
                   comp.os.os2.apps                 (Usenet)

                 Saturday, 28-Aug-1999 to Friday, 03-Sep-1999

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    27-Aug-99 21:47:01
  To: All                                               28-Aug-99 03:31:24
Subj: Re: Lotus Web Site Fixed

From: rcpj@panix.com (Pierre Jelenc)

Sander Nyman <nospam@sancoatjpsdotnet.void> writes:
> I am fairly certain that anyone needing the Lotus Smart Suite update to
> v1.1.1 has already downloaded it from Hobbes.  

I did that, but what do I do next? There's no installation program and no
instructions.

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          27-Aug-99 21:55:29
  To: All                                               28-Aug-99 03:31:24
Subj: Re: OS2 & Lexmark

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Fri, 27 Aug 1999 16:24:09, esther@bitranch.com (Esther Schindler) a 
crit dans un message:

> (Gosh, it's *so* nice to have an entire thread where people are 
> praising a hardware vendor's OS/2 support!)

Shows what great press you can get from us when you spin off a subsidiary 
out of IBM's bluesuitfreakthimk domain.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               28-Aug-99 00:21:03
  To: All                                               28-Aug-99 03:31:24
Subj: emTeX or emTeX/TDS?

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Hi there!

I am planning to use VTeX (PDF output) which needs either a special TeX
distribution set or emTeX/TDS according to its README. Currently I have
installed normal emTeX.
Can anybody tell me about the differences between normal emTeX and
emTeX/TDS? What are the advantages/disadvantages? I have read that there
are things emTeX/TDS can't do. But which?

Thanks in advance

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               28-Aug-99 00:28:06
  To: All                                               28-Aug-99 03:31:24
Subj: FTP Browser 1.71 bug?

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Hi!

I have tried FTP Browser 1.71 for some days now. It's a nice program,
but it definitely has a few annoying bugs. E.g. I can't get it to change
to directory with spaces in the name. Any workaround?

The info screen says "Build date: 05/02/97", so I think it's not
maintained any longer. Sigh... I would have registered it, but those
bugs limit the programs usefulness too much.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               28-Aug-99 00:31:15
  To: All                                               28-Aug-99 03:31:24
Subj: Re: Looking for flow chart program.

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Dave Critelli schrieb:
> 
> Hello:
> 
> I'm looking for an application to generate flow charts.  Suggestions
> please.

Have a look at StarOffice 5.1! I think it's the StarImpress part. A
friend of mine once showed me how he made flow charts and it seemed very
easy to do.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               27-Aug-99 23:06:26
  To: All                                               28-Aug-99 03:31:24
Subj: Re: RealPlayer for OS/2

From: esther@bitranch.com (Esther Schindler)

Isaac, the RealAudio folks want to sell servers. In order to sell 
servers, they need people using the client -- and gadzillions of 
people do -- but they only make money on servers. That's their 
ultimate goal, even if they need a loss-leader (such as grocery chains
selling bananas at 5lbs/$1) to get people into the virtual store, so 
to speak.

Is there a reason for RealAudio to port both a client and a server to 
Linux? If they asked me, I'd give than an unmitigated Yes. On this, I 
suspect we all agree.

Is there a business case for them to create an OS/2 version of either 
client or server? ....well, as an OS/2 user I'd sure like it (I 
currently walk over to my mac or a Windows machine to listen to 
RealAudio, on the few occasions I want it) but I don't see a way to 
convince them that there's money in it. Even if you think that "the 
cost of doing an unsupported version is pretty low," that "pretty low"
is sure to be non-zero, and you haven't offered a business reason for 
them to spend a cent on this market.

Please don't think that the reason I argue with you is because I don't
want a RealAudio client. I'd love one. But if you're in the position 
of selling a viewpoint, you have to be prepared to tell your opponent 
what *their* benefit is to doing things the way you ask... what _you_ 
get out of it is irrelevant to the discussion.

--Esther

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               27-Aug-99 23:09:28
  To: All                                               28-Aug-99 03:31:24
Subj: Re: Looking for flow chart program.

From: esther@bitranch.com (Esther Schindler)

On Fri, 27 Aug 1999 22:31:30, Christian Hennecke 
<christian.hennecke@ruhr-uni-bochum.de> wrote:
| Have a look at StarOffice 5.1! I think it's the StarImpress part. A
| friend of mine once showed me how he made flow charts and it seemed very
| easy to do.

Is it a charting application, Christian, or a flowcharting 
application?

Here's the difference.

With a charting program, you can create a series of boxes and draw 
arrows between them. When you discover that there's another step in 
between two of 'em, though, you have to manually move the boxes and 
arrows to make room for the new item, and rearrange items on the page 
if you've added a branch.

With a flowcharting application, you add the items and define the 
relationships between them, and when you add a new item, the page 
automatically reflows the presentation. It's very slick, very useful, 
and -- to some people -- very necessary.

--Esther 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: steve53_remove_this@earthlink.net                 27-Aug-99 16:34:06
  To: All                                               28-Aug-99 03:31:24
Subj: Re: Lotus SmartSuite Updated to v1.1.1

From: steve53_remove_this@earthlink.net

In <37c56229.1743813@news.omen.net.au>, on 08/26/99 
   at 03:51 PM, zayne@omen.com.au (Mooo) said:

>There is a small list of fixes.  The main problem we have is that 123
>still cannot print to a net printer nor print to pmfax.  As such, its

Have you installed the updated FxPrint driver available at the Keller
site?

Steven

--
---------------------------------------------------------------
Steven Levine <steve53removethis@earthlink.net>  MR2/ICE #10183 Warp4/FP11
---------------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            27-Aug-99 23:55:27
  To: All                                               28-Aug-99 03:31:24
Subj: Re: Any experience with "TAME"?

From: mike.luther@ziplog.com

In <7q6rkq$1cr$4@coranto.ucs.mun.ca>, jdc0014@InfoNET.st-johns.nf.ca (John
Hong) writes:
> In <37b54098.8507193@news-s01.ny.us.ibm.net>, jiclbch@ibm.net (Juan I. 
>Cahis) writes:
>
>>Dear Friends:
>>
>>Does someone of you have any experience with "TAME"?
>>
>>It is a utility to enhance the multitasking capabilities of MsDos (and
>>Win-OS/2) VDM's, enhancing the overall performance of the system. You
>>can get it at Hobbes (TAME133.ZIP). It seems a very interesting
>>utility.
>>
>>Any hint?
>
>	I'm afraid it doesn't really do much with Win-OS/2, at least none 
>that I have seen.  I mean, with Win-OS/2 that is essentially running two 
>enviornments, back to back.  First OS/2 loads up the DOS VDM, and then 
>run's Windows 3.1 inside it.  Tame doesn't do much good with Windows.  
>It's mainly a DOS thing.

Not at all true in my experience, especially with comm port programs
that are WIN 3.1 programs such as PPWIN for the AEA ham TNC's!

What will happen, or at least does for me is that the inate CPU bashing
can be cut from 100% to only 50% trashed.  That's crucial.  At the risk
of being castigated for punishment, half a loaf is better than none.  :)

More important, for those souls running Classic Pentiums of all speeds
and even MMx variants, it seems to eliminate the 100% load problem that
sets up the F0 bug!  WIN 3.1 apps which are not run inside some kind of
a task buster do put up the wrong signal flag to the 'train', it seems,
more reqularly than one would think!  The results can be highly variable
and 'train' wrecks aren't funny at all to me, especially with important
cargo aboard ...

    All humorous wording, of course, but most should see the parallel ..

TAME does, to my experience, help stabilize systems that use WIN 3.1
apps for communications purposes...

    Maybe it's just me ... :)

//-----------------------------
Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            28-Aug-99 00:02:29
  To: All                                               28-Aug-99 03:31:24
Subj: Re: Detection

From: mike.luther@ziplog.com

In <Jgyx3.3530$J72.749097@news.itd.umich.edu>, cmhall@umich.edu (Chris Hall)
writes:
>In <7q63uc$fhs@newsops.execpc.com>, Cliff Fellows <cfellows@execpc.com>
writes:
>>Each time I boot up I have to <Alt-F1> and then <F5> to get the OS to
>>see/use my sound card, and NOT have a UART 65500(?) conflict. I recently
>>installed a socket 7 mother board which supports PnP. If I disable PnP
>>then my OS (Warp 4 - Fixpak 11) won't find the sound card at all. When I
>>enable the hardware sniffer all works fine. Don't like the loooooong
>>bootup time, though.
>>What am I over looking?
>>Thanks, in advance for some pointers.
>>
>>Cliff
>>Menomonee Falls, WI
>>
>Cliff:
>
>If you want full hardware detection on each boot, go to OS/2 System,
>Setup. Open the Hardware Managers Properties notebook. First page
>has the hardware detection level. You can choose none, once or full
>(on each boot), I believe. Sounds like you need full detection turned on.
>
>Chris Hall  (cmhall@umich.edu)
>Dept. of Geological Sciences, U. of Michigan
>"They use Microsoft Excel to plot their data. Sometimes they get the results
>they expect, sometimes they don't."   from Microsoft TV commercial, 1999.
>

Look for an IRQ conflict, port conflict or DMA conflict between your
sound card and what all else is going on...

Whil'st you are looking at that HARDWARE report from the detection
program in your SETUP folder, check carefully for your Network Interface
Card (NIC) data.  I think you will find it may be missing from the report!

If so, check very carefully for a conflict between the NIC IRQ and your
sound card.  Typically IRQ 5 conflicts are, apparently, easy to provoke
between these two devices, if my memory is correct...

Be also aware that you can usually force the sound card to follow some
other convention as to IRQ, port numbers needed, DMA channels, during
the CONFIG.SYS run by hard coding them into the loader line.  That van
temporarily solve the problem, but in the long run, install and setting
of things so that the conflicts aren't there, including use of any setup
program to get the sound card where you want it, have always seemed the
best solutions for my problems like this..


//-----------------------------
Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: steve53_remove_this@earthlink.net                 27-Aug-99 16:55:09
  To: All                                               28-Aug-99 03:31:25
Subj: Re: Lotus Web Site Fixed

From: steve53_remove_this@earthlink.net

In <7q710m$kf$1@news.panix.com>, on 08/27/99 
   at 09:47 PM, rcpj@panix.com (Pierre Jelenc) said:

>I did that, but what do I do next? There's no installation program and no
>instructions.

Go to the Lotus site and read the install instructions. :)

Seriously, just save copies of the old files and copy the new ones in
place.  There's one that needs to be renamed.

HTH,

Steven

--
---------------------------------------------------------------
Steven Levine <steve53removethis@earthlink.net>  MR2/ICE #10183 Warp4/FP11
---------------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: donm@ftel.net                                     28-Aug-99 00:10:24
  To: All                                               28-Aug-99 03:31:25
Subj: Re: AOL Instant Messenger for OS/2 ????

From: donm@ftel.net (Don Morse)

In message <37C5962C.E68835E9@erols.com> - Murray Weismer
<weismer@erols.com>Thu, 26 Aug 1999 15:31:56 -0400 writes:
:>
:>NEW Java version???????
:>Are you able to jump to the browser from within it?
:>
:>Tom Brown wrote:

is there a new Java version????  I'm running the olderclient here as detailed
below, but I'd love to try a newer version

********************************************************
  If a million monkeys on typewriters can eventually
       type out the Bible, given enough time.
     Then Bill Gates had 25 monkeys and a week! 
********************************************************
  dmorse@pacificnet.net using Merlin and EmTec News
    ICQ 245937, AOL IM merlinof2  www.blackpalace.com
********************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Franklin interNet http://www.franklin.net (1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 28-Aug-99 01:02:22
  To: All                                               28-Aug-99 03:31:25
Subj: Re: Lotus SmartSuite Updated to v1.1.1

From: zayne@omen.com.au (Mooo)

steve53_remove_this@earthlink.net wrote:

>In <37c56229.1743813@news.omen.net.au>, on 08/26/99 
>   at 03:51 PM, zayne@omen.com.au (Mooo) said:
>
>>There is a small list of fixes.  The main problem we have is that 123
>>still cannot print to a net printer nor print to pmfax.  As such, its
>
>Have you installed the updated FxPrint driver available at the Keller
>site?

