to do
so! I want to install OS2/Warp 4 Simplified Chinese version ( I think
the install procedure is the same for all language version of OS2) Could
anyone kindly told me the procedure of making the install disks.
I had download the FixPak 5 for Simplified Chinese, and follow the
instruction of readme, update the os2ldr.exe. But the boot disk can't
recognize the HD.

Suggestions please

Terence Cheng
mailto:terence@nikoyo.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: LinkAGE Online a PSINet Company (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      31-Aug-99 00:48:29
  To: All                                               31-Aug-99 11:04:20
Subj: Re: IBM Home and Away Credit Card Adapter and OS/2

From: nospam@savebandwidth.invalid      (John Thompson)

In <slrn7sl0nd.2gc.stefand@ferrari.lcam.u-psud.fr>, stefand@lcam.u-psud.fr
(Stefan A. Deutscher) writes:

>>I think that's why I need to use the provided COM.SYS driver as 
>>it has been modified to accept dynamically assigned resources 
>>while SIO.SYS and the stock COM.SYS didn't know what to do in 
>>that situation.

>That seems to be correct, and it also is a possible drawback, as now you
>can't use any additional com ports at speeds higher than what ever Warp
>3 had. IIRC, Warp 4 introduced higher com port speeds useful for 56kB
>modems / ISDN compressed etc. Not my problem now, but may be one day.
>OTHO, I'll probably go ISDN router and just use the ethernet portion of
>the card then.

I still have SIO.SYS installed on the machine and have it
configured to load with alternative CONFIG.SYS file I can boot to
from the ALT-F1 "Recovery Choices" screen. I can't use the 
ethernet inthat configuration, but in a situation where I'd need 
the higher speed of SIO.SYS I probably wouldn't be hooked into my
LAN anyway.

-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: dwparsons@t-online.de                             31-Aug-99 12:51:04
  To: All                                               31-Aug-99 11:04:20
Subj: Re: Hey, all you OS/2 experts ........

From: dwparsons@t-online.de (Dave Parsons)

X-Newsreader: ProNews/2 Version 1.501




On Tue, 24 Aug 1999 07:25:19, "Arjen Meijer" <arjen@removethis.hacom.nl>
wrote:

> 
> I have netscape 4.04 and the npfi.dll is shown in de about:plugin screen.
> 
> I think some settings in the x:\os2 directory causes the blue screen of
dead.
> This is what happens:
>  1. netscape comes up with coffee cup to select a language.
>  2. I select English, the Feature installer is loaded and I am being
rerouted to 
>      netscape keyword page. This shows error keyword not found, install
4.61.
>  3. On the background my workplace shell crashes  and remains blue.
>  4. I have to use clt-alt-del
> 
> And I am not the only person having this problem. Help is really
appreciated.
> 
> Arjen
> 

I had a similar experience when I upgraded to V.1.1.7.

First, my apologies if I repeat any questions which you have already
answered but I have not seen any earlier posts.

Can we establish a few facts:-

1. Which version of Netscape are you using, beta or GA and from when?

2. Which version of feature installer are you using?
If you are uncertain issue:-
bldlevel fisetup.exe
from the command line in the directory containing FISETUP.EXE.

3. Do you have any version of Java installed at the moment and if so
can you post the results of issuing:-
java -fullversion
from the command line.

4. Which version of OS/2 are you using and which fix packs have you
installed, if any? Run:-
syslevel > sl.out
from the command line and send sl.out to me via email.

5. Can you explain your point 2 concerning the 'keyword' in more
detail, since I did not have that problem and I do not understand
exactly what happened.

6. Can you explain what you have tried so far.

No promises, but it should be possible  - eventually.

-- 
Dave

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDL (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     31-Aug-99 12:01:22
  To: All                                               31-Aug-99 11:04:20
Subj: Re: Can the 1024 Cylinder Limit Be Circumvented?

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Mon, 30 Aug 1999 20:56:44 +0000, Mark Von Hendy wrote:

->First, thanks to all who responded to my question about pinball.sys.  I
->got great responses both from this group and the corresponding NT
->group.  So now I am trying to reinstall NT and OS/2 in larger
->partitions.  After struggling with various sizes of partitions, I did a
->little arithmetic to discover that 1024 cylinders limits me to 502 MB
->for all my boot partitions.  I would really like to have O/S partitions
->larger than 251 MB.  Is there any way to beat the 1024 cylinder limit
->that plagues Warp 3.0?

If you have LBA turned on in your system BIOS then the 1024 cylinder limit
should be somewhere around the 8GB point (1024 x 255 x 63 x 512).

Warp 3 seems to have a bug in the boot sector code on HPFS partitions that
stops it from booting if it's on a disk outside the first 2GB. The
solution is usually to grab gt2gbw3.zip from
ftp://hobbes.nmsu.edu/pub/os2/system/patches/warp_3 and use that since it
contains a version of UHPFS.DLL that fixes the problem.


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     31-Aug-99 12:04:06
  To: All                                               31-Aug-99 11:04:20
Subj: Re: HOWTO install OS2 Warp 4 on harddisk > 4G

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Tue, 31 Aug 1999 04:43:00 +0800, Terence Cheng wrote:

->After Reading newsgroups I understand that fixpak is needed on OS2 to
->support HD > 4G. However, I can't find out the procedure of how to do
->so! I want to install OS2/Warp 4 Simplified Chinese version ( I think
->the install procedure is the same for all language version of OS2) Could
->anyone kindly told me the procedure of making the install disks.
->I had download the FixPak 5 for Simplified Chinese, and follow the
->instruction of readme, update the os2ldr.exe. But the boot disk can't
->recognize the HD.

You do not need an entire fixpack, just the replacement copy of
IBM1S506.ADD from
ftp://service.boulder.ibm.com/ps/products/os2/os2ddpak/idedasd.exe.
Download it, run it to extract the files and copy the new version of
IBM1S506.ADD to a diskcopy of the second install diskette. If there is not
enough space then remove one or both of the files AIC7770.ADD (EISA
Adaptec SCSI controller support) or AIC7870.ADD (PCI Adaptec 2940 series
SCSI controller support).


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            31-Aug-99 12:43:21
  To: All                                               31-Aug-99 14:56:01
Subj: Re: IBM Home and Away Credit Card Adapter and OS/2

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On Tue, 31 Aug 1999 00:48:59 GMT, John Thompson
<nospam@savebandwidth.invalid> wrote:
>In <slrn7sl0nd.2gc.stefand@ferrari.lcam.u-psud.fr>,
>stefand@lcam.u-psud.fr (Stefan A. Deutscher) writes:
>
>>>I think that's why I need to use the provided COM.SYS driver as it
>>>has been modified to accept dynamically assigned resources while
>>>SIO.SYS and the stock COM.SYS didn't know what to do in that
>>>situation.
>
>>That seems to be correct, and it also is a possible drawback, as now
>>you can't use any additional com ports at speeds higher than what ever
>>Warp 3 had. IIRC, Warp 4 introduced higher com port speeds useful for
>>56kB modems / ISDN compressed etc. Not my problem now, but may be one
>>day. OTHO, I'll probably go ISDN router and just use the ethernet
>>portion of the card then.
>
>I still have SIO.SYS installed on the machine and have it configured to
>load with alternative CONFIG.SYS file I can boot to from the ALT-F1
>"Recovery Choices" screen. I can't use the ethernet inthat
>configuration, but in a situation where I'd need the higher speed of
>SIO.SYS I probably wouldn't be hooked into my LAN anyway.


Smart! I'll check that out. Cheers,  Stefan

-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           31-Aug-99 17:07:25
  To: All                                               31-Aug-99 16:34:24
Subj: Re: CDW as a backup medium

From: doug.bissett"at"ibm.net (Doug Bissett)

On Tue, 31 Aug 1999 01:58:37, donnelly@tampabay.rr.com (Buddy 
Donnelly) wrote:

..snip...
> Anybody figure out how to get one of these rigs to run off my laptop, too? 
> I can't imagine a better world than one which lets me plug a major HD into 
> my laptop for files transfer, etc.
> 
> 
> Good luck,
> 
> Buddy
> 
> Buddy Donnelly
> donnelly@tampabay.rr.com
> 
> 

SOME laptops have a Docking Station feature (the laptop plugs into a 
base unit), which can contain things like hard drives, sound cards, 
CD-ROM drives etc.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: madodel@ptdprolog.net                             31-Aug-99 17:20:21
  To: All                                               31-Aug-99 16:34:24
Subj: Re: OS2 Fixpacks

From: madodel@ptdprolog.net (Mark Dodel)

Duane Chamblee of Indelible Blue had some replacement ESS drivers that
were supposed to work with FP10 and FP11.  

The site had a recent harddrive crash and Duane is still rebuilding 
it.  If the URL doesn't work right now try again later.  Here is the 
tip as posted in the VOICE August Newsletter:

August 14, 1999 - If you have an ESS based sound card and plan to 
install FP10 or FP11, check Duane Chamblee's website for information 
about a problem with these cards and these fixpaks.
http://duanec.indelible-blue.com/anonymous/essdrvs/ Duane has some 
drivers on this site that have been tested with FP10 and FP11.

According to this site "ESS Sound card users should try the latest 
version of their driver BEFORE applying Fixpak10."


As to Y2K, if you have FP11 installed, I believe you have all the Base
OS patches to date.  
Year2000 fixes for OS/2 are outlined in part at 
http://ps.software.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/fixnews.ht
ml#y2knew


Mark

On Tue, 31 Aug 1999 00:58:15, "Steven Cox" <infoxchg@cajun.net> wrote:

-)
-)On Tue, 24 Aug 1999 18:11:18 GMT, Mark Dodel wrote:
-)
-)>At an OS/2 commend prompte type
-)>
-)>VER /R
-)>
-)>the output will be something like 
-)>
-)>"The Operating System/2 Version is 4.00
-)>Revision 9.033"
-)>
-)
-)I did the online installation of fixpack 11.  I had not done a fixpack
before
-)& this was real easy.  While it was D/L files it asked me if I would like to
-)read the instructions.  I clicked yes I discovered it said to install
Fixpack
-)5 first in order to prevent problems with some device drivers.  I continued
-)hoping my system was new enough to have the latest drivers.
-)
-)When I rebooted after the install was complete, it trapped on an ES18681
-)device driver for my sound card.  I then booted to a command promt, opened
-)config.sys in Tedit and REMed out the ESS driver section.
-)
-)I then rebooted.  All seems fine without sound.  My revision is now 9.035. 
I
-)read the instructions again & it says to get updated drivers from the Driver
-)Pack online.  However, when I go to the web page it only has Warp 3 drivers. 

-)It says Warp 4 supports this device from the install CD.
-)
-)What do I do now??  Should I try to reinstall the drivers with selective
-)install??
-)
-)What else do I need to do insure I am Y2K ok?  I know I need to check all my
-)programs to insure I have Y2K ok versions.   Is there anything else I need
to
-)do to OS/2?
-)
-)Any help is appreciated.
-)Steven
-)
-)


//---------------------------------------------------------
// From the Desk of: Mark Dodel, RN, BSN, MBA
//             Healthcare Computer Consultant
//                   madodel@ptdprolog.net
//    http://home.ptd.net/~madodel
//
//  For a VOICE in the future of OS/2
//             http://www.os2voice.org/index.html
//---------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PenTeleData http://www.ptd.net (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          31-Aug-99 18:20:15
  To: All                                               31-Aug-99 16:34:24
Subj: Re: OS2 Fixpacks

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Tue, 31 Aug 1999 17:20:43, madodel@ptdprolog.net (Mark Dodel) a crit 
dans un message:

> Duane Chamblee of Indelible Blue had some replacement ESS drivers that
> were supposed to work with FP10 and FP11.  
> 
> The site had a recent harddrive crash and Duane is still rebuilding 
> it.
snip

> http://duanec.indelible-blue.com

I just noticed a really nifty thing Duane has done with his page. He 
defined the body font as "WarpSans" which makes it look very "OS/2" on my 
browser.