No, I have a more recent version of the pmfax package (not the one
from the Warp CD).

Cheers,
Craig

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nothing I say is my own opinion (1:109/42)

+----------------------------------------------------------------------------+

From: judithr@primenet.com                              27-Aug-99 18:34:06
  To: All                                               28-Aug-99 03:31:25
Subj: Lotus and calendars works (html), why doesn't MSWord?

From: judithr@primenet.com

I had not used Lotus Word Pro much until I wanted to make a monthly
calendar for class assignments.  Some friends, MS users were over,
so I did one in LotusWordPro in OS/2 and they used another computer
to do one in MSWord.  I saved mine in html to export to a class web
page and it was great -- well, needed to get rid of the weekends.
Theirs produced a blaank page, a link to the calendar wizard.   They
want to know how to make an html calendar in Word.  I told them "I
didn't know." 

No, I am not requesting information on how to do this in MSWord.  I
don't care how.  They could not figure it out and I don't help
people with such problems.   So sad, Too bad. 

I would like to know if there is a way to configure Lotus to leave
off Sat. and Sun. on the calendar. 


Judith Russell       
judithr@primenet.com                    
Saugus Web Coordinator
http://www.hart.k12.ca.us/saugus


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: nospam                                            28-Aug-99 02:05:00
  To: All                                               28-Aug-99 03:31:25
Subj: Re: javaicq

From: glennth@<nospam>senet.com.au (Glenn Thompson)

On Fri, 27 Aug 1999 00:44:06, lhadley@nospam.net wrote:

-> You know, I didn't have trouble running ICQJava (once I upgraded to Java
-> 1.1.8) but aICQ won't run for me. Ideas anyone?

Don't know I haven't tried that one.
What about micq ?

Glenn.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none here ! (1:109/42)

+----------------------------------------------------------------------------+

From: horseman@ibm.net                                  28-Aug-99 05:25:25
  To: All                                               28-Aug-99 10:43:13
Subj: Re: Lotus Web Site Fixed

From: Tony Wright <horseman@ibm.net>

Buddy Donnelly wrote:

> On Fri, 27 Aug 1999 06:19:38, hamei@pacbell.net a ?crit dans un message:
>
> > In <37C620A5.48DFF44F@dgraph.com>, Kris Kadela <kris@dgraph.com> writes:
> >
> > >And to think that all they needed to do in the first place is to chage
> > >one tiny setting and "hot" restart the server and avoid such problems
> > >for ever. Heh.
> >
> > Hey, remember these guys are Professional Software Developers, unlike them
> > silly amateurs that take the easy way out :-)
> >
> > >
> > >Sander Nyman wrote:
> > >>
> > >> I am fairly certain that anyone needing the Lotus Smart Suite update to
> > >> v1.1.1 has already downloaded it from Hobbes.  However, for anyone
still
> > >> interested in downloading direct from Lotus, and as a general follow
up, I
> > >> received the following from Lotus today:
> > >>
> > >> Dear Sander Nyman,
> > >>
> > >> Our Web team has broken up the file in question into four segments to
> > >> avoid timeout problems.  Here is the direct link to the file:
> > >>
http://www.support.lotus.com/sims2/sims_or2.nsf/430bb6168e25dd69852566430080b76
7/c980c1bf48fa57fa852567af00646c04
>
> I'm sorry but that URL is flat ridiculous,

"flat" ? - This is a Notes server so don't you mean "heretical" if you can't
spell hierarchical? <g>

> especially, ESPECIALLY if it
> resulted from someone human looking at the file and fixing it.

Lotus = IBM = human = engage brain and put it on their ftp server(with resume) 
instead of, or additionally to?

> Good luck,
>
> Buddy
>
> Buddy Donnelly
> donnelly@tampabay.rr.com



--
Rgds Tony W   Email: horseman@ibm.net

"humanum est errare: To err is human
.... and to fail is to be a Project Manager...
...but to foul things up completely needs a computer!"




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Equi-Tek CompCon (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           28-Aug-99 01:18:03
  To: All                                               28-Aug-99 10:43:13
Subj: Re: 4-digit year in 'dir' list??

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <37C6D0C1.D0F3A350@nospam.com>, on 08/27/99 at 12:54 PM,
   Jim Lewis <jklewis@nospam.com> said:


>  It's almost done already, are there any beta testers out there? All you

I'd be glad to beta test your utility. I hope you figure out how to show
the EA's.

BTW, I am sending this via the newsgroup as well as to the address you
show below. I am waiting to find out if there really is a nospam.com.


--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: fuzzies@ibm.net                                   28-Aug-99 08:01:27
  To: All                                               28-Aug-99 10:43:13
Subj: PMMail and incorrect characters - fix??

From: fuzzies@ibm.net (T. Bartlett)

Running Warp 4, fixpack 9 and PMMail 1.9 characters such as $, ', " and  do
not dispay correctly. Codepage is set in the config.sys as CODEPAGE=850,437.

Any advice on how to fix this appreciated.

Ted


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: mail@ridax.se                                     28-Aug-99 08:31:27
  To: All                                               28-Aug-99 10:43:13
Subj: Re: REMOTE CONTROL PRODUCTS

From: mail@ridax.se (Mikael Wahlgren)

:>I'm looking for any recommendations for remote control products for OS/2
Warp V4.  

Our company have a product called PM2You that will allow you to remote control
OS/2 from another OS/2 or Windows machine, or even from an ordinary browser
with Java using any kind of operating system.  It can work over TCP/IP,
dial-up modem, NetBIOS, SPX, APPC, ISDN, X.25, Named Pipes and some other
protocols.

If you are interested, you are welcome to contact me or download from our home
page.


Mikael Wahlgren - mail@ridax.se
Ridax programutveckling - PM2You/OS2You Remote Control for OS/2
FTP 194.52.57.138 - http://welcome.to/ridax
WIN2You - Remote Control for Windows 95/NT

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ridax programutveckling (1:109/42)

+----------------------------------------------------------------------------+

From: ivan@protein.bio.msu.su                           28-Aug-99 13:02:09
  To: All                                               28-Aug-99 10:43:13
Subj: Re: REMOTE CONTROL PRODUCTS

From: "Ivan Adzhubei" <ivan@protein.bio.msu.su>

In <%7Nx3.2915$fi.5116@nntpserver.swip.net>, on 08/28/99 
   at 08:31 AM, mail@ridax.se (Mikael Wahlgren) said:

>Our company have a product called PM2You that will allow you to remote
>control OS/2 from another OS/2 or Windows machine, or even from an
>ordinary browser with Java using any kind of operating system.  It can
>work over TCP/IP, dial-up modem, NetBIOS, SPX, APPC, ISDN, X.25, Named
>Pipes and some other protocols.

>If you are interested, you are welcome to contact me or download from
>our home page.

Wow, nice to see you are still alive! It's so common these days to see
OS/2 products dropped and ISV's disappearing...

Mikael, could you please answer a couple of my questions for which I
found no answers at your site?

1) Does PM2You/OS2You work across a firewall, e.g., could I control my
server from a remote workstation which is on an intranet (192.168.x.x)
address connected to the outside world via Linux NAT (IP masquerading)
server? Firewall is open, no restrictions on ports, used only for NAT.

2) Does it works with Aurora (OS/2 WSeb)? I tried a similar product
(NetOp) and it traps my system. Did you test PM2You with OS/2 v.4.5 Rev.
14_039F (TCP/IP 4.2)? Does it SMP-safe under WSeb?

I am using WSeb (DevCon release) for development on my workstation at
home, but still have my OS/2 servers running under Warp 4 or WS 4
Advanced at work. Will migrate them all to WSeb as soon as I'll find
funds to buy enough production licenses :-).

Thank you in advance.

Cheers,
Ivan

-- 
-----------------------------------------------------------
"Ivan Adzhubei" <ivan@protein.bio.msu.su>
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Moscow State University (1:109/42)

+----------------------------------------------------------------------------+

From: mcbrides@erols.com                                28-Aug-99 02:32:01
  To: All                                               28-Aug-99 10:43:13
Subj: Re: 4-digit year in 'dir' list??

From: mcbrides@erols.com (Jerry McBride)

In article <37C6A580.9A360C36@nospam.com>,
Jim Lewis <jklewis@nospam.com> wrote:
>Stefan A. Deutscher wrote:
>
>> On Fri, 27 Aug 1999 01:35:22 GMT, John Thompson
>> <nospam@savebandwidth.invalid> wrote:
>> >In <37C5A4F0.3924@ibm.net>, Wm D Loughman <wdlkhl@ibm.net> writes:
>> >
>> >>After changing from FAT partions to HPFS partions, I re-installed
>> >>Warp-4, FP-9.  My 'dir' listings show (only) 2-digit years.  Am I
>> >>imagining, that before this I had a 4-digit year in my 'dir'
>> >>listings?? If this isn't pure invention on my part, how do I get back
>> >>to 4-digit years?
>> >
>> >I've never seen 4-digit years displayed in a commnd-line directory
>> >listing.  Perhaps you're thinking of the folder "Details view" which
>> >does show a 4-digit year.
>>
>> And boy would I wish they'd add a switch to show full time (4 digit
>> year), as well as last access and creation times also from the command
>> line!  I know it can be done with REXX and what not, but that's not the
>> same thing as
>>
>>  dir /show_me_all_you_know_about_these_files
>>
>> would be.
>>
> I have thought about writing a C program to do just that a few times. It
>would work almost just like dir, except would not have the /s (subdirectory)
>option. In fact, to save time it won't have any options, but it will show
>the data as you requested including creation times/dates, 4-digit year,
>etc.  My file finder (available below) already shows a 4-digit year.
>
> How many other people would use this if I make it available? Freeware of
>course.
>

A most welcomed offer. But... no sort option? :')


--

*******************************************************************************

*            Sometimes, the BEST things in life really ARE free...           
*
*       Get a FREE copy of NetRexx 1.150 for your next java project at:      
*
*                     http://www2.hursley.ibm.com/netrexx                    
*
*******************************************************************************


/----------------------------------------\
| From the desktop of: Jerome D. McBride |
|         mcbrides@erols.com             |
\----------------------------------------/

--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TEAM-NETREXX (1:109/42)

+----------------------------------------------------------------------------+

From: ralbers@dccnet.com                                28-Aug-99 10:30:10
  To: All                                               28-Aug-99 10:43:13
Subj: Re: Looking for flow chart program.

From: ralbers@dccnet.com

There was a flow charting program back in the early days of OS/2, but 
they no longer sell it - I believe.  Remember seeing it in an old OS/2
magazine - (paper, yes a paper OS/2 mag!), but can not remember the 
name, or who sold it.

Lotus smartsuite has an organizational chart, but not good for 
flowcharting, though it does have most of the flow charting symbols. -
Freelance that is!

VisPro Rexx comes with a great little sample program that is an ER 
app, and works quite well, though do you really want to purchase 
VisPro just for this app? - Actually yes would be my answer, what a 
bonus - a gui rexx developer as a bonus!

I have looked for flowcharting apps before, and we are lacking 
seriously in this area!  Programmers, take note - there might be a 
business opportunity here?


On Fri, 27 Aug 1999 13:47:42, Dave Critelli <DCritel@ibm.net> wrote:

> Hello:
> 
> I'm looking for an application to generate flow charts.  Suggestions
> please.
> 
> Thanks you
> Dave
> 
> 
> 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@null                                       28-Aug-99 10:35:28
  To: All                                               28-Aug-99 10:43:13
Subj: Re: RSJ Problem

From: nospam@null (Richard A Crane)

On Fri, 27 Aug 1999 00:17:52, ames@deltrak.demon.co.uk (Andrew Stephenson) 
wrote:


> THE PROCEDURE:
> 
> 1) Ensure the disk is in the drive properly.
> 
> 2) Open an OS/2 command line session and give the command
> 	trackcpy
>    NB: Like "trackcopy" but without an 'o'.
> 
> 3) When the '>' prompt appears, give the command
> 	blank cdr: 0
> 
> 4) Wait.  Apparently the time required varies with the type of
>    drive.  For Yamahas, it takes about as long as the original
>    recording (plus finalisation) took.  So go brew up a cup of
>    something legal and let the machine do its thing.
> 
> 5) When it has finished and the next '>' prompt appears, give
>    the command
> 	quit
> 
> And that's it.  The disk should now attach in the usual way.
> 
 Could I suggest "trackcpy && blank cdr:0 && quit"

A slightly shorter version (you don't have to check for it in the middle it
just
all runs)
Richard A Crane ph 08 8945 3252 fx 08 8945 5952
Check Copyright of this with the author you may suffer litigation or 
embarrassment.

ps Foolproof is not good enough ..... we're not dealing with fools

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      28-Aug-99 00:47:05
  To: All                                               28-Aug-99 10:43:13
Subj: Re: RealPlayer for OS/2

From: nospam@savebandwidth.invalid     (John Thompson)

In <7q706k$h3o$1@nntp.ucs.ubc.ca>, isaacl@bulls.ece.ubc.ca (e-frog) writes:

>The point is, the RealAudio server is useless if nobody listens to
>RealAudio. If I were at RealNetworks, I'd cover my ass, and do (even an
>unsupported) a version for Linux and OS/2 and whatever platform is out
>there with decent number of seats. 

Well, they already have a client for linux.  IIRC, it's still 
beta but sems to work well enough.

-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               28-Aug-99 15:25:27
  To: All                                               28-Aug-99 14:21:24
Subj: Re: Looking for flow chart program.

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Esther Schindler schrieb:
> Is it a charting application, Christian, or a flowcharting
> application?

Uh, well I don't know. I just saw my friend create parts of what he
needed very fast.
 
> With a flowcharting application, you add the items and define the
> relationships between them, and when you add a new item, the page
> automatically reflows the presentation. It's very slick, very useful,
> and -- to some people -- very necessary.

Hm, sounds like Visio I once saw running under Windows 3.1. Then I guess
there's no way but using Win-OS/2.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             28-Aug-99 06:59:15
  To: All                                               28-Aug-99 14:21:24
Subj: Re: mSQL ported to OS/2?

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On 27 Aug 1999 16:57:17 GMT, Jonesy wrote:

>> Allen Cogbill wrote:
>>> 
>>> Subject says it all.

Check WarpCast. A new release of mSQL for OS/2 was just announced
there.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: raphaelt@netnews.worldnet.att.net                 27-Aug-99 12:23:21
  To: All                                               28-Aug-99 16:46:26
Subj: Re: [Q] 128 bit Netscape fixpack

From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum)

"Bradley G. Smith" <bgsmith/r6pnw_deschutes@fs.fed.xxus> wrote:

>I have installed the 128-bit fixpack for Netscape on 2 PCs. In both cases,
>the progress bar for updating the files (not preprocessing and not backup)
>goes by very quickly. And the date/time stamps and sizes for the "updated"
>files do not change. Has anyone else experienced this?
>
>If I run the fixpack again I think the new syslevel file is detected and
>nothing is done as far as modifying files.
>
>Is there a work around? Or am I wrong in thinking that the fixed files should
>have revised date and time stamps and changed sizes?

No, they should have at least changed timestamps and dates. 
Eg:

8-03-99  8:37p     3,710,941      0 a---  NETSCAPE.EXE

and 

8-03-99  8:33p        28,560     61 a---  NSREG.DLL
8-03-99  8:21p       213,659     61 a---  OS23240.DLL

My SYSLEVEL gives ID 5697B8601, XR01404/ previous XR00404.

-Ray

-- 
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: raphaelt@netnews.worldnet.att.net                 28-Aug-99 10:09:27
  To: All                                               28-Aug-99 16:46:26
Subj: Re: Can OS/2 users grow up and think like Linux users?

From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum)

Peter.Weilbacher@T-Online.de wrote:

>On Sat, 22 Jan 2000 14:33:19, raphaelt@netnews.worldnet.att.net (Raphael
>Tennenbaum) wrote:

(coming to you from the future, you'll note)

>> Uh huh.  1) Uninstall OD, which is probably 95% of what's
>> kerflooey on your system.  Replace with freeware Xfolder.
>> 2) Apply the latest fix for Netscape 4.04.  3) Reinstall
>> your video drivers, especially if there's newer ones
>> available for your card.  4) Clean up your INI files with
>> Henk Kelder's wptools.
>
>As I recently wrote in another thread, its not that simple. I have
>made all these steps a long time ago, but the WPS is often locking
>itself, meaning that one folder does not respond. You can press 
>CTRL-ESC and some other combinations and a window comes up. 
>There you can press ENTER, but nothing happens. All this especially
>happens to me, when I have no other programs running besides 
>Sysbar/2 Clock and Task Switcher. There is no way for me to restart
>the WPS in these cases.

When my system gets like this I try to root things out --
eg, I just dumped, I'm sorry to say, Goran Ivankovic's nice
worldclock program because I suspected it of a mem. leak
(not to slander this neat prog, but around here rogue
programs are guilty until proven innocent).  I'm not
defending the opsys itself, given its strengths it
absolutely ought to contend better with rogue apps than it
does, but a lot of my work involves heavy NS stuff, and for
me it hangs very very seldom.  I suspect there are issues
with Java (many of the old hangs I'd get seemed to point to
the Java Console) and NS.  For me the latest NS refresh has
eliminated the worst thing -- the horrid file download bug
and the system-freezeup-after-exiting-NS4.04; sometimes NS
will blow up but now it doesn't take anything with it.  Also
I'm on Java 1.1.7.  Fwiw.  

-- 
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: mail@ridax.se                                     28-Aug-99 15:43:22
  To: All                                               28-Aug-99 16:46:26
Subj: Re: REMOTE CONTROL PRODUCTS

From: mail@ridax.se (Mikael Wahlgren)

:>1) Does PM2You/OS2You work across a firewall, e.g., could I control my
:>server from a remote workstation which is on an intranet (192.168.x.x)
:>address connected to the outside world via Linux NAT (IP masquerading)
:>server? Firewall is open, no restrictions on ports, used only for NAT.

If the firewall allows you to establish socket connections on the configure
port, it will work OK.  If the client (terminal) is behind a proxy/firewall,
you can still come out using the Browser/Java client.  We are currently
considering a solution that allows you to access a host that is behind a
firewall as well.

:>2) Does it works with Aurora (OS/2 WSeb)? I tried a similar product
:>(NetOp) and it traps my system. Did you test PM2You with OS/2 v.4.5 Rev.
:>14_039F (TCP/IP 4.2)? Does it SMP-safe under WSeb?

The current release of PM2You/OS2You does have some problems with OS/2 Warp
Server for eBusiness when it is installed on a JFS partition.  We have
developed some fixes for this problem, that you can get from us on request, in
case you need them.  However, we hope IBM will fix the problem with JFS.


Mikael Wahlgren - mail@ridax.se
Ridax programutveckling - PM2You/OS2You Remote Control for OS/2
FTP 194.52.57.138 - http://welcome.to/ridax
WIN2You - Remote Control for Windows 95/NT

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ridax programutveckling (1:109/42)

+----------------------------------------------------------------------------+

From: dpalmer@olywa.net                                 28-Aug-99 15:59:28
  To: All                                               28-Aug-99 16:46:26
Subj: Lotues 123G null values question

From: dpalmer@olywa.net

This is a question about ancient software...
Looking for help with old Lotus 123G (OS/2 version)
I've a need to graph medical test results - I've over 100 weeks of data.
Not every test is run every week - the tests therefore have null values.

When importing to 123G as a comma separated ascii file it ignores the nulls 
and shifts following fields to the left.

When importing to 123G with a value of 0 in place of null the data imports
but the graph lines bounce to zero for all the null test weeks.  Setting up
123G with Zeros as blanks works for the spreadsheet but the Graph still
graphs 0 values.

Has anyone written a macro to change spreadsheets 0's to actual nulls?
What else might work?
Thanks in advance,
Dave Palmer

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Giganews.Com - Premium News Outsourcing (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@sancoatjpsdotnet.void                      28-Aug-99 10:54:04
  To: All                                               28-Aug-99 21:13:09
Subj: Re: Lotus SmartSuite Updated to v1.1.1

From: nospam@sancoatjpsdotnet.void (Sander Nyman)

In <37c56229.1743813@news.omen.net.au>, on 08/26/99 
   at 03:51 PM, zayne@omen.com.au (Mooo) said:

>rjf@yyycomasia.com (rj friedman) wrote:

>>Does anyone have any idea of what, exactly, does it fix? Is 
>>it worth the dl?

>There is a small list of fixes.  The main problem we have is that 123
>still cannot print to a net printer nor print to pmfax.  As such, its
>useless and the whole thing got plonked back on the shelf in favour of
>Staroffice 5.1 which does work.

The not so small list of fixes has nothing to do with your problem.  The
problem with printing to PM Fax was at Keller's end, and the fix has been
available on their site for ages.  Lotus 123 works great here, and is a
daily workhorse in the running of my business.

Sander Nyman

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@sancoatjpsdotnet.void                      28-Aug-99 11:02:03
  To: All                                               28-Aug-99 21:13:09
Subj: Re: Lotus Web Site Fixed

From: nospam@sancoatjpsdotnet.void (Sander Nyman)

On 08/27/99 at 09:47 PM, rcpj@panix.com (Pierre Jelenc) said:

>Sander Nyman <nospam@sancoatjpsdotnet.void> writes:
>> I am fairly certain that anyone needing the Lotus Smart Suite update to
>> v1.1.1 has already downloaded it from Hobbes.  

>I did that, but what do I do next? There's no installation program and no
>instructions.

Pierre, the instructions are located on the Lotus web page.  

http://www.support.lotus.com/sims2/sims_or2.nsf/430bb6168e25dd69852566430080b76
7/c980c1bf48fa57fa852567af00646c04

Basically, it's as simple as renaming the old files in their respective
folders, and copying the new files over.  

Sander Nyman

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: evert.haaksma@inter.NL.net                        28-Aug-99 20:18:09
  To: All                                               28-Aug-99 21:13:09
Subj: XFree86 starting problem

From: Evert Haaksma <evert.haaksma@inter.NL.net>

Besides using OS/2, I sometimes fiddle around with Linux.
So I decided to try XFree86 for OS/2.
I installed it following the instructions.
But now, when I enter the command "startx" on a command line, things are
not going as I hoped.
The greyish background and the black cross-pointer appear as I know them
from Linux.
The pointer responds to the mouse as well.
So I guess X is started all right.
But then, instead of starting a window manager, I am returned to the
OS/2-prompt.
No messages appear, so I have no clue as where to look for.

Does anyone know what can cause this problem?

Grtz,
Evert Haaksma (evert.haaksma@inter.NL.net)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET-NL (http://www.nl.uu.net) (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    28-Aug-99 18:22:03
  To: All                                               28-Aug-99 21:13:09
Subj: Re: Lotus Web Site Fixed

From: rcpj@panix.com (Pierre Jelenc)

Sander Nyman <nospam@sancoatjpsdotnet.void> writes:
> 
> Pierre, the instructions are located on the Lotus web page.  
> 
>
http://www.support.lotus.com/sims2/sims_or2.nsf/430bb6168e25dd69852566430080b76
7/c980c1bf48fa57fa852567af00646c04

It says to check the version number, but when I do I get no version
number, just a copyright and (my correct) registration notice, except for
WordPro which says Release 097.1944.0

What do I have?

(I just moved, and the distribution CD is ...er, somewhere...)

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: your.user.name@your.host.name                     28-Aug-99 18:25:18
  To: All                                               28-Aug-99 21:13:09
Subj: Re: 4-digit year in 'dir' list??

From: your.user.name@your.host.name ()

In article <37C6D0C1.D0F3A350@nospam.com>, Jim Lewis wrote:
>Stan Goodman wrote:
>
>> There are probably a lot of people around that can't remember what century
>> this is, and that would therefore find the program useful.
>>
>
>  Even worse are the people who blindly think that the files they currently
have
>today all have a century number of 19.  The dir command only shows the last 2
>digits regardless of the century and this has caused quite a few problems in
Y2K
>testing. That was the main reason I modified my file finder to display a
4-digit
>year and is why I'm writing this other program now.
>
> It's almost done already, are there any beta testers out there?