It's especially noticable on the Users page:

http://duanec.indelible-blue.com/users/index.html

My PCL5 printer doesn't like printing it, and makes the WarpSans stuff 
about 3 pts high, but if I print to my PS driver it does very clean font 
sub to Roman.

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          31-Aug-99 18:12:06
  To: All                                               31-Aug-99 16:34:25
Subj: Re: CDW as a backup medium

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Tue, 31 Aug 1999 17:07:50, doug.bissett"at"ibm.net (Doug Bissett) a 
crit dans un message:

> On Tue, 31 Aug 1999 01:58:37, donnelly@tampabay.rr.com (Buddy 
> Donnelly) wrote:
> 
> ...snip...
> > Anybody figure out how to get one of these rigs to run off my laptop, too? 

> > I can't imagine a better world than one which lets me plug a major HD into 

> > my laptop for files transfer, etc.
> 
> SOME laptops have a Docking Station feature (the laptop plugs into a 
> base unit), which can contain things like hard drives, sound cards, 
> CD-ROM drives etc.

I was thinking of working it off a SCSI-PCCard, maybe. But thanks for the 
reminder, and I might see if my old TP701 can find a docking station 
somewhere.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             31-Aug-99 21:21:10
  To: All                                               31-Aug-99 21:19:21
Subj: Help with Mindspring as an ISP

From: rgibson@ix.netcom.com (Ron Gibson)

Anybody got tips on setting up a Mindspring account with DOIP?

I had a Netcom account and it always worked fine.  Now I'm setting up a
Mindspring account for a friend on my old machine.

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  31-Aug-99 17:18:11
  To: All                                               31-Aug-99 21:19:21
Subj: Re: What did I do wrong this time???

From: mchasson@ibm.net

In <Z8vLRdP7nz3N-pn2-EjDo7BYlEOD9@yourmachine.yourlocaldomain.yourisp>, on
08/31/99 at 02:10 AM,
   donnelly@tampabay.rr.com (Buddy Donnelly) said:


>My guess would be that one of the \MMOS2\*.INI files is the cause, either
> MMPM2.INI or, possibly, CD.INI. Check for very recent datestamps on
>these,  and the one that shows the recent change will probably be your
>feller.

>Anybody who knows better how to handle this, jump in anytime.

>First, try booting to floppies (probably) and copying them to another
>name, then deleting the originals, and reboot. The system will probably
>make new  ones, I hope, or at least complain about not finding them.

>If that doesn't help, maybe you've got copies of these from a backup? Or,
> then, do a complete reinstall of the Multimedia stuff from Selective 
>Install.

Well CDP.INI is elderly and should be innocent.  MMPM2.INI and MMPM.INI
are from the time of the event yesterday and clearly are guilty of
something.  MMPM.!!! was created at boot today and is clearly going to
replace mmpm.ini.  Yes I have backups, but I use this stuff so seldom that
is except for Real Player and Web Pages, that I dont know if the backups
are also not corrupted.  I recall some years ago my last bad crash when
inetproc.dll got corrupted and brought everything to a screeching halt. 
In that case I restored from the archive desktop to run the tape program
and brought it all back.  Yes I am still not sure how to get an original
file off the CDrom or out of the archive.  But I dont have that much free
disk space at the moment.  

More interesting than all the foregoing is that I fooled around a little
more with the CDrom, You know I put the paper clip in the door release
hole, and managed to screw up something to the point that I then got a
Trap3 on reboot.  The CDrom just blinked steadily at that point and a
second reboot produced a trap3 and so to bed.  I was still fairly sure
that it was a software problem, so I opened the box and pulled the IDE
cable from the Cdrom and booted normally.  I left the power cable
connected and I pushed the tray button a few times and it worked fine.  So
I felt confident I had reset the CDrom from the software lock.  I then
booted normally and the CDrom now works like it did before the "accident". 
I would still like to try playing some music through the thing only I am
gun shy.  

Is there a sure fix.  Will uninstall reinstall of mmos2 do it?

This is Warp4 FP5 with lots of memory.

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: sharonp@homemail.com                              31-Aug-99 22:04:18
  To: All                                               31-Aug-99 21:19:21
Subj: Re: Help with Mindspring as an ISP

From: sharonp@homemail.com (Sharon Parks)

In message <eleS4DQ3N6dS-pn2-nEcJehx7bH7R@localhost> - rgibson@ix.netcom.com
(Ron Gibson)31 Aug 1999 21:21:20 GMT writes:
:>
:>Anybody got tips on setting up a Mindspring account with DOIP?
:>
:>I had a Netcom account and it always worked fine.  Now I'm setting up a
:>Mindspring account for a friend on my old machine.
:>
:>                      email: rgibson@ix.netcom.com
:>

I'm using Mindspring with all my same netcom settings.  There was no need to
change anything.  I use DOIP.

Sharon

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: sgfarris@aracnet.com                              31-Aug-99 22:09:07
  To: All                                               31-Aug-99 21:19:21
Subj: Re: Fixpack 7 = no ide cdrom?

From: sgfarris@aracnet.com (Steve Farris)

Well, I got the cd to work.  It was difficult to reinstall the original cd
support since I didn't have a cd drive!  Had to use winblows to copy the
os2image directory to a hard disk, then try it.  It didn't work, anyway.
So I got the latest ide drivers from IBM.  The computer wouldn't boot with
them ("cannot operate your hard disk...").  But when I returned all the
drivers to fp7 level except for os2cdrom.dmd and ibmidecd.flt, it worked.

The ide drivers said they were from fixpack 12.  I looked on the fix pack
site and only saw fix packs 7 and 11.  11 says it doesn't contain any
drivers.  Has 12 been pulled from distribution?

I still have some instability--the computer locks up randomly.  I haven't
been able to even figure out specific causes, although it usually has to do
with opening or closing a window.  I'm wondering if mixing fp7 and 12 in
the drivers has caused some disk instability.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: aracnet.com (1:109/42)

+----------------------------------------------------------------------------+

From: huekf@my-deja.com                                 31-Aug-99 22:46:23
  To: All                                               01-Sep-99 10:43:23
Subj: How do I install internet access on OS/2 W4 ?

From: huekf@my-deja.com

Hi, Can someone please help me on how to install internet
access on my OS/2 W4?

When I had installed my OS/2 on my system, I did not install the
internet & networkings on to my desktop(stand alone pc).

But now after having learn the basics, I need to install the
internet.Where do I begin ?
(My installation source is from the OS/2 cd).

Thanks.
Huekf


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          31-Aug-99 22:59:09
  To: All                                               01-Sep-99 10:43:23
Subj: Re: What did I do wrong this time???

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Tue, 31 Aug 1999 21:18:23, mchasson@ibm.net a crit dans un message:

> 
> Well CDP.INI is elderly and should be innocent.  MMPM2.INI and MMPM.INI
> are from the time of the event yesterday and clearly are guilty of
> something.  MMPM.!!! was created at boot today and is clearly going to
> replace mmpm.ini.

Those .!!! versions of INI files appear to be placeholders for the versions
held in memory. There's not much you can do with them, if anything.

>  Yes I have backups, but I use this stuff so seldom that
> is except for Real Player and Web Pages, that I dont know if the backups
> are also not corrupted.

I was thinking back to when you felt everything was working properly. It 
sounds like you could restore to that version and get back your old 
behaviour?

snip
> that it was a software problem, so I opened the box and pulled the IDE
> cable from the Cdrom and booted normally.  I left the power cable
> connected and I pushed the tray button a few times and it worked fine.  So
> I felt confident I had reset the CDrom from the software lock.  

Hardware solutions sometimes are best.


> I then
> booted normally and the CDrom now works like it did before the "accident". 
> I would still like to try playing some music through the thing only I am
> gun shy.  
> 
> Is there a sure fix.  Will uninstall reinstall of mmos2 do it?

First, I'd save off a copy of today's MMPM2.INI, and also add MMPM2.INI to 
my OS2.KEY file, as in:
KEYFILE:C:\MMOS2\MMPM2.INI
and take an archive on the next reboot.

Then I'd try what you tried before, playing music. Then if you run into the
same trouble, try copying an archived copy back into place (while booted to
a command line, probably to floppies) to restore 

Double-check all your cables and connectors inside, of course. This almost 
sounded like a loose connection, to me. (Also you want to make sure that CD
is properly jumpered for Master/Slave.)

Save doing a Selective Install for last ditch. I'd be willing to bet that 
reinstalling MM will correct your problem, if all the hardware stuff is 
right.



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             31-Aug-99 23:42:17
  To: All                                               01-Sep-99 10:43:23
Subj: Re: Help with Mindspring as an ISP

From: rgibson@ix.netcom.com (Ron Gibson)

On Tue, 31 Aug 1999 22:04:37, sharonp@homemail.com (Sharon Parks) wrote:

> :>Anybody got tips on setting up a Mindspring account with DOIP?

> :>I had a Netcom account and it always worked fine.  Now I'm setting up a
> :>Mindspring account for a friend on my old machine.
 
> I'm using Mindspring with all my same netcom settings.  There was no need to
> change anything.  I use DOIP.
 
But now you can't get a Netcom account through Mindspring. It's a 
Mindspring account and uses a different DNS, etc.

But if you had a Netcom account and it was bought out by Mindspring then
you can use all the same settings.  That's my situation.  My friend is
getting a *new* account and so it has to be a Mindspring account.

BTW, there giving a nice kickback to both of us for her signing up as my
referral.

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           01-Sep-99 00:28:21
  To: All                                               01-Sep-99 10:43:24
Subj: Re: How do I install internet access on OS/2 W4 ?

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Tue, 31 Aug 1999 22:46:47, huekf@my-deja.com wrote:

> Hi, Can someone please help me on how to install internet
> access on my OS/2 W4?
> 
> When I had installed my OS/2 on my system, I did not install the
> internet & networkings on to my desktop(stand alone pc).
> 
> But now after having learn the basics, I need to install the
> internet.Where do I begin ?
> (My installation source is from the OS/2 cd).
> 

Execute the INSTALL.CMD file in the root directory
of the Warp 4 CD. This will start the networking install
part of the Warp 4 installation. Just pick the TCP/IP services
and it should work.....

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jlemon@netscape.net                               01-Sep-99 01:10:03
  To: All                                               01-Sep-99 10:43:24
Subj: Adobe Photoshop in Win-OS/2?

From: Jon Le Mon <jlemon@netscape.net>

Hi,

Has anyone successfully installed  and got Adobe
Photoshop 4.01 to run in a
WIN-OS/2 session?

Have installed Photoshop and then WINS32 Ver 1.25.
Once I start Photoshop I get this Error:-

*****************************************************

                               Win32s - Error
Unhandled Exception detected,(Code:0xC0000005
PHOTOSHP.EXE:2739A4)
                       Application will be terminated
                                        OK
*****************************************************


Any help appreciated.

Thanks

Jon

--
--------------
Jon Le Mon
Wellington
New Zealand


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: jbrush@aros.net                                   31-Aug-99 21:46:03
  To: All                                               01-Sep-99 14:27:05
Subj: Newbie to SCSI question

From: jbrush@aros.net

I am convinced a R/W CD is the way to go over most other storage solutions
so:

I will need a SCSI card to drive the CD, and I have never used any scsi
before, except that cheapo card that came with my Microtek E3 scanner. 

Since I know nothing about scsi, other than what it is and why its often
better than ATAPI, will any scsi card for OS/2 work with any CD R/W?

Are there scsi cards for people who don't have $200 to spend? I don't
really care if the throughput is not state of the art in speed. Since I
cannot afford much, I am content to just burn a CD and watch TV instead of
hoping for serious multitasking with a slower scsi interface.

It seems that $200-$250 will get me a cd r/w, so how much more will I have
to spend for a scsi adapter? I can't help but ask if that card that came
with the scanner would do, even for a starter. I don't use the scanner
anymore anyway.

Thank you in advance.

Regards from Utah,

John



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ArosNet Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: judithr@primenet.com                              31-Aug-99 21:59:13
  To: All                                               01-Sep-99 17:47:18
Subj: Re: Newbie to SCSI question

From: judithr@primenet.com

Probably the SCSI card that came with the scanner will work.  Try
that before buying another. If it doesn't, check the list on the
Device Driver Pak page from IBM.  There are lots there.  Almost
anything Adaptec will work but they are expensive.   If OS/2
recognizes the SCSI card it should work for the CD burner. 

I'm using a card that came with a scanner in one machine, one that
came with a CD burner in another and an adaptec 2920 in a third. 
There doesn't seem to be any difference. 

>I will need a SCSI card to drive the CD, and I have never used any
>scsi before, except that cheapo card that came with my Microtek E3
>scanner. 

>Since I know nothing about scsi, other than what it is and why its
>often better than ATAPI, will any scsi card for OS/2 work with any
>CD R/W?

>Are there scsi cards for people who don't have $200 to spend? I
>don't really care if the throughput is not state of the art in
>speed. Since I cannot afford much, I am content to just burn a CD
>and watch TV instead of hoping for serious multitasking with a
>slower scsi interface.

>It seems that $200-$250 will get me a cd r/w, so how much more will
>I have to spend for a scsi adapter? I can't help but ask if that
>card that came with the scanner would do, even for a starter. I
>don't use the scanner anymore anyway.

>Thank you in advance.

>Regards from Utah,

>John





Judith Russell       
judithr@primenet.com                    
Saugus Web Coordinator
http://www.hart.k12.ca.us/saugus


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: rjlockie@home.com                                 01-Sep-99 05:14:06
  To: All                                               01-Sep-99 17:47:18
Subj: Re: Newbie to SCSI question

From: rjlockie@home.com (Bob Lockie)

In message <37cca2f9$1$woehfu$mr2ice@news.aros.net> - jbrush@aros.netTue, 31
Aug 1999 21:46:06 -0600 writes:
:>
:>I am convinced a R/W CD is the way to go over most other storage solutions
:>so:
:>
:>I will need a SCSI card to drive the CD, and I have never used any scsi
:>before, except that cheapo card that came with my Microtek E3 scanner. 
:>
:>Since I know nothing about scsi, other than what it is and why its often
:>better than ATAPI, will any scsi card for OS/2 work with any CD R/W?
:>
:>Are there scsi cards for people who don't have $200 to spend? I don't
:>really care if the throughput is not state of the art in speed. Since I
:>cannot afford much, I am content to just burn a CD and watch TV instead of
:>hoping for serious multitasking with a slower scsi interface.
:>
:>It seems that $200-$250 will get me a cd r/w, so how much more will I have
:>to spend for a scsi adapter? I can't help but ask if that card that came
:>with the scanner would do, even for a starter. I don't use the scanner
:>anymore anyway.

You don't HAVE to buy a SCSI cdrw, you CAN buy an IDE.

You probably should buy SCSI.

You can get a good SCSI card for well under $200 if you don't look at Adaptec.
:-)

Symbios is a well known chip maker.

The scanner card may be good enough but sometimes it is not a real SCSI card
and only works
with the peripheral it came with.

Be prepared that if it doesn't work to go out and buy a new SCSI card.


You can connect your scanner after/before the cdrw so you can have multiple
devices.

The Symbios 53C875 chip is a good SCSI3 controller.

You should be able to get it.

I bought an Asus PCI-SC875 based on this chip for well under $200 Canadian.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: michael@ime.rwth-aachen.de                        01-Sep-99 10:55:06
  To: All                                               01-Sep-99 17:47:19
Subj: Re: Adobe Photoshop in Win-OS/2?

From: michael@ime.rwth-aachen.de

Jon Le Mon <jlemon@netscape.net> writes:

> Hi,
> 
> Has anyone successfully installed  and got Adobe
> Photoshop 4.01 to run in a
> WIN-OS/2 session?
> 
> Have installed Photoshop and then WINS32 Ver 1.25.
> Once I start Photoshop I get this Error:-
> 
> *****************************************************
> 
>                                Win32s - Error
> Unhandled Exception detected,(Code:0xC0000005
> PHOTOSHP.EXE:2739A4)
>                        Application will be terminated
>                                         OK
> *****************************************************
> 
> 
3.04 is the last version, wich runs on Warp. :-(

-- 
Michael Holzapfel <michael@ime.rwth-aachen.de>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Aachen University of Technology (RWTH) (1:109/42)

+----------------------------------------------------------------------------+

From: sharonp@homemail.com                              01-Sep-99 09:23:13
  To: All                                               01-Sep-99 17:47:19
Subj: Re: Help with Mindspring as an ISP

From: sharonp@homemail.com (Sharon Parks)

In message <eleS4DQ3N6dS-pn2-RYs9HMKL2IBU@tam-fl1-25.ix.netcom.com> -
rgibson@ix.netcom.com (Ron Gibson)31 Aug 1999 23:42:34 GMT writes:
:>
:>On Tue, 31 Aug 1999 22:04:37, sharonp@homemail.com (Sharon Parks) wrote:
:>
:>> :>Anybody got tips on setting up a Mindspring account with DOIP?
:>
:>> :>I had a Netcom account and it always worked fine.  Now I'm setting up a
:>> :>Mindspring account for a friend on my old machine.
:> 
:>> I'm using Mindspring with all my same netcom settings.  There was no need
to
:>> change anything.  I use DOIP.
:> 
:>But now you can't get a Netcom account through Mindspring. It's a 
:>Mindspring account and uses a different DNS, etc.
:>
:>But if you had a Netcom account and it was bought out by Mindspring then
:>you can use all the same settings.  That's my situation.  My friend is
:>getting a *new* account and so it has to be a Mindspring account.
:>
:>BTW, there giving a nice kickback to both of us for her signing up as my
:>referral.
:>
:>                      email: rgibson@ix.netcom.com
:>


Try using .mindspring instead of .netcom for all servers, i.e. www.mindspring,
nntp.mindspring, etc.  The DNS to try is 199.182.120.1.  If all else fails,
call Customer Service, not Tech Support, and ask them for the DNS you should
use, and the server settings.

HTH, Sharon

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: muses9@cyberus.ca                                 01-Sep-99 11:24:10
  To: All                                               01-Sep-99 17:47:19
Subj: Re: Adobe Photoshop in Win-OS/2?

From: muses9@cyberus.ca (Marko)

You cannot. 

Version 3.05 was the last you could dupe into running in Win-OS/2.


On Wed, 1 Sep 1999 01:10:07, Jon Le Mon <jlemon@netscape.net> made 
history by saying:

-> Hi,
-> 
-> Has anyone successfully installed  and got Adobe
-> Photoshop 4.01 to run in a
-> WIN-OS/2 session?
-> 
-> Have installed Photoshop and then WINS32 Ver 1.25.
-> Once I start Photoshop I get this Error:-
-> 
-> *****************************************************
-> 
->                                Win32s - Error
-> Unhandled Exception detected,(Code:0xC0000005
-> PHOTOSHP.EXE:2739A4)
->                        Application will be terminated
->                                         OK
-> *****************************************************
-> 
-> 
-> Any help appreciated.
-> 
-> Thanks
-> 
-> Jon
-> 
-> --
-> --------------
-> Jon Le Mon
-> Wellington
-> New Zealand
-> 
-> 
-> Sent via Deja.com http://www.deja.com/
-> Share what you know. Learn what you don't.

--
Marko
Ottawa

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          01-Sep-99 14:34:09
  To: All                                               01-Sep-99 17:47:20
Subj: Re: Help with soundcard & drivers

From: piquant00@uswestmail.net (Annie K.)

On Wed, 1 Sep 1999 06:34:27, "dean brown" <dean3@zoom.co.uk> wrote:

:When I boot up my PC I hear the Microsoft intro sound 

 Are you in the wrong newsgroup? I find no mention of OS/2 anywhere in 
your post.

-- 
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: jvarela@mind-spring.com                           01-Sep-99 15:47:17
  To: All                                               01-Sep-99 17:47:20
Subj: Re: Help with Mindspring as an ISP

From: jvarela@mind-spring.com (John Varela)

On Tue, 31 Aug 1999 21:21:20, rgibson@ix.netcom.com (Ron Gibson) 
wrote:

> Anybody got tips on setting up a Mindspring account with DOIP?

http://help.mindspring.com/modules/00000/00005.htm

worked for me.

--
John Varela
to e-mail, remove - between mind and spring

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: rjfreem@ibm.net                                   01-Sep-99 10:22:24
  To: All                                               01-Sep-99 17:47:20
Subj: Re: OS/2 Friendly Internal Modem?

From: rjfreem@ibm.net

In <SKfw30zmCGmZ-pn2-sQ2wjjrkdZcH@localhost>, on 08/30/99 
   at 01:45 AM, doug.bissett"at"ibm.net (Doug Bissett) said:

>On Fri, 27 Aug 1999 18:50:07, "George Barrowcliff" 
><barrowcl@flash.net> wrote:

SIO.SYS will allow you to configure three com ports. I have the mouse on
com 1, UPS on com2 and an earily 56k Sportster on com3 IRQ 7 (it is both
plug 'n pray and jumpered). I cound not get COM.SYS to configure the com
ports. RJF


>> THe problem with external modems is I am using both com ports for
>> communication with some local hardware components and I didn't want to buy
>> extra com ports.
>>  

>That does present a bit of a problem. There are also USB modems, that 
>will work, if you have the correct type of USB adapter (sorry, I don't
>have all of the details, but there has been a lot of discussion about 
>that in some of the newsgroups). Otherwise, you may be able to pick up
>some "old stock" USR internal modems, or some other brand. The basic 
>"rule" seems to be "if it has jumpers it will, probably, work". If it 
>does not have jumpers, it MIGHT work, if you can convince your Plug  and
>Pray system to properly detect it, and configure it consistently  (this
>can be a big challenge, at times). You may also need to add  parameters
>to the COM.SYS line (or SIO.SYS, if you use that), in  CONFIG.SYS (do
>HELP COM.SYS for more info).

>Hope this helps...
>******************************
>From the PC of Doug Bissett
>doug.bissett at ibm.net
>The " at " must be changed to "@"
>******************************

-- 
-----------------------------------------------------------
rjfreem@ibm.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: rjfreem@ibm.net                                   01-Sep-99 10:31:09
  To: All                                               01-Sep-99 17:47:20
Subj: Re: FAT32 IFS tips...