	Yes, I'll give it a whirl.  Lotsa whirls.  Please.

>                                                                              
          All you have to
>do is put it on your path and run it. It will not do anything to your INI
files
>or to config.sys, etc. So far it shows filename, size, creation date/time,
and
>last update. I plan to add the file attributes, and the size of the EAs if
any
>(when I figure out how to do that).
>
>
>--
>
>Jim Lewis
>Not speaking for IBM.
>Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis
>
>
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: veit@borneo.gmd.de                                28-Aug-99 18:25:29
  To: All                                               28-Aug-99 21:13:09
Subj: Re: XFree86 starting problem

From: veit@borneo.gmd.de (Holger Veit)

On Sat, 28 Aug 1999 20:18:18 +0200, 
	Evert Haaksma <evert.haaksma@inter.NL.net> wrote:
>Besides using OS/2, I sometimes fiddle around with Linux.
>So I decided to try XFree86 for OS/2.
>I installed it following the instructions.
>But now, when I enter the command "startx" on a command line, things are
>not going as I hoped.
>The greyish background and the black cross-pointer appear as I know them
>from Linux.
>The pointer responds to the mouse as well.
>So I guess X is started all right.
>But then, instead of starting a window manager, I am returned to the
>OS/2-prompt.
>No messages appear, so I have no clue as where to look for.
>
>Does anyone know what can cause this problem?

Read the XFree86/OS2 FAQ. Verify that you really have the window manager
that is listed in XFree86/lib/xinit/xinitrc.cmd (typically twm or icewm).
Verify that PATH and LIBPATH are correct. Check the output of POPUPLOG.OS2
and the output of the error log you can get with the methods described in
the FAQ. Ensure that your OS2_SHELL and SHELL and X11SHELL is correct.

Holger

-- 
Signature fault - code dumbed

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: GMD-AiS (1:109/42)

+----------------------------------------------------------------------------+

From: rdegenna@utk.edu                                  28-Aug-99 18:31:14
  To: All                                               28-Aug-99 21:13:09
Subj: No desktop!

From: rdegenna@utk.edu

My son's 486, dedicated to games, had a disk crash.  OS/2 4.0 fix 10 is on an 
ide drive C:.  The scsi drive, D:, is the one that crashed.  I had most of the 

stuff backed up, and it was just games anyway, so that isn't a problem (a 
low-level format seems to have fixed the drive, too).

So, just restore to D: and be on my way, right?  Not so: The system can no 
longer find my desktop (It creates a temporary one.)

I have NINE backups of my desktop: three Unimaint, three Deskman, and three 
by OS/2.  NONE of those nine can find a working desktop.  Only once (the 
newest Unimaint) did I get a desktop other than a temporary one, and that 
failed again almost immediately.  And now, that same Unimaint backup can no 
longer produce a working desktop.

Short of a complete reinstall of OS/2, what can I do?

Thanks,

Ray DeGennaro

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Tennessee (1:109/42)

+----------------------------------------------------------------------------+

From: fBeythien@gmx.de                                  28-Aug-99 18:00:06
  To: All                                               28-Aug-99 21:13:09
Subj: Re: PMMail and incorrect characters - fix??

From: fBeythien@gmx.de (Frank Beythien)

On Sat, 28 Aug 1999 08:01:54, fuzzies@ibm.net (T. Bartlett) wrote:

> Running Warp 4, fixpack 9 and PMMail 1.9 characters such as $, ', " and ? do
> not dispay correctly. Codepage is set in the config.sys as CODEPAGE=850,437.
> 
> Any advice on how to fix this appreciated.

What is your pmmail->settings->general->default character set ?
You could try iso 8859-1 (latin-1)
or upgrade to Pmmail 1.96a, or even PMMail/2. 

CU/2
-- 
Frank Beythien   fBeythien@gmx.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Prima e.V. - Dortmund - Germany (1:109/42)

+----------------------------------------------------------------------------+

From: ispy@groovyshow.com                               28-Aug-99 13:39:07
  To: All                                               28-Aug-99 21:13:09
Subj: Re: Warp4-and-HPFS386

From: "Kelly Robinson" <ispy@groovyshow.com>

Man, you OS/2 people are so loyal and faithful and not above the law...



Anonymous <nobody@neuropa.net> wrote in message
news:199908252134.VAA27684@berlin.neuropa.net...
> This hpfs386 is dated 06/11/99 and is the latest release.
> if you're just using hpfs.ifs,  you can improve your system
> performance with the hpfs386 driver.
>
> The hpfs386 is 32bit and can have any cache size you
> want, plus its about 4x faster at writing and a bit
> faster at reading.  It will improve the speed of your
> system.
>
> Microsoft owns the "rights" (but IBM writes and has
> improved the code considerably).  MS charges IBM $600
> for each copy of HPFS386 that gets distributed with
> Warp Server.  You may thank Microsoft by passing this
> hpfs386.zip file around to your other OS/2 friends HPFS386.
>
> Instructions for installing are inside the hpfs386 zip file.
>
> It is easy to do.  You just create a subdirectory (follow
> the instructions for the name of the subdirectory) and
> copy the files inside the zip into that directory.  Then
> you adjust your config.sys file (see below) and the
> the hpfs386.ini file (again below, it is easy).
>
> The hpfs.ini file that needs the cache set.  It is currently
> set to 4096 which may be too large for you particular
> system.  I have 64 megs of ram and I didn't change the
> ini file so when I rebooted my desktop came up but
> it sort of froze.  So I changed the hpfs.ini file over to
> 1024, rebooted and presto! Everything worked beautifully.
> The ini file is a text file so you don't need a special ini
> editor to change it.  The instructions are inside the ini
> file itself in case you get lost.
>
> Another note: you'll need to update your config.sys.
> That information is also found in the hpfs386.zip file
> in the readme instructions.  The entries are easy to
> add.  They can be included at the end of your path
> statements and you can literally mark/copy/paste
> the entry from the instruction file directly into your
> config.sys paths.  Make sure you make those entries
> in your config.sys before you reboot your system so
> your system knows what driver to use and where to
> find it.
>
> You'll know it worked when you reboot and a single
> statement across your screen says the hpfs386 driver
> was found.
>
>


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://extra.newsguy.com (1:109/42)

+----------------------------------------------------------------------------+

From: DAMNSPAM.ks@karicobs.com                          28-Aug-99 19:50:09
  To: All                                               28-Aug-99 21:13:09
Subj: No desktop!

From: DAMNSPAM.ks@karicobs.com (Kari Suomela)

Saturday August 28 1999 18:31, rdegenna@utk.edu wrote to All:

 r> I had most of the stuff backed up, and it was just games anyway, so
 r> that isn't a problem (a low-level format seems to have fixed the
 r> drive, too).

Low level? Maybe you changed the drive parameters?

 r> Short of a complete reinstall of OS/2, what can I do?

Not much. :(

 KS


... Do something unusual today.  Accomplish work on the computer.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bbs.karicobs.com - Toronto, Canada (1:109/42)

+----------------------------------------------------------------------------+

From: dunmunro@direct.ca                                28-Aug-99 20:26:24
  To: All                                               29-Aug-99 05:35:21
Subj: Netscape and two Inet providers

From: dunmunro@direct.ca (Duncan Munro)

I an using Comm4.04 and I need to recieve my mail with one Internet
provider and send it through another provider.  Mu username and
password are different with each. Is there a way to do this?

TIA

Duncan

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: tholen@ifa.hawaii.edu                             28-Aug-99 20:29:11
  To: All                                               29-Aug-99 05:35:21
Subj: Re: Warp4-and-HPFS386

From: tholen@ifa.hawaii.edu

Kelly Robinson writes:

> Man, you OS/2 people are so loyal and faithful and not above the law...

On what basis do you apply your accusation to "you OS/2 people"?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IFA B111 (1:109/42)

+----------------------------------------------------------------------------+

From: pNoOrStPiAgM@ibm.net                              28-Aug-99 21:09:17
  To: All                                               29-Aug-99 05:35:21
Subj: Re: No desktop!

From: pNoOrStPiAgM@ibm.net (Harald Portig)

Ray,

I wouldn't be surprised if your disk is still the source of the 
problem.  I have had situations before when the system acted strangely
and illogical and then replacing the hard drive was the solution.

Good luck, Harald Portig
Remove the letters NOSPAM from my address to reply.

On Sat, 28 Aug 1999 18:31:29, rdegenna@utk.edu wrote:

> NONE of those nine can find a working desktop.  Only once (the 
> newest Unimaint) did I get a desktop other than a temporary one, and that 
> failed again almost immediately.  And now, that same Unimaint backup can no 
> longer produce a working desktop.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   28-Aug-99 15:11:12
  To: All                                               29-Aug-99 05:35:21
Subj: Re: Netscape and two Inet providers

From: Kris Kadela <kris@dgraph.com>

Hmm, in 4.61 you can specifu seperate POP and SMTP servers. Don't
remember how it was in 4.04 but even 2.02 lets you do that.

Duncan Munro wrote:
> 
> I an using Comm4.04 and I need to recieve my mail with one Internet
> provider and send it through another provider.  Mu username and
> password are different with each. Is there a way to do this?
> 
> TIA
> 
> Duncan

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: news@fenrir.demon.co.uk                           28-Aug-99 08:07:11
  To: All                                               29-Aug-99 05:35:21
Subj: Re: OS2 & Lexmark

From: "Brian Morrison" <news@fenrir.demon.co.uk>

On 27 Aug 1999 12:03:39 GMT, Stefan A. Deutscher wrote:
>
>Okay, so where does one find the latest parallel.pdr? Will it be in Warp
>4 fp11, or in the device driver fp 1, or where?
>

You must use the one that comes with the bidi distribution, the recent
parallel.pdr file in the fix packs is an updated 'standard' non
bidi-aware version.

Bidi.exe can be had at DDPak, under Device Solutions.


-- 
Brian Morrison                                       news@fenrir.demon.co.uk

               to reply, change address from 'news' to 'bdm'

 ...Grim faced, cold as fishwife's fingers, he snatched from the wall
 the sickle-sharp boar tusks he used for defacing Readers' Digest....


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Fool and Bladder Face-Jumping Team (1:109/42)

+----------------------------------------------------------------------------+

From: news@fenrir.demon.co.uk                           28-Aug-99 08:08:14
  To: All                                               29-Aug-99 05:35:21
Subj: Re: OS2 & Lexmark

From: "Brian Morrison" <news@fenrir.demon.co.uk>

On Fri, 27 Aug 1999 16:09:06 GMT, Joe Ricci wrote:

>Bidi Driver locked up my machine with Fixpack 10,
>
>I suspect that you are correct about bidi compatability being broken
>

So, put back the parallel.pdr from the bidi distibution then!


-- 
Brian Morrison                                       news@fenrir.demon.co.uk

               to reply, change address from 'news' to 'bdm'

 ...Grim faced, cold as fishwife's fingers, he snatched from the wall
 the sickle-sharp boar tusks he used for defacing Readers' Digest....


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Fool and Bladder Face-Jumping Team (1:109/42)

+----------------------------------------------------------------------------+

From: lhadley@nospam.net                                28-Aug-99 22:30:07
  To: All                                               29-Aug-99 05:35:21
Subj: StarOffice and Java 1.1.8

From: lhadley@nospam.net

Has anyone got Java to work with Star Office?

I've enabled it in the appropriate places, but it keeps saying "Java
installation not found"

I've listed the \Java11 and \Java11\NS directories as class paths.

Any suggestions?

[Warp3 , fp40]


-- DLH  AIM id "SirKrustin"      In order of preference
  lhadley1@home.net, lhadley@peterboro.net

  homepage:  http://sirkrustin-online.iwarp.com    
== Last updated 8/28/1999 =======================================

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Work Internet powered by @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: rcpj@panix.com                                    28-Aug-99 22:52:25
  To: All                                               29-Aug-99 10:42:24
Subj: Re: No desktop!

From: rcpj@panix.com (Pierre Jelenc)

 <rdegenna@utk.edu> writes:
> My son's 486, dedicated to games, had a disk crash.  OS/2 4.0 fix 10 is on
an 
> ide drive C:.  The scsi drive, D:, is the one that crashed.  I had most of
the 
> stuff backed up, and it was just games anyway, so that isn't a problem (a 
> low-level format seems to have fixed the drive, too).
> 
> So, just restore to D: and be on my way, right?  Not so: The system can no 
> longer find my desktop (It creates a temporary one.)

Do you have a C:\DESKTOP directory? If so, add in your config.sys the line 

DESKTOP=C:\DESKTOP

and reboot.

If it's the desktop you had lost, it means that it has lost its ID and you
can fix it with a short Rexx program:

                     

=================cut here=========================================
/* DESKTOP.CMD from Rick Walsh */
                     
call RxFuncAdd 'SysLoadFuncs', 'RexxUtil', 'SysLoadFuncs'
call SysLoadFuncs
                     
if SysSetObjectData("C:\DESKTOP","OBJECTID=<WP_DESKTOP>") then
say "Success"
else
say "Failure"

=================cut here=========================================

Pierre
-- 
Pierre Jelenc                  | The Cucumbers' "Total Vegetility" is out!
                               |  Pawnshop's "Three Brass Balls" is out!
The New York City Beer Guide   |      RAW Kinder's "CD EP" is out!
   http://www.nycbeer.org      | Home Office Records http://www.web-ho.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Public Access Networks Corp. (1:109/42)

+----------------------------------------------------------------------------+

From: jknott@ibm.net                                    28-Aug-99 18:53:14
  To: All                                               29-Aug-99 10:42:25
Subj: Re: 4-digit year in 'dir' list??

From: jknott@ibm.net (James Knott)

In article <slrn7sd3c4.n7c.stefand@ferrari.lcam.u-psud.fr>,
stefand@lcam.u-psud.fr (Stefan A. Deutscher) wrote:

>And boy would I wish they'd add a switch to show full time (4 digit
>year), as well as last access and creation times also from the command
>line!  I know it can be done with REXX and what not, but that's not the
>same thing as
>
> dir /show_me_all_you_know_about_these_files
>
>would be.

Or

dir 
/show_me_all_you_know_about_these_files_but_not_the_stuff_I_don't_care
_about  ;-)



-- 
E-mail jknott@ca.ibm.com
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            28-Aug-99 17:12:03
  To: All                                               29-Aug-99 10:42:25
Subj: Re: PMMail and incorrect characters - fix??

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On 28 Aug 1999 08:01:54 GMT, T. Bartlett wrote:

>Running Warp 4, fixpack 9 and PMMail 1.9 characters such as $, ', " and   do
>not dispay correctly. Codepage is set in the config.sys as CODEPAGE=850,437.

Have you checked from your PMMail setting / Locale ,that the 
default character set is correct (ISO 8859-1 (Latin-1))? 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: steve53_remove_this@earthlink.net                 28-Aug-99 16:05:11
  To: All                                               29-Aug-99 10:42:25
Subj: Re: Lotus SmartSuite Updated to v1.1.1

From: steve53_remove_this@earthlink.net

In <37c7348d.3783811@news.omen.net.au>, on 08/28/99 
   at 01:02 AM, zayne@omen.com.au (Mooo) said:

>No, I have a more recent version of the pmfax package (not the one from
>the Warp CD).

Are you aware that there is a specific driver fix for problems with SSOS2?

Steven

--
---------------------------------------------------------------
Steven Levine <steve53removethis@earthlink.net>  MR2/ICE #10183 Warp4/FP11
---------------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               28-Aug-99 23:21:04
  To: All                                               29-Aug-99 10:42:25
Subj: Re: Looking for flow chart program.

From: esther@bitranch.com (Esther Schindler)

On Sat, 28 Aug 1999 10:30:20, ralbers@dccnet.com wrote:
| There was a flow charting program back in the early days of OS/2, but 
| they no longer sell it - I believe.  Remember seeing it in an old OS/2
| magazine - (paper, yes a paper OS/2 mag!), but can not remember the 
| name, or who sold it.

Well, having a print magazine devoted to OS/2 isn't that big of a 
deal. The Phoenix OS/2 Society publishes _extended attributes_ every 
month, after all. The past editor-in-chief is a volunteer contributer 
to _extended attributes_, as is one minor little ex-senior 
contributing editor. (You can request a free sample copy at 
http://www.possi.org.)

It's not surprising that I have the full complement of OS/2 Magazines 
across the room from me, and I do believe that I recall the same 
review to which you refer (and which I assuredly didn't write... 
meaning that Brian Proffit probably did, since we fought over the cool
stuff). OTOH, I also remember that the review said, "it stinks," so 
it's no surprise that the application is off the market. (But I'd have
to go through all of 'em to figure out whether my memory is correct, 
and that'd lose me the rest of the afternoon.)

You're quite right that this is a market opportunity, for anybody who 
wants to tackle it.

--Esther

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: littlejo@katie.vnet.net                           28-Aug-99 23:30:18
  To: All                                               29-Aug-99 10:42:25
Subj: Re: DTP for OS/2

From: Keith Littleton <littlejo@katie.vnet.net>

In message ID: <37bee49f$3$ewyncunz$mr2ice@news.infinet.com>
Jerry Lapham <rjlapham@infinet.com> wrote:
In <37bb75ea$1$fnapb$mr2ice@news.jps.net>, on 08/18/99
   at 10:56 PM, nospam@sancoatjpsdotnet.void (Sander Nyman) said:
>
>> So far, for my needs, I have not had a DTP task
>> that Lotus Word Pro could not handle well.
>
>DeScribe does a pretty  good job, too.
... signature deleted ...

>The Kansas Board of Education's vote to omit macro-evolution 
>from the list of science topics created quite a stir among 
>academics. Noting the outcry, a Chinese paleontologist, who
>reports that recent fossil finds in his country defy the 
>Darwinian evolutionary theory that major animal groups 
>evolved gradually from a common ancestor, says, "In China 
>we can criticize Darwin but not the government. In America 
>you can criticize the government but not Darwin."

Some comments about this quote:

1. This quote, which appeared a Phillip Johnson article in
the Wall Street Journal" fails to name the anonymous Chinese
paleontologist.  Thus, it fails to give any idea about the
expertise and credibility of the person making this statement.
It is not unlike, someone citing a "NASA astronaut" as having 
reported a UFO.  Surely, this paleontologist must have a name?

2. The unnamed "Chinese paleontologist" seems rather ill-
informed about the evolution controversy because Darwin or 
Darwinism is *not* the same as evolution.  The crux of the
situation is that *evolutionary theory* does not depend on
the phyletic gradualism that Darwin proposed.  The "Chinese 
paleontologist" conflates evolution, the theoretical 
foundation, with Darwinism, a specific mechanism.  That in
the 1990s, Darwinism and evolution are not the same thing
is something of which any paleontologist should be aware.

Darwin was wrong about gradualism's being the only way 
in which biological change occurs.  Biologists and other
scientists have been criticizing Darwin for the past 60 years.
Even 50 years ago, mainstream biologists, i.e. Simpson were 
publishing about "tempo and mode" and disagreeing with some
of Darwin basic ideas.  However, of these scientists 
concluded that the "sudden appearance" of new taxa was a 
supernatural event or invalidated *evolution* in any way. 
This just shows that the possibilities for organic change 
were rich and varied and that soft bodied animals, as being
talked in the Cambrian Explosion.  Darwin was also wrong and
been criticized about inheritance.  Given that American 
scientists have been criticizing Darwin for over fifty
years, the "Chinese paleontologist" obviously needs to learn
something of what he talking about.

3. The Kansas Board of Education seems to have a similar
problem in understanding evolution, in that it is Christian
scientific creationists who make the totally fictional and 
false distinction between "microevolution " and 
"macroevolution." Given that Mr. Tom Willis and 
other members of the Creation Science Association For 
Mid-America co-authored the Kansas Board of Education
Science Standards, that such creationist fiction is
included in them is not at all surprising.

4. If a person carefully reads the science standards, a 
person finds that the Kansas Board of Education indicates
in their science standards that the theories of Relativity
and Quantum Mechanics, like evolution, are just as badly
flawed as evolution.  For example, in Appendix B, they
state:

  "Example:  A theory is proposed for a new subatomic 
  particle, a quarkeron.  Proposed characteristics are 
  enumerated.  The chief proponent argues "I cannot 
  directly test my theory, but if my theory of the 
  Quarkeron is correct, I predict it would behave thusly.
  A test can be devised for this behavior.  I will turn 
  on the accelerator and look for a hit at the time and 
  place I predicted.  If particles hit the target at the 
  predicted time and place, my theory will be confirmed."  
  The widespread use of this "assertion of the consequent" 
  fallacy to "verify" atomic theories has led to a closet 
  full of theories that each "explain the behavior" of the
  atom more or less well, but the total of which few 
  physicists are very comfortable with.  A poll of 
  physicists would reveal a high percent that feel the 
  present theories of the atom, and for that matter, light,
  the electron and other sub-atomic particles, will someday 
  be overthrown by a substantially different model.  More 
  than one model has been proposed that require neither 
  of the theories of Relativity and Quantum Mechanics."

This example, from Appendix B, arrogantly claims not only 
that modern physics is in a pretty sorry state, but also 
physicists engage in sloppy reasoning closely reflects the
typical attitude of one of its co-authors, Tom Willis.  
The last sentence refers to the work of Thomas Barnes, the 
Lucases and Bergman (not Jerry, another one) at the 
Common Sense Science site.

One of the "other models" that Tom Willis and other 
coauthors of the Kansas Science Standard refer to can be 
seen at.

http://www.csama.org/199810NL.HTM#Foundation

"A New Foundation for Modern Science"

by Charles W. and Joseph C. Lucas

An ICC review by Tom Willis

... text deleted ...

   "They also argue that the present model of the atom should 
   be suspect at least to Christians because it is a random model,
   it is based on an assumption of an inherently unreal mathematical \
   point, it is logically incoherent, and it was conceived as part 
   of a philosophy intended to eliminate religion from the globe. 
   In short, they argue that there is little connection between
   the present model of the atom and a search for truth, and there
   is probably a willful anti-Christian motive behind it."

   ... text deleted ...

   "The proposed new model of the atom consists of a doughnut 
   shaped electron with a spinning charge. The electrons have 
   fixed positions about the atom. A simple diagram of the atom
   reveals how and where it will bond with other atoms to form 
   molecules.

   Does their model work? One chemist, who had worked with it 
   only a week, came to the meeting with a folder full of 
   molecules he had built using it. He told me, "I accomplished 
   more in one week with this model than I've done in 25 years 
   with Quantum Mechanics."  Is the model correct? I don't know. 
   Contact email Common Sense Science, David Bergman, at 
  102215.3233@compuserve.com.

   Proceedings of the 4th ICC may be ordered from CSA at a cost 
   of $35.00 (+ $1.50 postage)."

This book is a source from which to understand the "other 
models" that the Kansas School Board is referring to in 
Appendix B of their science standards.  These "other models" 
are a creationist physics that the Kansas Board of Education
would allowed to be taught in addition to Relativity and 
Quantum Mechanics.  It is not just evolution that is 
involved in the controversy over the Kansas School Board
science standards, but also creationist physics that they
would allowed to be taught in Kansas schools alternative 
to Relativity and Quantum Mechanics. 

5. The controversy is not about Darwin being criticized, as 
the unnamed "Chinese paleontologist" incorrectly claims.
Rather, it is about about scientific principles like 
evolution, Relativity, and Quantum Mechanics being ignored
or criticized because they are thought to be "Anti-Christian"
and criticized on the basis of fraudulent concepts, i.e.
"macroevolution" versus "microevolution," and using 
distortions and misrepresentations to argue their points.

Yours,
Keith Littleton
littlejo@vnet.net
New Orleans, LA

"The Grand Canyon was not caused by erosion but by a
volcanic eruption," Willis said. "We know that from 
Mount St. Helens." 