From: rjfreem@ibm.net

In <7qcdtd$sdv$2@coranto.ucs.mun.ca>, on 08/29/99 
   at 10:57 PM, jdc0014@InfoNET.st-johns.nf.ca (John Hong) said:


Ordinarily one of the two primary partitions on the same hard drive will
be completely hidden from the other. I had the configuation as you have,
but with a win98 install and without any assisting drivers (PARTFLT). It
worked for a while. I forgot what happened but I had to reinstall win98. I
saw an explaination of why the fat32 is visible, Also which I have forgot.
Not too musch help

RJF

>	First things first...hats off to Henk Kelder for a *swank* FAT32  driver
>for OS/2. :-)

>	Anyhow, I have my FAT32 driver installed exactly the way I saw it  in
>the fat32.txt file (ie. BASEDEV=PARTFLT.FLT /P 0b /W)

>	My hard drive is setup as the following:

>Win95 - Primary Partition - FAT32
>OS/2 - Primary Partition - HPFS
>Logical Partition - FAT32
>Boot Manager - Primary Partition

>	Now, when I launch OS/2, C: is OS/2, but it didn't hide the C:  Win95
>partition.  I can in fact read/write to it.  I didn't really want  that,
>though.  Basically, I wanted the Win95/OS2 primary partitions  completely
>hidden from one another.  So that made my original D:  partition into an
>E: partition (now that Win95 was D:).
>	Any chance I can setup the driver so that I only see C: belonging  to
>OS/2, and D: belonging to the logcal FAT32 partition?



-- 
-----------------------------------------------------------
rjfreem@ibm.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     01-Sep-99 20:16:11
  To: All                                               01-Sep-99 19:58:09
Subj: Re: Help with soundcard & drivers

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On 1 Sep 1999 14:34:18 GMT, Annie K. wrote:

->On Wed, 1 Sep 1999 06:34:27, "dean brown" <dean3@zoom.co.uk> wrote:
->
->:When I boot up my PC I hear the Microsoft intro sound 
->
-> Are you in the wrong newsgroup? I find no mention of OS/2 anywhere in 
->your post.

He could be running OS/2 with the Windows fastload option set on. This
loads Windows when you boot and gives it the soundcard to make silly
noises with.


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: roconnor@undergrad.math.uwaterlo...               01-Sep-99 19:43:18
  To: All                                               01-Sep-99 21:47:10
Subj: New XFREE86OS/2

Message sender: roconnor@undergrad.math.uwaterloo.ca

From: roconnor@undergrad.math.uwaterloo.ca (Russell Steven Shawn O'Connor)

So rumor has it that XFree86 3.3.5 is now available.  I already have
3.3.3.1 installed and working fine.  Can I simply install the new version
over top of my current version, or will this cause problems?  The
documentation didn't seem to directly address the issue of updating
older versions of XFree.  It is possible that I missed it.

BTW, I'd like to mention that SSH works fine with XFree86.  That is to
say it handles the encryption of X connections and does that messy xauth
stuff for you.  I always run SSH in a PM session, so I don't know if it
runs under an xterm.  But none the less, I'm very pleased.

-- 
Russell O'Connor                           roconnor@uwaterloo.ca
       <http://www.undergrad.math.uwaterloo.ca/~roconnor/>
``And truth irreversibly destroys the meaning of its own message''
-- Anindita Dutta, ``The Paradox of Truth, the Truth of Entropy''

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Waterloo (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    01-Sep-99 20:36:08
  To: All                                               01-Sep-99 21:47:11
Subj: CDrecord How-to?

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

	Well, funny thing really...  I sent a money order for a Yamaha 
4416S CDRW and Initio 9100A Fast SCSI-2 card.  What did I end up with?  A 
Ricoh 7040S CDRW and a Initio 9100U Ultra SCSI card.  Wow...I didn't get 
*any* of the things that I wanted, but I'm still happy since I have it 
working.  ;-)
	Well, sort of.  Are there any how-to's on how to use CDrecord/2?  
I tried using that frontend CDWRITER in order to put some data on a blank 
CDR.  What I ended up with was a coaster.  Either I did something wrong 
or it was just a bad CDR (was a Maxell brand name one, apparently they 
are not too popular amongst most CDR/CDRW users).


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: mc6530@mclink.it                                  01-Sep-99 20:55:15
  To: All                                               01-Sep-99 21:47:11
Subj: Supermicro P6DBU: what about OS/2?

From: mc6530@mclink.it (Yuri Dario)

Hi,


I have found a reseller near to me that can sell a dual cpu mother 
board (P6 DBU): do you know something about OS/2 compatibility?
Difference between a P6DGU?? it should be the chipset BX vs GX, but I 
don't know the differences between them.

TIA,

	Yuri Dario

/*
 * member of TeamOS/2 - Italy
 * http://www.quasarbbs.com/yuri
 */

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MC-link The World On Line (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             01-Sep-99 21:30:10
  To: All                                               01-Sep-99 21:47:11
Subj: Re: Newbie to SCSI question

From: rgibson@ix.netcom.com (Ron Gibson)

On Wed, 1 Sep 1999 05:14:13, rjlockie@home.com (Bob Lockie) wrote:

> :>Since I know nothing about scsi, other than what it is and why its often
> :>better than ATAPI, will any scsi card for OS/2 work with any CD R/W?
>
> :>Are there scsi cards for people who don't have $200 to spend? I don't
> :>really care if the throughput is not state of the art in speed. Since I

> :>It seems that $200-$250 will get me a cd r/w, so how much more will I have
> :>to spend for a scsi adapter? I can't help but ask if that card that came
 
> You don't HAVE to buy a SCSI cdrw, you CAN buy an IDE.
 
> You probably should buy SCSI.
> 
> You can get a good SCSI card for well under $200 if you don't look at
Adaptec.
> :-)

Even some of the Adaptec cards are well under $100 as long as its not
bootable and even some of the bootable ISA cards are around $70 on
pricewatch.

But I'll add that an AVA 1505 that I tried gave me such a hassle that I
gave up on it.

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: oliver.rick@oor.de                                31-Aug-99 22:51:25
  To: All                                               02-Sep-99 04:17:19
Subj: Re: OS2 Fixpacks

From: oliver.rick@oor.de (Oliver Rick)

On Mon, 30 Aug 1999 Steven Cox wrote:

> What else do I need to do insure I am Y2K ok?  I know I need to check
> all my programs to insure I have Y2K ok versions.   Is there anything
> else I need to do to OS/2?

Pick your components from the list at
http://ourworld.compuserve.com/Homepages/orick/warpy2k1.htm

   /Olli/
--
IBM OS/2 Warp Update Summary:
http://ourworld.compuserve.com/Homepages/orick/warpupd1.htm

--- Squish/386 v1.11

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Out of Rosenheim/2 (1:109/42)

+----------------------------------------------------------------------------+

From: nospam_evr@spam.net                               01-Sep-99 20:18:07
  To: All                                               02-Sep-99 06:35:00
Subj: **Attention, Motherboard & OS/2

From: "/2 User" <nospam_evr@spam.net>

What is the best Socket 7 mother board for OS/2. I will be using a AMDK6-2
333 processor with it.
I currently have the Epox piece of crap and I cant even get windose to run on
it.
Which Chipset?
Which brand?
Is their a url to purchase?

Thanks in advance.


~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
"I tend to stay away from the Advocacy groups to avoid the WindTrolls"
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jbrush@aros.net                                   01-Sep-99 17:35:22
  To: All                                               02-Sep-99 06:35:00
Subj: Re: Help with Mindspring as an ISP

From: jbrush@aros.net

te:

>> Anybody got tips on setting up a Mindspring account with DOIP?

Only that I spent an awfully long amount of time wrestling with it untill
I realized that the username is bsmith@ mindspring.com and not just plain
old bsmith.

I know I was pissed to see such a stupid configuration, but other than
that, I had no problems, other than a slow PPP connection so I ditched it.

John

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ArosNet Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: rjlockie@home.com                                 02-Sep-99 01:44:22
  To: All                                               02-Sep-99 06:35:00
Subj: Re: Newbie to SCSI question

From: rjlockie@home.com (Bob Lockie)

In message <eleS4DQ3N6dS-pn2-zrYDxx2fcoce@localhost> - rgibson@ix.netcom.com
(Ron Gibson)1 Sep 1999 21:30:21 GMT writes:
:>
:>On Wed, 1 Sep 1999 05:14:13, rjlockie@home.com (Bob Lockie) wrote:
:>
:>> :>Since I know nothing about scsi, other than what it is and why its often
:>> :>better than ATAPI, will any scsi card for OS/2 work with any CD R/W?
:>>
:>> :>Are there scsi cards for people who don't have $200 to spend? I don't
:>> :>really care if the throughput is not state of the art in speed. Since I
:>
:>> :>It seems that $200-$250 will get me a cd r/w, so how much more will I
have
:>> :>to spend for a scsi adapter? I can't help but ask if that card that came
:> 
:>> You don't HAVE to buy a SCSI cdrw, you CAN buy an IDE.
:> 
:>> You probably should buy SCSI.
:>> 
:>> You can get a good SCSI card for well under $200 if you don't look at
Adaptec.
:>> :-)
:>
:>Even some of the Adaptec cards are well under $100 as long as its not
:>bootable and even some of the bootable ISA cards are around $70 on
:>pricewatch.
:>
:>But I'll add that an AVA 1505 that I tried gave me such a hassle that I
:>gave up on it.

Well, I would recommend a bootable, PCI card.

My opinion is that if you're going to spend money on a card it should be a
good one.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: jlemon@netscape.net                               02-Sep-99 04:23:00
  To: All                                               02-Sep-99 06:35:00
Subj: Re: Adobe Photoshop in Win-OS/2?

From: Jon Le Mon <jlemon@netscape.net>

In article <QLLC0h0LvdvF-pn2-eFT0YDyedFnS@localhost>,
  muses9@cyberus.ca (Marko) wrote:
> You cannot.
>
> Version 3.05 was the last you could dupe into
running in Win-OS/2.
>
> --
> Marko
> Ottawa
>
>

Thanks to all for your input.

Jon


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             02-Sep-99 06:16:01
  To: All                                               02-Sep-99 10:42:04
Subj: Re: Help with Mindspring as an ISP

From: rgibson@ix.netcom.com (Ron Gibson)

On Wed, 1 Sep 1999 15:47:34, jvarela@mind-spring.com (John Varela) wrote:

> On Tue, 31 Aug 1999 21:21:20, rgibson@ix.netcom.com (Ron Gibson) 
> wrote:
> 
> > Anybody got tips on setting up a Mindspring account with DOIP?
> 
> http://help.mindspring.com/modules/00000/00005.htm

Chuckle.  I finally found it.  I'm a netcom converted to mindspring guy
and I wasn't used to their web site.  My old machine I selling to a
newbie and they have a real good deal for referrals now.  Sign up
somebody and you get $60 off your account and they get $60 off theirs!

So she signed up and I'm setting it up.  Just got it going a few hours
ago.

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             02-Sep-99 06:29:17
  To: All                                               02-Sep-99 10:42:04
Subj: Re: Newbie to SCSI question

From: rgibson@ix.netcom.com (Ron Gibson)

On Thu, 2 Sep 1999 01:44:45, rjlockie@home.com (Bob Lockie) wrote:

> :>Even some of the Adaptec cards are well under $100 as long as its not
> :>bootable and even some of the bootable ISA cards are around $70 on
> :>pricewatch.
> :>
> :>But I'll add that an AVA 1505 that I tried gave me such a hassle that I
> :>gave up on it.
> 
> Well, I would recommend a bootable, PCI card.
 
> My opinion is that if you're going to spend money on a card it should be a
> good one.
 
Hardly necessary to run a scanner or a DAT drive...

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: hfalken@x4u2.desy.de                              02-Sep-99 10:49:19
  To: All                                               02-Sep-99 15:03:08
Subj: need help: can't boot with windows after os2boot was executed

From: Harald Falkenberg <hfalken@x4u2.desy.de>

Hi,

on a PC with a windows 3.1 and os/2 3.0 I run into trouble after executing
the os2boot programm within the program manager. Now after every system 
restart os/2 is getting started, but I like to prefer windows 3.1 as 
default start system. So I looked into the system and found the following:

- c:command.com says wrong dos version
- autoexec.bat and config.sys seem to have only pathes to os2 dirs
- c: is the same by an os/2 start or start wis a dos boot disk
- within os/2 session fdisk (in c:\os2) says a warning, that the
   the partition table may be corrupted. Also there is only aboveground 
   dos (fat) partition, which is set to active.
- partition magic dos not work and ends with a warning, that the partion 
  table may be corrupted. 
- it is not possible to boot with a partition magic disk -> it says 
  wrong command interpreter...