Tom Willis as quoted by By Erwin Seba
Journal-World Writer  Tom Willis is a co-author
and proponent of the new Kansas School Board 
science standards.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Vnet Internet Access, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            29-Aug-99 01:40:08
  To: All                                               29-Aug-99 10:42:25
Subj: Re: Smack - speedy resolution

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Thu, 26 Aug 1999 00:19:11 GMT, virobik@MAPS.onr.com wrote:

>Anyone who has to print labels on a regular (or irregular) basis under
>OS/2 should own this program. Highly recommended. 
>(www.perfectniche.com).

Sounds interesting but why isn't it available by e-mail? 
Does it include a manual?
Ordering by post just brings extra cost ( to get here in europe ).

Also some screenshots would be nice.

By the way, this site seems to be problematic to my NS4.61B2.
It just silently died three times when I was visiting the site.  


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: dunmunro@direct.ca                                29-Aug-99 00:07:02
  To: All                                               29-Aug-99 10:42:25
Subj: Re: Netscape and two Inet providers

From: dunmunro@direct.ca (Duncan Munro)

Same in 4.04, however it does not let me specify two different
usernames or passwords.

I work for a university. I want to recieve my mail through my employer
at work and at home (which I  do)  but when I am at home I want to
send it via my private ISP. the university prohibits send mailing from
off campus location except through telnet or  webmail. Both methods
are very clumsy for the volume of mail that I get.

thanks

Duncan 

On Sat, 28 Aug 1999 15:11:24 -0600, Kris Kadela <kris@dgraph.com>
wrote:

>Hmm, in 4.61 you can specifu seperate POP and SMTP servers. Don't
>remember how it was in 4.04 but even 2.02 lets you do that.
>
>Duncan Munro wrote:
>> 
>> I an using Comm4.04 and I need to recieve my mail with one Internet
>> provider and send it through another provider.  Mu username and
>> password are different with each. Is there a way to do this?
>> 
>> TIA
>> 
>> Duncan
>
>-- 
>
>**********************
>DigiGraph Technical
>http://www.dgraph.com
>**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: jaj01@earthlink.net                               28-Aug-99 19:37:08
  To: All                                               29-Aug-99 10:42:25
Subj: FIXED!!-> Can't access any HELP files!

From: "James A. Jones" <jaj01@earthlink.net>

I finally found out what was preventing OS/2 Warp 4 from accessing any
HELP or INF files. Somehow, HPMGRMRI.DLL was missing from the \OS2\DLL
directory. This is the "Help manager resource dll" that works along with
HELPMGR.DLL. I have no idea how it could have been deleted. Good thing I
had another Warp 4 system running on my other machine, or I would have
never found it. Thanks to all who offered suggestions!

P.S. If you ever want to secure a Warp 4 system to prevent users from
accessing any help files, INF files, tutorial, or Regedit2, HPMGRMRI.DLL
is the file to delete.

-- 
 ----------
"Bill Gates is a white Persian cat and a monocle away
from becoming another James Bond villain."
"No Mr Bond, I expect you to upgrade." -Dennis Miller
 ----------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: peter@pjm2.newcastle.edu.au                       29-Aug-99 01:24:21
  To: All                                               29-Aug-99 10:42:25
Subj: Re: 4-digit year in 'dir' list??

From: peter@pjm2.newcastle.edu.au (Peter Moylan)

Stan Goodman <l_luciano@da.mob> wrote:
 
>Aha! Now I understand the problem. The oldest possible files on any PC date
>from 1980, so the last two digits in a directory listing will be ambivalent
>starting from 2080. Those would be files generated under DOS, of course, 
>and OS/2 files would have a period of grace after that.

IIRC DOS and OS/2 files have exactly the same period of grace:
up to 128 years after 1980.  The API calls use a 7-bit field to
hold the year.

Meanwhile, Unix dies in 2038 or thereabouts.

-- 
Peter Moylan                         peter@ee.newcastle.edu.au
OS/2 help and software at http://eepjm.newcastle.edu.au/os2/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: jricci@.nospam.ibm.net                            29-Aug-99 01:38:11
  To: All                                               29-Aug-99 10:42:25
Subj: Re: OS2 & Lexmark

From: jricci@.nospam.ibm.net (Joe Ricci)

Brian could you please outline the steps to make the bidi driver work 
with fixpack 11.
I would appreciate your help since I have not done this and am not 
sure which files to restore as your post suggests


On Sat, 28 Aug 1999 07:08:29, "Brian Morrison" 
<news@fenrir.demon.co.uk> wrote:
> So, put back the parallel.pdr from the bidi distibution then!
-- 
> Brian Morrison                                       news@fenrir.demon.co.uk
> 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: forkd4nisse@dtek.chalmers.se                      29-Aug-99 04:16:02
  To: All                                               29-Aug-99 10:42:25
Subj: Re: Netscape and two Inet providers

From: forkd4nisse@dtek.chalmers.se (Martin Nisshagen)

Duncan Munro [via Internet Direct - http://www.mydirect.com/] ->
comp.os.os2.misc:

 Same in 4.04, however it does not let me specify two different
 usernames or passwords.
 
 I work for a university. I want to recieve my mail through my employer
 at work and at home (which I  do)  but when I am at home I want to
 send it via my private ISP. the university prohibits send mailing from
 off campus location except through telnet or  webmail. Both methods
 are very clumsy for the volume of mail that I get.

Solution: use something more decent than Nutscrape for news and mail. 

Best regards,

m a r t i n | n

-- 
Martin Nisshagen                  PGP 6.0: 0x45D423AC         K R A F T W E R
K
CS/CE, Chalmers, Sweden           ICQ UIN: 689662             2x 300A @ 450
MHz
d4nisse-at-dtek-chalmers-se       http://go.to/martin_n       http://zap.to/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTH (1:109/42)

+----------------------------------------------------------------------------+

From: OS2Guy@WarpCity.com                               28-Aug-99 19:25:02
  To: All                                               29-Aug-99 10:42:25
Subj: Important News From Dan Porter of Innoval

From: Tim Martin <OS2Guy@WarpCity.com>

I have just received the following from Dan Porter of
Innoval Systems Solutions, Inc.:

From: Dan Porter  6:21 PM (PST), August 28, 1999
Subject: InnoVal and OS/2
To: os2guy@warpcity.com

Effective immediately, InnoVal Systems Solutions, Inc. is withdrawing
the following products from marketing and support.

Post Road Mailer for OS/2
J Street Mailer for Java
Web Willy Watch for OS/2

Anyone may download free copies of these products from our online store
at http://stores.yahoo.com/innoval. In addition, anyone may freely
distribute executable copies of the software through online software
repositories and websites. You are encouraged to do so because we will
only be able to keep them in our online store for a limited time. If you

distribute the Post Road Mailer you must also distribute a serial number

to allow a user to activate the product. You may use a serial number you

received from us in the past (for release 3.0), or you may use serial
number 31571728. You may also post serial numbers in newsgroups and
websites. Online orders, for these specific products, placed with us
during the last sixty days, have not been processed and customers
credit cards have not been charged. These orders will be cancelled and
customers are free to keep and use the downloaded code that they
received when they placed their order.

For me, personally, this is a sad day. Our company tried to hang in as
long as possible with OS/2. OS/2 is still my favorite platform and OS/2
customers are the best customers our company ever had. I have made many
good friends through my associations with all of you. You ll still see
me popping in at OS/2 users group meetings throughout the country when
my travels coincide with a meeting.

Our company continues to do very well. The consulting side of the
business has always been strong. The most exciting area of business,
however, is Iceptur. Iceptur is our new Internet filtering software for
the Windows 95/98/NT platform. Despite the fact that there are over two
hundred competitors in this market niche, we are experiencing phenomenal

success. This is partly because of the unique technology we developed
and partly because there is a strong demand for high quality Internet
filtering solutions (release 2.0 will hit the streets by September 5th).

We have entered into a number of strategic alliances with several
companies to market Iceptur and license the underlying technology for
use in other products.

I need, now, to focus all of InnoVal s resources on Iceptur and our
consulting business. I tried, during the past year, to juggle resources
but in doing so was not doing the right kind of job for our customers,
the OS/2 community at-large, InnoVal s employees, or InnoVal s owners.
You made the Post Road Mailer into the number one email client for OS/2.

You worked with us on J Street Mailer as we tried to negotiate a
platform independent course with Java. You have my thanks and the thanks

of everyone at InnoVal.

We are moving on to bigger things, but not better. OS/2 was better and
(oh, how I wish) it could have been big.

Thanks again,

Dan Porter, President
InnoVal Systems Solutions, Inc.

AND

From: Dan Porter  6:22 PM (PST), August 28, 1999
Subject: J Street Mailer Initiative
To: os2guy@warpcity.com

Let me state publically that I have no objection to any and all efforts
to enhance J Street Mailer. No do I have any objection to free
distribution. The team that worked on the original JSM project is
pleased that their original work is so well recognized.

Dan Porter, President
InnoVal Systems Solutions, Inc.

On a personal note:  I have been privileged to work and correspond
with Dan Porter and the fine folks at InnoVal for several years now.
No other OS/2 software developer has been more supportive or more
gracious with their time, efforts and devotion to OS/2.  I thank Dan
and his wonderful team of OS/2 programmers for all of their hard
work and I know that they entire OS/2 community wishes InnoVal
the best success on their future endeavors.

Tim Martin
The OS/2 Guy
Warp City
http://warpcity.com
"E-ride the wild surf to Warp City!"





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: pcoen@drew.edu                                    28-Aug-99 22:35:08
  To: All                                               29-Aug-99 10:42:25
Subj: Re: Netscape and two Inet providers

From: Paul Coen <pcoen@drew.edu>

Duncan Munro wrote:
> 
> I an using Comm4.04 and I need to recieve my mail with one Internet
> provider and send it through another provider.  Mu username and
> password are different with each. Is there a way to do this?
> 

Not with 4.04. Netscape 4.5 and above (such as the 4.61 beta)
allow you to use different SMTP and incoming mail server user
names.

If you're using IMAP, though, I don't think I'd use
even the second 4.61 beta. It's still flaky (although
even buggy, Netscape 4.61's imap support is better than
4.04).

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@sover.net                                28-Aug-99 21:14:08
  To: All                                               29-Aug-99 10:42:26
Subj: Re: Looking for flow chart program.

From: letoured@sover.net

>I have looked for flowcharting apps before, and we are lacking  seriously
>in this area!  Programmers, take note - there might be a  business
>opportunity here?

I'll buy one! -- But I want it to include being able to place timelines
along the flow. This would make it most useful for mapping out everything
from novels to you name it, and not just common flowcharts uses.



_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: mikelrob@206.149.24.9                             29-Aug-99 02:49:07
  To: All                                               29-Aug-99 10:42:26
Subj: Can't retrieve mail

From: mikelrob@206.149.24.9 (Michael Robertson)

	I'm stumped and frustrated.  For the past couple of weeks I haven't been able 
to retrieve mail from my ISP.  I'm using MR2ICE, 1.62 and it will send
messages OK.  It gives me the message "Retrieving 1 of n" and then the
percentage indicator stays at zero and nothing more happens.  What is really
getting me is that Netscape Mail, YARN mail and even Eudora Lite, which I
installed just to see if a Win proggie would work, all do the same thing. 
They all say they are starting to retrieve message one of n and then hang.  My 
ISP, flashnet, is completely clueless and just suggests I get my messages from 
their mail web site via the mail URL using Netscape, which is what I've been
doing.  Its very slow that way, however.  Anyone have any idea what might be
happening?
-- 
Michael Robertson                  
>>>>Live simply, that others may simply live<<<<

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     29-Aug-99 03:04:28
  To: All                                               29-Aug-99 15:49:07
Subj: Re: Netscape and two Inet providers

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

Duncan Munro wrote:

> Same in 4.04, however it does not let me specify two different
> usernames or passwords.
>
> I work for a university. I want to recieve my mail through my employer
> at work and at home (which I  do)  but when I am at home I want to
> send it via my private ISP. the university prohibits send mailing from
> off campus location except through telnet or  webmail. Both methods
> are very clumsy for the volume of mail that I get.

You should be able to set up the browser to use your private ISP's
SMTP server for sending mail, and the university's pop-server (and
password) for receiving mail, while you are logged into your private
ISP.  The only problem might be if the university won't allow you to
log in to the pop-server from an external domain.

Jeffrey S. Kobal
IBM Corporation
Netscape Communicator for OS/2 - Development Team


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: muses9@cyberus.ca                                 29-Aug-99 03:32:17
  To: All                                               29-Aug-99 15:49:07
Subj: Re: Looking for flow chart program.

From: muses9@cyberus.ca (Marko)

I have been looking for a new project. Thanks for the idea!

On Fri, 27 Aug 1999 16:58:59, "Jan Danielsson" 
<Jan.Danielsson@falun.mail.telia.com> made history by saying:

-> >| I'm looking for an application to generate flow charts.  Suggestions
-> >| please.
-> >
-> >Dave,
-> >
-> >I've never found a native flow chart application for OS/2. I wish we 
-> >could trade in some of the Yet Another FTP Client apps for just _one_ 
-> >that's comparable to an early version of Visio.
-> 
-> If I only had more time, I would write one myself.
-> 
-> Maybe a team effort would solve the problem?, Anyone?
-> 

--
Marko
Ottawa

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: your.user.name@your.host.name                     29-Aug-99 03:56:11
  To: All                                               29-Aug-99 15:49:07
Subj: Re: 4-digit year in 'dir' list??

From: your.user.name@your.host.name ()

In article <37C6A580.9A360C36@nospam.com>, Jim Lewis wrote:
>Stefan A. Deutscher wrote:
>
>> On Fri, 27 Aug 1999 01:35:22 GMT, John Thompson
>> <nospam@savebandwidth.invalid> wrote:
>> >In <37C5A4F0.3924@ibm.net>, Wm D Loughman <wdlkhl@ibm.net> writes:
>> >
>> >>After changing from FAT partions to HPFS partions, I re-installed
>> >>Warp-4, FP-9.  My 'dir' listings show (only) 2-digit years.  Am I
>> >>imagining, that before this I had a 4-digit year in my 'dir'
>> >>listings?? If this isn't pure invention on my part, how do I get back
>> >>to 4-digit years?
>> >
>> >I've never seen 4-digit years displayed in a commnd-line directory
>> >listing.  Perhaps you're thinking of the folder "Details view" which
>> >does show a 4-digit year.

Sigh...  I suppose so.  Pushing one's 7th decade does marvelous (terrible?)
things to one's recall (er... warped?) and imagination (overactive?).

>>
>> And boy would I wish they'd add a switch to show full time (4 digit
>> year), as well as last access and creation times also from the command
>> line!  I know it can be done with REXX and what not, but that's not the

How do you do that in REXX, please?   (Stefan?) 

>> same thing as
>>
>>  dir /show_me_all_you_know_about_these_files
>>
>> would be.
	[  snip  ]

> I have thought about writing a C program to do just that a few times. It
>would work almost just like dir, except would not have the /s (subdirectory)
>option. In fact, to save time it won't have any options, but it will show
>the data as you requested including creation times/dates, 4-digit year,
>etc.  My file finder (available below) already shows a 4-digit year.
>
> How many other people would use this if I make it available? Freeware of
>course.

Me, me, me!!


WD "Bill" Loughman
Berkeley, California, USA
wdlkhl@ibm.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   28-Aug-99 22:04:29
  To: All                                               29-Aug-99 15:49:07
Subj: Re: Netscape and two Inet providers

From: Kris Kadela <kris@dgraph.com>


Martin Nisshagen wrote:
> 
> Duncan Munro [via Internet Direct - http://www.mydirect.com/] ->
> comp.os.os2.misc:
> 
>  Same in 4.04, however it does not let me specify two different
>  usernames or passwords.
> 
>  I work for a university. I want to recieve my mail through my employer
>  at work and at home (which I  do)  but when I am at home I want to
>  send it via my private ISP. the university prohibits send mailing from
>  off campus location except through telnet or  webmail. Both methods
>  are very clumsy for the volume of mail that I get.

The mail config in Netscape allows one to supply a different username
for the outgoing server and a different one for the incoming.

> 
> Solution: use something more decent than Nutscrape for news and mail.
> 
> Best regards,
> 
> m a r t i n | n
> 
> --
> Martin Nisshagen                  PGP 6.0: 0x45D423AC         K R A F T W E
R K
> CS/CE, Chalmers, Sweden           ICQ UIN: 689662             2x 300A @ 450
MHz
> d4nisse-at-dtek-chalmers-se       http://go.to/martin_n      
http://zap.to/kw

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                29-Aug-99 04:17:16
  To: All                                               29-Aug-99 15:49:07
Subj: Re: Important News From Dan Porter of Innoval

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <37C899FF.D4371FE0@WarpCity.com>, Tim Martin <OS2Guy@WarpCity.com> writes:
>I have just received the following from Dan Porter of
>Innoval Systems Solutions, Inc.:

   How do we know this is true, i.e, why didn't i, as a licensed
JStreet user get any notice about this, and why didn't Dan post
it anywhere on his WWW site, which BTW, has nothing else on it
but "Iceptur"?

>From: Dan Porter  6:21 PM (PST), August 28, 1999
>Subject: InnoVal and OS/2
>To: os2guy@warpcity.com
>
>Effective immediately, InnoVal Systems Solutions, Inc. is withdrawing
>the following products from marketing and support.
>
>Post Road Mailer for OS/2
>J Street Mailer for Java
>Web Willy Watch for OS/2
>
>Anyone may download free copies of these products from our online store
>at http://stores.yahoo.com/innoval. In addition, anyone may freely
>distribute executable copies of the software through online software
>repositories and websites. You are encouraged to do so because we will
>only be able to keep them in our online store for a limited time. If you
>
>distribute the Post Road Mailer you must also distribute a serial number
>
>to allow a user to activate the product. You may use a serial number you
>
>received from us in the past (for release 3.0), or you may use serial
>number 31571728. You may also post serial numbers in newsgroups and
>websites. Online orders, for these specific products, placed with us
>during the last sixty days, have not been processed and customers
>credit cards have not been charged. These orders will be cancelled and
>customers are free to keep and use the downloaded code that they
>received when they placed their order.
>
>For me, personally, this is a sad day. Our company tried to hang in as
>long as possible with OS/2. OS/2 is still my favorite platform and OS/2
>customers are the best customers our company ever had. I have made many
>good friends through my associations with all of you. You ll still see
>me popping in at OS/2 users group meetings throughout the country when
>my travels coincide with a meeting.
>
>Our company continues to do very well. The consulting side of the
>business has always been strong. The most exciting area of business,
>however, is Iceptur. Iceptur is our new Internet filtering software for
>the Windows 95/98/NT platform. Despite the fact that there are over two
>hundred competitors in this market niche, we are experiencing phenomenal
>
>success. This is partly because of the unique technology we developed
>and partly because there is a strong demand for high quality Internet
>filtering solutions (release 2.0 will hit the streets by September 5th).
>
>We have entered into a number of strategic alliances with several
>companies to market Iceptur and license the underlying technology for
>use in other products.
>
>I need, now, to focus all of InnoVal s resources on Iceptur and our
>consulting business. I tried, during the past year, to juggle resources
>but in doing so was not doing the right kind of job for our customers,
>the OS/2 community at-large, InnoVal s employees, or InnoVal s owners.
>You made the Post Road Mailer into the number one email client for OS/2.
>
>You worked with us on J Street Mailer as we tried to negotiate a
>platform independent course with Java. You have my thanks and the thanks
>
>of everyone at InnoVal.
>
>We are moving on to bigger things, but not better. OS/2 was better and
>(oh, how I wish) it could have been big.
>
>Thanks again,
>
>Dan Porter, President
>InnoVal Systems Solutions, Inc.
>
>AND
>
>From: Dan Porter  6:22 PM (PST), August 28, 1999
>Subject: J Street Mailer Initiative
>To: os2guy@warpcity.com
>
>Let me state publically that I have no objection to any and all efforts
>to enhance J Street Mailer. No do I have any objection to free
>distribution. The team that worked on the original JSM project is
>pleased that their original work is so well recognized.
>
>Dan Porter, President
>InnoVal Systems Solutions, Inc.
>
>On a personal note:  I have been privileged to work and correspond
>with Dan Porter and the fine folks at InnoVal for several years now.
>No other OS/2 software developer has been more supportive or more
>gracious with their time, efforts and devotion to OS/2.  I thank Dan
>and his wonderful team of OS/2 programmers for all of their hard
>work and I know that they entire OS/2 community wishes InnoVal
>the best success on their future endeavors.
>
>Tim Martin
>The OS/2 Guy
>Warp City
>http://warpcity.com
>"E-ride the wild surf to Warp City!"
>
>
>
>
>


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   28-Aug-99 22:20:25
  To: All                                               29-Aug-99 15:49:07
Subj: Re: Netscape and two Inet providers

From: Kris Kadela <kris@dgraph.com>

Well. looks like Innoval mail clients are now free. Use those.

"Jeffrey S. Kobal" wrote:
> 
> Duncan Munro wrote:
> 
> > Same in 4.04, however it does not let me specify two different
> > usernames or passwords.
> >
> > I work for a university. I want to recieve my mail through my employer
> > at work and at home (which I  do)  but when I am at home I want to
> > send it via my private ISP. the university prohibits send mailing from
> > off campus location except through telnet or  webmail. Both methods
> > are very clumsy for the volume of mail that I get.
> 
> You should be able to set up the browser to use your private ISP's
> SMTP server for sending mail, and the university's pop-server (and
> password) for receiving mail, while you are logged into your private
> ISP.  The only problem might be if the university won't allow you to
> log in to the pop-server from an external domain.
> 
> Jeffrey S. Kobal
> IBM Corporation
> Netscape Communicator for OS/2 - Development Team

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          29-Aug-99 04:43:01
  To: All                                               29-Aug-99 15:49:07
Subj: Re: FIXED!!-> Can't access any HELP files!

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Sun, 29 Aug 1999 00:37:17, "James A. Jones" <jaj01@earthlink.net> a 
crit dans un message:

> I finally found out what was preventing OS/2 Warp 4 from accessing any
> HELP or INF files. Somehow, HPMGRMRI.DLL was missing from the \OS2\DLL
> directory. This is the "Help manager resource dll" that works along with
> HELPMGR.DLL. I have no idea how it could have been deleted. Good thing I
> had another Warp 4 system running on my other machine, or I would have
> never found it. Thanks to all who offered suggestions!

Nice of you to post the fix, and glad you worked it out, but next time, 
when you email people to get help with this, you should make sure your 
return mailbox works, and you should read these groups to check for 
feedback that was posted when the email bounced.

admin@earthlink.net says "jaj01@earthlink.net" isn't a valid email.

And I'm not sure it needs to be cross-posted like it was, but I'll keep it 
just like it is so you're more likely to read this. 

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: judithr@primenet.com                              28-Aug-99 21:47:24
  To: All                                               29-Aug-99 15:49:07
Subj: Re: Smack - speedy resolution

From: judithr@primenet.com

It is available to download from BMT Micro, and they probably have
the manual corrected by now.  The manual is part of the download,
.pdf format.  

>On Thu, 26 Aug 1999 00:19:11 GMT, virobik@MAPS.onr.com wrote:

>>Anyone who has to print labels on a regular (or irregular) basis under
>>OS/2 should own this program. Highly recommended. 
>>(www.perfectniche.com).

>Sounds interesting but why isn't it available by e-mail?  Does it
>include a manual?
>Ordering by post just brings extra cost ( to get here in europe ).

>Also some screenshots would be nice.

>By the way, this site seems to be problematic to my NS4.61B2. It
>just silently died three times when I was visiting the site.  