I'm not familier with os/2 and the boot manager, but it looks like os/2
is started on the same partition (no hpfs is shown in fdisk). 

So if anybody can help me to solve the problems, that would be very kind:
a) start with windows 3.1 after reboot instead of os/2
b) whats wrong with the partion table

I know the system is old and dusty, but I need it seriously. 

regards
	Harald


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deutsches Elektronen-Synchrotron DESY, Hamburg, G
(1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       02-Sep-99 09:15:15
  To: All                                               02-Sep-99 15:03:08
Subj: Re: Newbie to SCSI question

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

On 2 Sep 1999 06:29:34 GMT, rgibson@ix.netcom.com wrote:
>On Thu, 2 Sep 1999 01:44:45, rjlockie@home.com (Bob Lockie) wrote:
>
>> :>Even some of the Adaptec cards are well under $100 as long as its not
>> :>bootable and even some of the bootable ISA cards are around $70 on
>> :>pricewatch.
>> :>
>> :>But I'll add that an AVA 1505 that I tried gave me such a hassle that I
>> :>gave up on it.
>> 
>> Well, I would recommend a bootable, PCI card.
> 
>> My opinion is that if you're going to spend money on a card it should be a
>> good one.
> 
>Hardly necessary to run a scanner or a DAT drive...

Well can I add to this list to go for a tekram dc390F.
Ultra wide scsi for 70 ukp. (Around 120 USD'ish)

This is running a Yamaha cdrw4416s, and I've not had
a moments bother with it!!  (Also a Zip drive as well!)

This is on Warp 4 fp11


Cheers
Chris



-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         02-Sep-99 15:14:13
  To: All                                               02-Sep-99 15:03:09
Subj: Another set up problem, hard drives this time

From: morgannalefey@my-deja.com

Setting up an OS/2 computer and we'll be installing PFS/2 on it so it
will act as a mirror print server for one we currently have running.

There are two 9.1 gig hard drives installed (Seagate is ID0 and Western
Digital is ID2).  When I first installed the second drive, I formatted
both disks hpfs for single partitions on both.  Then when I tried to
install OS/2 it whined at me that there wasn't a partition of the right
size (more than 100 megs) it could install on.  So I repartitioned the
ID0 drive with a 400 meg partition and the rest on the second
partition.  Left the second drive as a single partition.

OS/2 installed with little problem (other than the double lan card
problem I was having and got help with elsewhere).  However, now that
we're going to install the PFS/2 software, we wanted to put that on the
second partition of the first drive.  We look for the second
partition.  It's not there.  Neither is the second drive.

Are there limitations on what size of partitions OS/2 is going to
find?  Do I need to make a lot of smaller partitions?  I wanted the
second drive to hold these huge print jobs that we get on a regular
basis.  How is that going to be impacted if I have to partition into
lotsa smaller drives? (they've recently installed fixpack 10, there
were problems with installing it at first, but I think they finally got
it to install on the third go; we're using Warp 4)

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    02-Sep-99 15:45:20
  To: All                                               02-Sep-99 16:41:12
Subj: Mkisofs tips...

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

	Pretty happy to report that the combo of Initio 9100U Ultra SCSI 
card and the Ricoh 7040S CDRW internal SCSI works quite well with 
CDrecord 1.8.24.

	Okay, now can someone tell me when making the image for burning 
how to preserve directory names?  Basically I have MS Windows 3.1, MS 
Word 6, and WordPerfect 5.1+ all in the CDROM's root directory. ;-)
	Luckily the files were zipped so that it was not too much of a 
problem...this time.
	The switchs I used for mkisofs.exe were:

MKISOFS -o c:/CD_Image.Dat X:/BLAH/BLAH

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: nbi@typhoon.xnet.com                              02-Sep-99 16:35:20
  To: All                                               02-Sep-99 16:41:13
Subj: fixpaks on CDROM

From: nbi@typhoon.xnet.com (Peter Stein)

Does anyone know of a straightforward procedure for putting 
a fixpak on CDROM? I really do wish IBM would make a CD image
available or at least provide a procedure. Thanks.

Peter Stein
nbi@xnet.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Suburban Robots That Monitor Reality (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           02-Sep-99 16:53:16
  To: All                                               02-Sep-99 16:41:13
Subj: Re: Mkisofs tips...

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Thu, 2 Sep 1999 15:45:41, jdc0014@InfoNET.st-johns.nf.ca (John 
Hong) wrote:

> 	Pretty happy to report that the combo of Initio 9100U Ultra SCSI 
> card and the Ricoh 7040S CDRW internal SCSI works quite well with 
> CDrecord 1.8.24.
> 
> 	Okay, now can someone tell me when making the image for burning 
> how to preserve directory names?  Basically I have MS Windows 3.1, MS 
> Word 6, and WordPerfect 5.1+ all in the CDROM's root directory. ;-)
> 	Luckily the files were zipped so that it was not too much of a 
> problem...this time.
> 	The switchs I used for mkisofs.exe were:
> 
> MKISOFS -o c:/CD_Image.Dat X:/BLAH/BLAH
> 

Try this one (note the -R )

MKISOFS -R -o c:/CD_Image.Dat X:/BLAH/BLAH

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: mckinnis@ibm.net                                  02-Sep-99 11:00:19
  To: All                                               02-Sep-99 16:41:13
Subj: Re: fixpaks on CDROM

From: Chuck McKinnis <mckinnis@ibm.net>

Visit http://www.os2ss.com and I think you will find what you want.  If
you want it for free, you have another problem.

Peter Stein wrote:
> 
> Does anyone know of a straightforward procedure for putting
> a fixpak on CDROM? I really do wish IBM would make a CD image
> available or at least provide a procedure. Thanks.
> 
> Peter Stein
> nbi@xnet.com

-- 
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: bstephan@redshift.com                             02-Sep-99 10:32:03
  To: All                                               03-Sep-99 03:37:14
Subj: Re: fixpaks on CDROM

From: bstephan@redshift.com

The fixpaks on CD-ROM are so inexpensive from BMT Micro and
Indelible Blue that it is not worth the effort to do it oneself.

In <7qm90t$rtj$1@flood.xnet.com>, on 09/02/99 
   at 04:35 PM, nbi@typhoon.xnet.com (Peter Stein) said:

>Does anyone know of a straightforward procedure for putting  a
>fixpak on CDROM? I really do wish IBM would make a CD image
>available or at least provide a procedure. Thanks.

>Peter Stein
>nbi@xnet.com


-- 
-----------------------------------------------------------
Bob Stephan bstephan@redshift.com or BobStephan@compuserve.com
  Happily using OS/2 Warp on the Central California Coast.
   http://www.redshift.com/~bstephan
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: mdamico@itol.com                                  02-Sep-99 12:48:01
  To: All                                               03-Sep-99 03:37:15
Subj: Moving hard drive possible? (part 2)

From: "Michael D'Amico" <mdamico@itol.com>

Greetings all:

You may recall my earlier question about how possible it is to move an OS/2
v3 hard drive from a 486 to a Pentium. The general consensus was that it is
possible as long as LBA settings are checked and the video is set to
standard VGA. I did just that, and moved the hard drive and NIC to the
Pentium CPU. This computer runs several REXX scripts, 24 hours a day, all
week long.  For about a week everything worked with no problems. Then,
yesterday, the system died with the (paraphrased) message:

The system has stopped. Record the following information and contact your
vendor/support person.

Upon reboot I was told that the OS/2 desktop could not be recovered, and
that an attempt to rebuild one would be made. The rebuild failed.

Could the hard drive swap have caused this delayed error, or would I have
seen errors sooner? Is it more likely that the system experienced some sort
of hardware failure? I haven't had time to test the drive, but that was to
be my next step.

Any thoughts or suggestions?

Thanks,

Mike


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Time Warner Telecom, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                02-Sep-99 19:46:03
  To: All                                               03-Sep-99 06:09:27
Subj: Re: Moving hard drive possible? (part 2)

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <7qmh7u$3h9$1@news.inc.net>, "Michael D'Amico" <mdamico@itol.com> writes:
>Greetings all:
>
>You may recall my earlier question about how possible it is to move an OS/2
>v3 hard drive from a 486 to a Pentium. The general consensus was that it is
>possible as long as LBA settings are checked and the video is set to
>standard VGA. I did just that, and moved the hard drive and NIC to the
>Pentium CPU. This computer runs several REXX scripts, 24 hours a day, all
>week long.  For about a week everything worked with no problems. Then,
>yesterday, the system died with the (paraphrased) message:
>
>The system has stopped. Record the following information and contact your
>vendor/support person.
>
>Upon reboot I was told that the OS/2 desktop could not be recovered, and
>that an attempt to rebuild one would be made. The rebuild failed.

   Your INI files got trashed.  This may have been from a drive
or memory error.  Go into the /os2 directory, rename or delete
the os2*.ini files, and run:

makeini os2.ini ini.rc
makeini os2sys.ini inisys.rc

>Could the hard drive swap have caused this delayed error, or would I have

   Not really, as it ran for a week.  It might be a hardware
problem in your new system.  It's prudent practice to routinely
back up your INI files.

>seen errors sooner? Is it more likely that the system experienced some sort
>of hardware failure? I haven't had time to test the drive, but that was to
>be my next step

   Probably

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            02-Sep-99 22:23:01
  To: All                                               03-Sep-99 06:09:28
Subj: Re: fixpaks on CDROM

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On 2 Sep 1999 16:35:41 GMT, Peter Stein wrote:

>Does anyone know of a straightforward procedure for putting 
>a fixpak on CDROM? I really do wish IBM would make a CD image
>available or at least provide a procedure. Thanks.
>
>Peter Stein
>nbi@xnet.com

I don't have a CDR so I really don't know about it but I guess
it is a similar procedure what I use with a zip-drive.

I unpack all the fixpaks with diunpack.exe into the zip drive
under a directory like "fixpak11".
I have also unpacked the latest fixt141.dsk there.

There I have a small rexx prog. "fix.cmd" which I run.
I cannot remember where it came from. It is like this:

/* REXX */
'@ECHO OFF'
PARSE SOURCE os2 type invocation
lastslash = LASTPOS('\',invocation)
path = SUBSTR(invocation,1,lastslash-1)
'set CSFUTILPATH='path
'set CSFCDROMDIR='path
path'\SERVICE.EXE'

This works for hard disks and zip-drives so why
wouldn't it work for CD also?

I agree totaly that the fixpaks should be able to
run straight from the CD rom.

I have a set ordered from OS2 supersite but the
time it arrived it contained the old fixpak and
that seems to be the case every time. 
And the files are  .dsk copies which you have
to unpack anyhow. 
 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    02-Sep-99 20:22:06
  To: All                                               03-Sep-99 06:09:28
Subj: Re: fixpaks on CDROM

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Peter Stein (nbi@typhoon.xnet.com) wrote:

: Thanks to everyone for the tips. Unfortunately neither of these
: sources has any statement indicating that the fixpak can be
: directly applied from the CD. It seems obvious that one ought
: to be able to do that, but who knows.

	The latest fixpak is ready to be installed.  It's the other older 
one's that I believe are simply packaged.

: I'll just apply it the old fashioned way. As far as inexpensive
: I guess everything is relative. I'm used to getting an entire
: Linux distribution for $2-3 so a $15 fixpak CD seems a little 
: out of line.

	<Shrugs shoulders> Then start using Linux more.  The fixpak CD 
also includes TCP/IP updates and some other things if I'm not mistaken.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             02-Sep-99 20:50:21
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Help with Mindspring as an ISP

From: rgibson@ix.netcom.com (Ron Gibson)

On Wed, 1 Sep 1999 23:35:44, jbrush@aros.net wrote:
 
> >> Anybody got tips on setting up a Mindspring account with DOIP?
 
> Only that I spent an awfully long amount of time wrestling with it untill
> I realized that the username is bsmith@ mindspring.com and not just plain
> old bsmith.
 
> I know I was pissed to see such a stupid configuration, but other than
> that, I had no problems, other than a slow PPP connection so I ditched it.
 
Yeah that threw me for a loop too. They have V90 dialups around here.

Netcom sold out to Mindspring, so even though it appears that I have 
Netcom as an ISP it's really mindspring.  Their service has not been as 
good (more down time) but it's OK overall over the last 4 months or so.
If it gets bad I'll get another provider, but I want one that works with
all OS's from W3.1 to Linux and I don't know who consider.

Feel free to pitch in with suggestions :)


                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: nbi@typhoon.xnet.com                              02-Sep-99 21:23:20
  To: All                                               03-Sep-99 06:09:28
Subj: Re: fixpaks on CDROM

From: nbi@typhoon.xnet.com (Peter Stein)

In article <7qmm9k$puh$1@coranto.ucs.mun.ca>,
John Hong <jdc0014@InfoNET.st-johns.nf.ca> wrote:
>Peter Stein (nbi@typhoon.xnet.com) wrote:
>
>: Thanks to everyone for the tips. Unfortunately neither of these
>: sources has any statement indicating that the fixpak can be
>: directly applied from the CD. It seems obvious that one ought
>: to be able to do that, but who knows.
>
>	The latest fixpak is ready to be installed.  It's the other older 
>one's that I believe are simply packaged.
>
>: I'll just apply it the old fashioned way. As far as inexpensive
>: I guess everything is relative. I'm used to getting an entire
>: Linux distribution for $2-3 so a $15 fixpak CD seems a little 
>: out of line.
>
>	<Shrugs shoulders> Then start using Linux more.  The fixpak CD 
>also includes TCP/IP updates and some other things if I'm not mistaken.

Hmmm. I previously got to the fixpak page at bmtmicro from another OS2
site and didn't see any answers to my questions. I now double checked
by going directly to the bmtmicro home page and sure enough if you go
to the fixpak page from there you get a different page (one that has
all the answers).

You are correct that it includes other updates and can be directly
installed from CD (via a graphical install utility). Maybe $15 isn't
so bad after all. :-)

Peter Stein
nbi@xnet.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Suburban Robots That Monitor Reality (1:109/42)

+----------------------------------------------------------------------------+

From: ispalten@austin.rr.com                            02-Sep-99 21:11:03
  To: All                                               03-Sep-99 06:09:28
Subj: Re: fixpaks on CDROM

From: Irv Spalten <ispalten@austin.rr.com>

Peter, IBM doesn't supply the CD image, but there are 2 ways you can
EASILY create it.

1) Run RSU, and D/L and UNZIP the files. Do not apply the FP. Look in
the drive that you specify to have the files placed on for $RSUTMP$.
Guess what that directory is? Run OS2SERV from that directory, and
you've got it.... so just burn that directory on CD.

2) Get the READ.ME from FixTool 1.41, and look at Section 6. It details
how to install a FP from the hard disk. Just put the files on a CD, and
again, you are all set.

Irv Spalten

Peter Stein wrote:
> 
> Does anyone know of a straightforward procedure for putting
> a fixpak on CDROM? I really do wish IBM would make a CD image
> available or at least provide a procedure. Thanks.
> 
> Peter Stein
> nbi@xnet.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rgibson@ix.netcom.com                             02-Sep-99 21:37:04
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Newbie to SCSI question

From: rgibson@ix.netcom.com (Ron Gibson)

On Thu, 2 Sep 1999 09:15:31, chris@scotgate2.demon.co.uk (Chris H Lindley)
wrote:

> >> :>Even some of the Adaptec cards are well under $100 as long as its not
> >> :>bootable and even some of the bootable ISA cards are around $70 on
> >> :>pricewatch.

> >> Well, I would recommend a bootable, PCI card.
> > 
> >> My opinion is that if you're going to spend money on a card it should be
a
> >> good one.
 
> >Hardly necessary to run a scanner or a DAT drive...
> 
> Well can I add to this list to go for a tekram dc390F.
> Ultra wide scsi for 70 ukp. (Around 120 USD'ish)
> 
> This is running a Yamaha cdrw4416s, and I've not had
> a moments bother with it!!  (Also a Zip drive as well!)

Yep, that's a good option too.  I hear the Symbios based cards are good
bang for the buck also. I'm not sure about OS/2 compatibility, though.

If I was going for a full blown PCI bootable SCSI card I'd look at the
options. $250 is a bit pricey...

I know Teckram and Symbios are both supported under Linux, also.

                      email: rgibson@ix.netcom.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: nbi@typhoon.xnet.com                              02-Sep-99 21:51:15
  To: All                                               03-Sep-99 06:09:28
Subj: Re: fixpaks on CDROM

From: nbi@typhoon.xnet.com (Peter Stein)

In article <37CEE7D6.1DB34495@austin.rr.com>,
Irv Spalten  <ispalten@austin.rr.com> wrote:
>Peter, IBM doesn't supply the CD image, but there are 2 ways you can
>EASILY create it.
>
>1) Run RSU, and D/L and UNZIP the files. Do not apply the FP. Look in
>the drive that you specify to have the files placed on for $RSUTMP$.
>Guess what that directory is? Run OS2SERV from that directory, and
>you've got it.... so just burn that directory on CD.
>
>2) Get the READ.ME from FixTool 1.41, and look at Section 6. It details
>how to install a FP from the hard disk. Just put the files on a CD, and
>again, you are all set.
>
>Irv Spalten
>
>Peter Stein wrote:
>> 
>> Does anyone know of a straightforward procedure for putting
>> a fixpak on CDROM? I really do wish IBM would make a CD image
>> available or at least provide a procedure. Thanks.
>> 
>> Peter Stein
>> nbi@xnet.com

Thanks. I actually installed a prior fixpak from hard disk and
was thinking of that as a brute force way to accomplish this.
A much more elegant way would be a utility that generates a
burnable ISO image from the downloadable fixpak files, in other
words a utility that automates the image creation so that the 
user only needs to download, run utility, and burn CD. I guess
it shouldn't be too difficult to write something like this.
Anyway, I've decided to punt and buy the $15 fixpak CD from
bmtmicro.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Suburban Robots That Monitor Reality (1:109/42)

+----------------------------------------------------------------------------+

From: barrowcl@flash.net                                02-Sep-99 21:55:14
  To: All                                               03-Sep-99 06:09:28
Subj: LSPU + LPT1/2

From: "George Barrowcliff" <barrowcl@flash.net>

I am using IBMs LanServerPrintUtility with two IBM Network 17 printers with
TCP/IP and Ethernet.  Both printers are configured and show up in the LSPU.

Printer1 is using \PIPE\NPM0, Printer2 is using \PIPE\NPM1

I have redirected the outputs from the spooler like this:
 SPOOL /D:LPT1  /O:Printer1 & SPOOL /D:LPT2 /O:Printer2

This works for a few hours then printing directed at lpt2 ends up on
Printer1.
When I check the port \PIPE\NPM1, it is not attached anymore.
If I reissue the command, LPT1 and LPT2 work OK.

Is there a different way this should be done?
TIA GWB


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Bergen Brunswig (1:109/42)

+----------------------------------------------------------------------------+

From: tabrown@nospam.ibm.net                            02-Sep-99 21:49:02
  To: All                                               03-Sep-99 06:09:28
Subj: Win-OS2: Unexpected DOS error: 23 ????

From: tabrown@nospam.ibm.net (Tom Brown)

I am trying to install a CBT training course from CDROM under WinOS2. 
Running the START.EXE installation program via any method I can think 
of produces the message window:

Unexpected DOS error: 23

Can anyone tell me what this means? Is there a list of these error 
codes somewhere?

Thanks!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: American Digital Network (1:109/42)

+----------------------------------------------------------------------------+

From: Nullmudshark-505@worldnet.att.net                 02-Sep-99 18:20:01
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Win-OS2: Unexpected DOS error: 23 ????

From: "Dave" <Nullmudshark-505@worldnet.att.net>

Yeah its a Win95 program.  They all seem to generate that message

On 2 Sep 1999 21:49:05 GMT, Tom Brown wrote:

>I am trying to install a CBT training course from CDROM under WinOS2. 
>Running the START.EXE installation program via any method I can think 
>of produces the message window:
>
>Unexpected DOS error: 23
>
>Can anyone tell me what this means? Is there a list of these error 
>codes somewhere?
>
>Thanks!



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: nope (1:109/42)

+----------------------------------------------------------------------------+

From: bstephan@redshift.com                             02-Sep-99 16:29:15
  To: All                                               03-Sep-99 06:09:28
Subj: Re: fixpaks on CDROM

From: bstephan@redshift.com

In <7qmi5o$2g1$1@flood.xnet.com>, on 09/02/99 
   at 07:11 PM, nbi@typhoon.xnet.com (Peter Stein) said:

> a $15 fixpak CD seems a little out of line.

Subsequent releases from BMT are only $7, so that might help a
little. I believe WarpUP! from IB is more automated. It will tell
you what on your system needs to be updated, and will install
updates by clicking on a selection. Duane there has done quite a
nice job of it.

-- 
-----------------------------------------------------------
Bob Stephan bstephan@redshift.com or BobStephan@compuserve.com
  Happily using OS/2 Warp on the Central California Coast.
   http://www.redshift.com/~bstephan
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    03-Sep-99 00:38:15
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Mkisofs tips...

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Lorne Sunley (lsunley@mb.sympatico.ca) wrote:

: Try this one (note the -R )

: MKISOFS -R -o c:/CD_Image.Dat X:/BLAH/BLAH

	Thanks for the tip!  Anyways, is there one where I can preserve 
all directory names where I don't have to include all the directory names?
Or am I stuck with putting each directory that I want in all the time?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          03-Sep-99 02:03:24
  To: All                                               03-Sep-99 06:09:28
Subj: Re: fixpaks on CDROM

From: piquant00@uswestmail.net (Annie K.)

On Thu, 2 Sep 1999 19:11:53, nbi@typhoon.xnet.com (Peter Stein) wrote:

:Unfortunately neither of these
:sources has any statement indicating that the fixpak can be
:directly applied from the CD. 

 I know from experience that the BMT Micro fixpak CD-ROM has this 
capability.

-- 
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: nbi@typhoon.xnet.com                              02-Sep-99 19:11:26
  To: All                                               03-Sep-99 06:09:29
Subj: Re: fixpaks on CDROM

From: nbi@typhoon.xnet.com (Peter Stein)

In article <37ceb4c5$2$ofgrcuna$mr2ice@news.redshift.com>,
 <bstephan@redshift.com> wrote:
>The fixpaks on CD-ROM are so inexpensive from BMT Micro and
>Indelible Blue that it is not worth the effort to do it oneself.

Thanks to everyone for the tips. Unfortunately neither of these
sources has any statement indicating that the fixpak can be
directly applied from the CD. It seems obvious that one ought
to be able to do that, but who knows. If the CD is merely 
intended as a packaging convenience then it isn't worth it,
I'll just apply it the old fashioned way. As far as inexpensive
I guess everything is relative. I'm used to getting an entire
Linux distribution for $2-3 so a $15 fixpak CD seems a little 
out of line.

>
>In <7qm90t$rtj$1@flood.xnet.com>, on 09/02/99 
>   at 04:35 PM, nbi@typhoon.xnet.com (Peter Stein) said:
>
>>Does anyone know of a straightforward procedure for putting  a
>>fixpak on CDROM? I really do wish IBM would make a CD image
>>available or at least provide a procedure. Thanks.
>
>>Peter Stein
>>nbi@xnet.com
>
>
>-- 
>-----------------------------------------------------------
>Bob Stephan bstephan@redshift.com or BobStephan@compuserve.com
>  Happily using OS/2 Warp on the Central California Coast.
>   http://www.redshift.com/~bstephan
>-----------------------------------------------------------
>


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Suburban Robots That Monitor Reality (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     02-Sep-99 20:23:05
  To: All                                               03-Sep-99 06:09:29
Subj: Re: Another set up problem, hard drives this time

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Thu, 02 Sep 1999 15:14:27 GMT, morgannalefey@my-deja.com wrote:

->Are there limitations on what size of partitions OS/2 is going to
->find?

Unless you upgrade the IDE drivers on the install diskettes then it will
not work with IDE drives greater than 4GB in size. Find the new drivers at
ftp://service.boulder.ibm.com/ps/products/os2/os2ddpak/idedasd.exe. Run
the file to expand it, copy the new version of IBM1S506.ADD onto a
diskcopy of the second diskette. If there isn't enough space then you may
delete AIC7770.ADD (used for EISA Adaptec SCSI cards) and/or AIC7870.ADD
(used for Adaptec PCI SCSI cards except the 2940U2W). Add the line

SET COPYFROMFLOPPY=1

to CONFIG.SYS and you should be fit.


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: mcmorran@norfolk.infi.net                         02-Sep-99 22:56:18
  To: All                                               03-Sep-99 10:34:21
Subj: Re: Mkisofs tips...

From: mcmorran@norfolk.infi.net (Peter McMorran)

[courtesy copy sent to poster]

In <7qn5a7$n63$1@coranto.ucs.mun.ca>, on 09/03/99 
   at 12:38 AM, jdc0014@InfoNET.st-johns.nf.ca (John Hong) said:

>Lorne Sunley (lsunley@mb.sympatico.ca) wrote:

>: Try this one (note the -R )

>: MKISOFS -R -o c:/CD_Image.Dat X:/BLAH/BLAH

>	Thanks for the tip!  Anyways, is there one where I can preserve
> all directory names where I don't have to include all the
>directory names? Or am I stuck with putting each directory that
>I want in all the time?

Hi, John,

When you give mkisofs a directory, it puts the files (and
directories) from that directory in the root directory of the CD.
To make that directory itself appear in the CD root, use
dirname/=dirname, where the dirname on the right is whatever the
path to the directory is. I've even used DiskC/=c:/ to copy a
partition to a directory on the CD. Not sure if this answers your
question; if not, please clarify your problem.

By the way, I've evolved the following set of options for
mkisofs:

-a -J -l -L -R

They don't hurt, and the -J in particular makes the original
filenames visible in OS/2, as long as they are less than 64
characters.

Cheers,
Peter

-- 
-----------------------------------------------------------
mcmorran@norfolk.infi.net (Peter McMorran)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: raymond.heath@pss.boeing.com                      03-Sep-99 03:20:18
  To: larry926@mindspring.com                           03-Sep-99 10:34:22
Subj: Re: boot manager

To: Larry Osborne <larry926@mindspring.com>
From: Raymond Heath <raymond.heath@pss.boeing.com>

Sorry, this will be lengthy, but helpful

In response to the boot manager question, I had simular troubles, but
using System commander. It was my intent to run DOS/WIN31, OS/2WARP, and
LINUX on the same drive. 

My problem was that in order to get a copy of DOS/WIN31 to the next
drive where I was to put OS/2, I had to first create a drive that had
two primaries and one extended partion which had no drive letter
assigned to it. Then I loaded the first active primary, let's call it
C1, with DOS and WIN 3.1 and all the associated drivers for the hardware
and then verify everything worked.

Then I loaded System Commander and reset the computer to let it find my
newly installed DOS partion. Once there I re-verified that WIN 3.1 came
up and everything worked. After that, I ran SCDISK from the System
Commander directory and made all partions hidden.

After resetting the computer, System Commander comes up, like boot
manager, and asks which drive you want. I pick the second primary, C2,
and it tries to boot off of it. Since it is a new virgin partition, it
asks for a system disk. I insert my DOS setup disk, it formats the
partition, and loads DOS. I then reapeat the process of loading WIN3.1,
(for OS/2 use) and it tells me that a version of WIN31 is on the
harddrive in drive D. You see, the first partition now becomes the
second drive. (this will swap if you change partitions on re-boot, i.e.
DOS to OS/2) You DO NOT choose to update the version on D: (really C1)
and instead tell it to install to C:\WINDOWS, just like you had never
installed it before. After rebooting back to C2, you just load all the
windows drivers for all your hardware and you should have two identicle
DOS/WIN31 systems.

At this point I re-boot again, rename my second partition, C2, to
OS2WARP, and boot into it, which is still currently DOS/WIN31 only. I
then install my OS/2 CD and startup disk, reboot to it and load WARP
normally, choosing the Express method.

I have learned one primary thing after hundreds of load combinations, If
you like WIN95/98, keep it on a seperate computer. Same goes with LINUX.
Both are designed to take full control of the boot sector. Oh, they can
be fooled for awhile, but sometime the registry or boot system manager,
will hickup and you will loose your dual boot combinations, and maybe
all your hardwork.

OS/2 was designed to be loaded into a DOS FAT drive and to utilize the
WIN 1.25 16bit format for compatability. Even though OS/2 is 32 bit OS,
it deals with it's upper 16 bits in an entirely different manner than
Microsoft OS's. At least the lower 16 bits is entirely compatable. That
is why there is no compatability with WIN32 applications, only WIN16
(which is really DOS compatable, since WIN 3.1 is only a program, not an
OS, because it requires DOS to run.)

One thing I noticed with WARP 4 compared to WARP 3, It's a memory hog!
The more you have the faster it runs. With only 16meg it takes 1min
50sec to boot on a P133 computer. With 32meg that time is cut in half.

I did find that Plug and Pray modems are a definate no no. Got a good
deal on a Manual set com port Hayes 56KFex/V90 ISA modem. Trust me, for
OS/2, you NEED a manual set modem like a 3-Com, Hayes, or the like.

Oh Larry, I almost forgot, the correct command is

     FDISK /MBR

	Ray

Larry Osborne wrote:
> 
> I want to thank all the people that responded to my post.  I went into dos
> in win98 and made the non-dos partition active and my boot manager is now
> working like a charm.  Again, Thank You all.
> 
> Larry
> 
> >"Larry Osborne" <larry926@mindspring.com> wrote:
> >>I had finally got warp 4 installed and working on my computer.  I put
> win98
> >>in another partition.  When I rebooted after the 98 installation my boot
> >>manager no longer shows up.  I tried using the utility disks that I made
> for
> >>os/2 but fdisk keeps saying that the partition table maay be corrupted.  I
> >>tried the fddisk/newmbr and it returns an error no. 3.  Any suggestions?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Boeing Company (1:109/42)

+----------------------------------------------------------------------------+

From: derwin@airmail.net                                03-Sep-99 00:28:11
  To: All                                               03-Sep-99 11:24:27
Subj: Re: fixpaks on CDROM

From: Dale Erwin <derwin@airmail.net>

Peter Stein wrote:
> 
> In article <7qmm9k$puh$1@coranto.ucs.mun.ca>,
> John Hong <jdc0014@InfoNET.st-johns.nf.ca> wrote:
> >Peter Stein (nbi@typhoon.xnet.com) wrote:
> >
> >: Thanks to everyone for the tips. Unfortunately neither of these
> >: sources has any statement indicating that the fixpak can be
> >: directly applied from the CD. It seems obvious that one ought
> >: to be able to do that, but who knows.
> >
> >       The latest fixpak is ready to be installed.  It's the other older
> >one's that I believe are simply packaged.
> >
> >: I'll just apply it the old fashioned way. As far as inexpensive
> >: I guess everything is relative. I'm used to getting an entire
> >: Linux distribution for $2-3 so a $15 fixpak CD seems a little
> >: out of line.
> >
> >       <Shrugs shoulders> Then start using Linux more.  The fixpak CD
> >also includes TCP/IP updates and some other things if I'm not mistaken.
> 
> Hmmm. I previously got to the fixpak page at bmtmicro from another OS2
> site and didn't see any answers to my questions. I now double checked
> by going directly to the bmtmicro home page and sure enough if you go
> to the fixpak page from there you get a different page (one that has
> all the answers).
> 
> You are correct that it includes other updates and can be directly
> installed from CD (via a graphical install utility). Maybe $15 isn't
> so bad after all. :-)
> 
> Peter Stein
> nbi@xnet.com

If I'm not mistaken, BMTMicro also has a subscription plan which
puts the cost per CD even less than that.
-- 
Dale Erwin
3624 Coral Gables Drive
Dallas, Texas 75229-2619
(214)893-8738

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Erwin Technology Corporation (1:109/42)

+----------------------------------------------------------------------------+

From: dmeade@pacbell.net                                02-Sep-99 22:11:27
  To: All                                               03-Sep-99 11:24:27
Subj: PCMCIA, Thinkpad 390, and IBM2SS14

From: dmeade@pacbell.net (David Meade)

Greetings,

I'm trying to get a pcmcia ethernet card working on a thinkpad 390
under Warp 4.0. I can't get it to work.

Here's what I know:
  1) When I boot the Win98 partition, it works perfectly.
     This is a Kingston kne-pc2t card and yes, it has os/2 drivers.
  2) When I boot OS/2 (4.0ga) it fails to load ibm2ss14.sys
  3) When I add /DEBUG on the ibm2ss14.sys line, I don't get any
     further information.
  4) When I go PC Card Director ---> PC Card Director I get a message
     there is no pcmcia slot.
  5) I have not started the TCPIP configuration for the card, awaiting
     getting the drivers to load.

Here's is what I've tried,
  1) I tried installing the pcmcia software from the ga disk
  2) I've gone to the thinkpad site and downloaded the pcmcia
     stuff for this machine. I've overlaid the old versions with the
     new ones.
  3) I've added a pci irq (9) to the list in the setup (ie. bios)
     screen (they were all set at 11).
  4) I activated all the internal stuff (internal, IR, com1, etc.)
     in the bios.

Here is what I am assuming:
  1) I can't get to start setting up the ethernet card until I get
     the ibm2ss14.sys driver to load.

Is this a correct assumption? Can anyone point me in the right
direction.

Thanks,

David

--
 David Meade                        Internet=dmeade@pacbell.net
 Oakland, CA

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    03-Sep-99 07:45:08
  To: All                                               03-Sep-99 11:24:27
Subj: Re: Mkisofs tips...

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Peter McMorran (mcmorran@norfolk.infi.net) wrote:

: When you give mkisofs a directory, it puts the files (and
: directories) from that directory in the root directory of the CD.

	I believe that is what happened to me just now.  My D: is a fat 
partition (674 MB).  This is where I stick the files that I am preparing 
to make an image with.  I had the directories broken down to this:

D:\OS2
D:\DOS
D:\WINDOWS

	In each directory I had other directoires like \APPS\ and \UTILS\.
Now I prepared the image with this:

mkisofs -R -o C:/CDIMAGE.IMG D:/*

	What I got after burning was:

X:\APPS
X:\UTILS

	Basically it just skipped the D:\OS2\ part and only preserved the 
D:\OS2\APPS directory name (as X:\APPS).  Thing is I wanted X:\OS2\APPS 
and X:\OS2\UTILS, etc.

: To make that directory itself appear in the CD root, use
: dirname/=dirname, where the dirname on the right is whatever the
: path to the directory is. I've even used DiskC/=c:/ to copy a
: partition to a directory on the CD. Not sure if this answers your
: question; if not, please clarify your problem.

	Could you give me an example of this?  I think this maybe what 
I'm looking for.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                03-Sep-99 07:56:05
  To: All                                               03-Sep-99 11:24:27
Subj: Re: Newbie to SCSI question

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <eleS4DQ3N6dS-pn2-xpeEbXmxvbg6@tam-fl10-38.ix.netcom.com>,
rgibson@ix.netcom.com (Ron Gibson) writes:
>On Thu, 2 Sep 1999 09:15:31, chris@scotgate2.demon.co.uk (Chris H Lindley)
>wrote:

>Yep, that's a good option too.  I hear the Symbios based cards are good
>bang for the buck also. I'm not sure about OS/2 compatibility, though.

   Really good.

baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      03-Sep-99 02:18:05
  To: All                                               03-Sep-99 17:08:12
Subj: Re: Win-OS2: Unexpected DOS error: 23 ????

From: nospam@savebandwidth.invalid      (John Thompson)

In <1dg3dd6yrPYX-pn2-vs3B0SddVdDD@adnline2030.adnc.com>,
tabrown@nospam.ibm.net (Tom Brown) writes:

>I am trying to install a CBT training course from CDROM under WinOS2. 
>Running the START.EXE installation program via any method I can think 
>of produces the message window:
>
>Unexpected DOS error: 23
>
>Can anyone tell me what this means? Is there a list of these error 
>codes somewhere?

IIRC, this means you are trying to run a program that uses an 
unsupported revision of the Win32 API.

-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    03-Sep-99 12:15:26
  To: All                                               03-Sep-99 17:08:13
Subj: CDRecord/2...

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

	Slight problem I'm having with CDRecord 1.8.24, I can't get this 
sucker to go up to speed=4.  I have a Ricoh 7040S, it is 4x write, 4x 
re-write.  Anyway I can get CDRecord to go at full speed or am I stuck 
with 2x?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    03-Sep-99 07:08:13
  To: All                                               03-Sep-99 17:08:13
Subj: Re: **Attention, Motherboard & OS/2

From: dcasey@ibm.net (Dan Casey)

In article <abfcnzriefcnzarg.fheoue1.pminews@news1.banet.net>,
"/2 User" <nospam_evr@spam.net> wrote:
>What is the best Socket 7 mother board for OS/2. I will be using a AMDK6-2
>333 processor with it.
>I currently have the Epox piece of crap and I cant even get windose to run on
>it.
>Which Chipset?
>Which brand?
>Is their a url to purchase?
>
>Thanks in advance.

I have 3 machines running Warp 4, here. One on an FIC VT 502 (P-150
processor), one on an FIC 503+ (AMD K6-233) and one on a Tyan Trinity
(AMD K62-400). All have a VIA chipset, and I'm quite pleased with all
of them.

A lot depends on your planned RAM configuration, how many ISA and PCI
slots you need, etc.

Check out:
http://www.digiconcepts.com/motherboards.htm

Plenty of information on the boards themselves, and good pricing.

I'm partial to the VIA chipsets, myself. the DANIS506 drivers support
them, and the USB support from IBM works with them (USB support
doesn't work with any chipsets other than Intel and VIA, and the Intel
Socket 7 chipsets won't cache more than 64 Mb of RAM).

There are a couple of good articles on the web that cover this
subject. One (which I wrote back in April of 1998) on choosing a
Motherboard can be found at:

http://www.os2voice.org/VNL/past_issues/VNL0498H/vnewsf2.htm

David Wei wrote an excellent article that explains, in depth, the
differences and details of processor Cache. Good information to have
for planning future upgradeability.

http://www.os2ezine.com/v4n7/k6iii.htm

Good Luck :-)
--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: skhalsa@my-deja.com                               03-Sep-99 12:19:10
  To: All                                               03-Sep-99 17:08:13
Subj: Help! Won't boot OS/2

From: skhalsa@my-deja.com

I have a 486 that once had OS/2 installed.  Now it won't boot OS/2 from
floppies.  Not from the install disks nor utility disks made on another
computer.  I tried the recent ideasd drivers, turning off turbo, shadow
ram, cache ram.

The boot disks stall on disk one after the VGA logo and the "wait,
install files" and I'm left with a blinking cursor.

The install disk leave me at an a: prompt, but will accept no keyboard
input (not even c-a-d).



Particulars:
Dos 6.22, Win31 install working normally.
FAT
1.6GB HD with 250MB partition (boot) and 1.3GB partition
Promise 2300+ eide controller (noncaching) with ide cdrom on second
channel.
Tried CMOS setup for HD at Normal, and also at LBA, with no change in
booting OS/2 nor any effect on the DOS/Win31 boot.


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: morgannalefey@my-deja.com                         03-Sep-99 12:24:09
  To: All                                               03-Sep-99 17:08:13
Subj: Re: Another set up problem, hard drives this time

From: morgannalefey@my-deja.com

In article
<geribeurzfyrlqvnycvcrkpbz.fhgjqn0.pminews@news.dial.pipex.com>,
  "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com> wrote:
> On Thu, 02 Sep 1999 15:14:27 GMT, morgannalefey@my-deja.com wrote:
>
> ->Are there limitations on what size of partitions OS/2 is going to
> ->find?
>
> Unless you upgrade the IDE drivers on the install diskettes then it
will
> not work with IDE drives greater than 4GB in size. Find the new
drivers at
> ftp://service.boulder.ibm.com/ps/products/os2/os2ddpak/idedasd.exe.
Run
> the file to expand it, copy the new version of IBM1S506.ADD onto a
> diskcopy of the second diskette. If there isn't enough space then you
may
> delete AIC7770.ADD (used for EISA Adaptec SCSI cards) and/or
AIC7870.ADD
> (used for Adaptec PCI SCSI cards except the 2940U2W). Add the line
>
> SET COPYFROMFLOPPY=1
>
> to CONFIG.SYS and you should be fit.

I'm a little confused.  Just to be clear on this.  I don't have *any*
IDE drives on this computer.  There are two drives, they are both scsi
drives chained off the scsi adapter.

Just to update, IBM has me doing a low level format, then I'll go back
and reformat and partition the drives.  We'll see how that goes.

--
Siobhan Perricone
PC Technician
Alltel Information Services
(I only speak for myself, not for Alltel)


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: alex@eddie.cis.uoguelph.ca                        03-Sep-99 14:27:22
  To: All                                               03-Sep-99 17:08:13
Subj: Re: Win-OS2: Unexpected DOS error: 23 ????

From: alex@eddie.cis.uoguelph.ca (Alex Taylor)

On Fri, 03 Sep 1999 02:18:10 GMT, John Thompson <nospam@savebandwidth.invalid>
wrote:
> >I am trying to install a CBT training course from CDROM under WinOS2. 
> >Running the START.EXE installation program via any method I can think 
> >of produces the message window:
> >
> >Unexpected DOS error: 23
> >
> >Can anyone tell me what this means? Is there a list of these error 
> >codes somewhere?
> 
> IIRC, this means you are trying to run a program that uses an 
> unsupported revision of the Win32 API.

Odd, I've managed to install CBT courses just fine under Win-OS/2,
as they're Win16 programs for compatibility reasons.

Maybe there's a Win3.1 version on the CD that needs to be selected?
Or perhaps Win32s needs to be updated (I see it doesn't say if it's
Warp 4 or not)...

-- 
-----------------------------------------------------------------
 Alex Taylor                  BA - CIS - University of Guelph
 alex@eddie.cis.uoguelph.ca   http://eddie.cis.uoguelph.ca/~alex
-----------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           03-Sep-99 15:11:11
  To: All                                               03-Sep-99 19:57:17
Subj: Re: Help! Won't boot OS/2

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Fri, 3 Sep 1999 12:19:20, skhalsa@my-deja.com wrote:

> I have a 486 that once had OS/2 installed.  Now it won't boot OS/2 from
> floppies.  Not from the install disks nor utility disks made on another
> computer.  I tried the recent ideasd drivers, turning off turbo, shadow
> ram, cache ram.
> 
> The boot disks stall on disk one after the VGA logo and the "wait,
> install files" and I'm left with a blinking cursor.
> 
> The install disk leave me at an a: prompt, but will accept no keyboard
> input (not even c-a-d).
> 
> 
> 
> Particulars:
> Dos 6.22, Win31 install working normally.
> FAT
> 1.6GB HD with 250MB partition (boot) and 1.3GB partition
> Promise 2300+ eide controller (noncaching) with ide cdrom on second
> channel.
> Tried CMOS setup for HD at Normal, and also at LBA, with no change in
> booting OS/2 nor any effect on the DOS/Win31 boot.
> 
> 

It may be hanging up on the Promise EIDE controller. The IBM1S506
drivers have problems with these thing. Try pulling out the card
and see if the boot completes. (at least to the "I can't find the 
CD0-ROM"
screen - given you are booting with the CD install diskettes).

The DANIS506 driver available on http://hobbes.nmsu.edu
purports to handle these controllers. You would have to update
the install disks with this driver to use the Promise controller.

Also, try pressing ALT-F2 at the OS/2 "boot blob" and see which
device driver is hanging the system. (The drivers display at the 
bottom
of the screen during load).

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: esitea@inficad.com                                03-Sep-99 08:43:20
  To: All                                               03-Sep-99 19:57:18
Subj: Re: fixpaks on CDROM

From: Ezra Sitea <esitea@inficad.com>

BMT Micro's CD Fixpaks from OS2SS.COM can be applied directly from cd.
Very simple, gui interface allows installation of base fixpaks and TCPIP
fixes as well.  Have used the CDs since fixpak 37 for Warp 3 and fixpak
6 for Warp 4.  These CDs are well worth the nominal fee charged.

Ezra

Peter Stein wrote:

> Thanks to everyone for the tips. Unfortunately neither of these
> sources has any statement indicating that the fixpak can be
> directly applied from the CD.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Inficad Communications (1:109/42)

+----------------------------------------------------------------------------+

From: osmo.vuorio@sonera.fi                             03-Sep-99 16:27:22
  To: All                                               03-Sep-99 21:18:29
Subj: Re: PCMCIA, Thinkpad 390, and IBM2SS14

From: osmo.vuorio@sonera.fi (osmo vuorio)

In article <ai1z3AgWxgPT089yn@pacbell.net>, dmeade@pacbell.net (David Meade)
says:
>

>Is this a correct assumption? Can anyone point me in the right
>direction.
>

http://www.pc.ibm.com/us/support/thinkpad/tpopsys.html
http://www.pc.ibm.com/qtechinfo/YAST-3MDRYE.html

Osmo

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telecom (1:109/42)

+----------------------------------------------------------------------------+

From: osmo.vuorio@sonera.fi                             03-Sep-99 16:31:02
  To: All                                               03-Sep-99 21:18:29
Subj: Re: PCMCIA, Thinkpad 390, and IBM2SS14

From: osmo.vuorio@sonera.fi (osmo vuorio)

In article <ai1z3AgWxgPT089yn@pacbell.net>, dmeade@pacbell.net (David Meade)
says:
>

>  3) I've added a pci irq (9) to the list in the setup (ie. bios)
>     screen (they were all set at 11).

Why Irq9? Pci de facto is Irq11,

Osmo

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telecom (1:109/42)

+----------------------------------------------------------------------------+

+============================================================================+