Judith Russell       
judithr@primenet.com                    
Saugus Web Coordinator
http://www.hart.k12.ca.us/saugus


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: OS2Guy@WarpCity.com                               28-Aug-99 21:49:19
  To: All                                               29-Aug-99 15:49:07
Subj: Re: Important News From Dan Porter of Innoval

From: Tim Martin <OS2Guy@WarpCity.com>

Baden Kudrenecky wrote:

> Tim Martin <OS2Guy@WarpCity.com> writes:
> >I have just received the following from Dan Porter of
> >Innoval Systems Solutions, Inc.:
>
>    How do we know this is true, i.e, why didn't i, as a licensed
> JStreet user get any notice about this, and why didn't Dan post
> it anywhere on his WWW site, which BTW, has nothing else on it
> but "Iceptur"?
>
> baden
>
> baden@unixg.ubc.ca
> http://baden.nu/
> OS/2, Solaris & Linux

I'm a licensed JStreet User.  I oversee the largest private OS/2-only
web site on the 'Net (Warp City).  Most of the news you find today
on public OS/2 web sites is more often than not reported by Warp
City first - just as it is in this case.  You are certainly welcome to
ignore my public messages.  The same information is now appearing
at the publicly accessible Warp Cast web site and has been repeated
in  these newsgroups by Judith Russell.  (WarpCast does not provide
the second message from Dan Porter regarding the  "J Street Mailer
Initiative".  Warp City has been running exclusive JSM information, files
and upgrades offered by Samatra Software (Paul vanKeep and now
Mike Bowler) to Warp City members, many of whom use JSM.  Dan
may have submitted it to us (Warp City) because he feels confident
we will report his feelings, public statements and support of the
the newly created JSM Initiative.  InnoVal has every right on earth
to be proud as punch of JSM.  It is the finest 100% Java emailer
program on the market today.  Emerald Mail, MailPuccini and the
other entries have yet to equal the quality and features of JSM.

Paul vanKeep and Mike Bowler have stepped forward to devote
their personal time and extraordinary Java programming skills
to ensure J Street Mailer stays 'out front' in the Java Emailer
category.  They have released a flurry of upgrades over the
last few weeks and are improving JSM with each release.  Another
release is expected any day now (PVK8).  A long list of new features
and bug fixes have been released.  Paul and Mike intend on improving
the quality of JSM beyond its current high quality state.  Their time,
efforts and exemplary work have all been offered for free because of
their admiration for the fine J Street Mailer.  JSM runs on Linux,
Windows95/98/NT, Mac and especially well on OS/2.   One program
that runs under all operating systems.  It is an amazing piece of
work created by InnoVal.

Tim Martin
The OS/2 Guy
Warp City
http://warpcity.com
"E-ride the wild surf to Warp City"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: dunmunro@direct.ca                                29-Aug-99 05:01:21
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Netscape and two Inet providers

From: dunmunro@direct.ca (Duncan Munro)

Sonofa***h it works! I could have sworn that I tried this before I
couldnt get it going. It looks like it's remembering both passwords
and usernames. I wonder how it does that since I can't specify the
outgoing username/password?

thanks

Duncan

On Sun, 29 Aug 1999 03:04:56 GMT, "Jeffrey S. Kobal"
<murdoctor@ausNOSPAMtin.rr.com> wrote:

>
>Duncan Munro wrote:
>
>> Same in 4.04, however it does not let me specify two different
>> usernames or passwords.
>>
>> I work for a university. I want to recieve my mail through my employer
>> at work and at home (which I  do)  but when I am at home I want to
>> send it via my private ISP. the university prohibits send mailing from
>> off campus location except through telnet or  webmail. Both methods
>> are very clumsy for the volume of mail that I get.
>
>You should be able to set up the browser to use your private ISP's
>SMTP server for sending mail, and the university's pop-server (and
>password) for receiving mail, while you are logged into your private
>ISP.  The only problem might be if the university won't allow you to
>log in to the pop-server from an external domain.
>
>Jeffrey S. Kobal
>IBM Corporation
>Netscape Communicator for OS/2 - Development Team
>
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   28-Aug-99 23:08:19
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Netscape and two Inet providers

From: Kris Kadela <kris@dgraph.com>


Duncan Munro wrote:
> 
> Sonofa***h it works! I could have sworn that I tried this before I
> couldnt get it going. It looks like it's remembering both passwords
> and usernames. I wonder how it does that since I can't specify the
> outgoing username/password?

I do not think you need any auth info for the outgoing beyond the fact
that you have an IP address that is allowed to send outgoing mail. After
all, the server is run by your ISP that assigned you the IP address. Try
removing the outgoing username and it should still work (does here).
> 
> thanks
> 
> Duncan
> 
> On Sun, 29 Aug 1999 03:04:56 GMT, "Jeffrey S. Kobal"
> <murdoctor@ausNOSPAMtin.rr.com> wrote:
> 
> >
> >Duncan Munro wrote:
> >
> >> Same in 4.04, however it does not let me specify two different
> >> usernames or passwords.
> >>
> >> I work for a university. I want to recieve my mail through my employer
> >> at work and at home (which I  do)  but when I am at home I want to
> >> send it via my private ISP. the university prohibits send mailing from
> >> off campus location except through telnet or  webmail. Both methods
> >> are very clumsy for the volume of mail that I get.
> >
> >You should be able to set up the browser to use your private ISP's
> >SMTP server for sending mail, and the university's pop-server (and
> >password) for receiving mail, while you are logged into your private
> >ISP.  The only problem might be if the university won't allow you to
> >log in to the pop-server from an external domain.
> >
> >Jeffrey S. Kobal
> >IBM Corporation
> >Netscape Communicator for OS/2 - Development Team
> >
> >

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: say@sfu.ca                                        29-Aug-99 06:02:26
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Important News From Dan Porter of Innoval

From: say@sfu.ca (Daniel Say)

Baden Kudrenecky (baden@unixg.ubc.ca) wrote:
: In <37C899FF.D4371FE0@WarpCity.com>, Tim Martin <OS2Guy@WarpCity.com>
writes:
: >I have just received the following from Dan Porter of
: >Innoval Systems Solutions, Inc.:

:    How do we know this is true, i.e, why didn't i, as a licensed
: JStreet user get any notice about this, and why didn't Dan post
: it anywhere on his WWW site, which BTW, has nothing else on it
: but "Iceptur"?

: baden@unixg.ubc.ca : http://baden.nu/ : OS/2, Solaris & Linux

--------
	He also closed his "new at hobbes web site" recently
	according to the web-hoster
--------
#Linkname: [hobbes.nmsu.edu] Directory of /pub/new
#Link below withdrawn August 1999
#http://www.aescon.com/bestofos2/hobbes.htm

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Simon Fraser University (1:109/42)

+----------------------------------------------------------------------------+

From: news@fenrir.demon.co.uk                           29-Aug-99 07:45:01
  To: All                                               29-Aug-99 15:49:08
Subj: Re: OS2 & Lexmark

From: "Brian Morrison" <news@fenrir.demon.co.uk>

On Sun, 29 Aug 1999 01:38:22 GMT, Joe Ricci wrote:

>Brian could you please outline the steps to make the bidi driver work 
>with fixpack 11.
>I would appreciate your help since I have not done this and am not 
>sure which files to restore as your post suggests
>

OK, well I have FP10, but I'm going to assume that it is as per FP11.

17-07-99  8:02a         <DIR>      0 ----  .
17-07-99  8:02a         <DIR>      0 ----  ..
13-12-96  2:44p           275      0 a---  bidi.ddp
17-12-96  1:07p         4,427      0 a---  install.txt
 9-12-96  9:16a        23,115      0 a---  lexnpa.cnv
 3-03-94 11:14a         2,329      0 a---  license
 7-11-96  2:16p        39,482      0 a---  npaprot.cnv
 4-02-97  6:25p        19,847      0 a---  par1284.sys
12-11-96  1:11p         6,725      0 a---  parallel.hlp
15-11-96 11:52a        28,416      0 a---  parallel.pdr

Above is a directory listing for the bidi.exe contents that is
currently on the IBM DDPak site.

The way I installed it was not to use the update port route, but
instead to copy the *.cnv, and parallel.* files into the <boot
drive>:\os2\dll directory.

Now, I think I'm right in saying that all that FP10 and 11 do with
these files is to overwrite parallel.pdr. So, you could then retrieve
parallel.pd_ from the FP11 archive or backup directory and unpack it,
then copy it over the new parallel.pdr.

That should then work.


-- 
Brian Morrison                                       news@fenrir.demon.co.uk

               to reply, change address from 'news' to 'bdm'

 ...Grim faced, cold as fishwife's fingers, he snatched from the wall
 the sickle-sharp boar tusks he used for defacing Readers' Digest....


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Fool and Bladder Face-Jumping Team (1:109/42)

+----------------------------------------------------------------------------+

From: rlalla@stepnet.REMOVETHIS.de                      29-Aug-99 11:01:16
  To: All                                               29-Aug-99 15:49:08
Subj: NS4.61: printing wide tables

From: "Robert Lalla" <rlalla@stepnet.REMOVETHIS.de>

Recently I loaded a web page containing a short but very wide table.
How can I print out this page onto several sheets of paper? 
Using the standard Netscape print function I get only the leftmost 
~20% on a single sheet. Are there any other tools available?

--
RL


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Robert Lalla (1:109/42)

+----------------------------------------------------------------------------+

From: arjen@removethis.hacom.nl                         29-Aug-99 11:13:19
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Can OS/2 users grow up and think like Linux users?

From: "Arjen Meijer" <arjen@removethis.hacom.nl>

On Sat, 28 Aug 1999 10:09:54 -0400, Raphael Tennenbaum wrote:

:>1) Uninstall OD, which is probably 95% of what's
:>>> kerflooey on your system.  Replace with freeware Xfolder.

OD is extreme stable en very nice piece of software. It causes hardly any
unknown 
problems.

The real problem is the Workplace itself. It is FULL of bugs.  Have a look at
the 
APAR's since fixpack 1 and you will find numerous fixes for 'hangs'.  Only
after fixpack 
9 the WPS became fairly stable. Make new *.ini file after installing this
fixpack and 
enjoy Object Desktop AND Xfolder side by side. A winning combination.  Very
very 
good indeed.

Upgrade the the latest java en netscape code and this part of os/2 will also
become 
very stable.

I my opinion 96% of the bugs of Warp are caused by WARP itself.

Arjen


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sizzen en Dwan (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           29-Aug-99 09:39:07
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Important News From Dan Porter of Innoval

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Sun, 29 Aug 1999 04:17:33, baden@unixg.ubc.ca   (Baden Kudrenecky) 
wrote:

> In <37C899FF.D4371FE0@WarpCity.com>, Tim Martin <OS2Guy@WarpCity.com>
writes:
> >I have just received the following from Dan Porter of
> >Innoval Systems Solutions, Inc.:
> 
>    How do we know this is true, i.e, why didn't i, as a licensed
> JStreet user get any notice about this, and why didn't Dan post
> it anywhere on his WWW site, which BTW, has nothing else on it
> but "Iceptur"?
> 

<lots of snip>

Their WWW site page has a link to 

http://st6.yahoo.com/innoval/os2software.html

This page has legends about downloading FREE
copies of the software and the quoted serial number
31571728 to activate Post Road Mailer

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            29-Aug-99 10:32:29
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Important News From Dan Porter of Innoval

From: mike.luther@ziplog.com

In <37C899FF.D4371FE0@WarpCity.com>, Tim Martin <OS2Guy@WarpCity.com> writes:
>I have just received the following from Dan Porter of
>Innoval Systems Solutions, Inc.:
>
>From: Dan Porter  6:21 PM (PST), August 28, 1999
>Subject: InnoVal and OS/2
>To: os2guy@warpcity.com
>
>Effective immediately, InnoVal Systems Solutions, Inc. is withdrawing
>the following products from marketing and support.
>
>Post Road Mailer for OS/2
>J Street Mailer for Java
>Web Willy Watch for OS/2
>
>Anyone may download free copies of these products from our online store
>at http://stores.yahoo.com/innoval. In addition, anyone may freely
>distribute executable copies of the software through online software
>repositories and websites. You are encouraged to do so because we will
>only be able to keep them in our online store for a limited time. If you

Tim .. is there any way that those of us whom purchased the Spell
Checker for Post Road Mailer for OS/2 can get that code?  I, for
example, licensed and paid for it, but never got the actual code.  I'd
like to activate the feature, but can't find a copy of the code!

For me the paid-for version of PRM is a stable and very capable product.

//-----------------------------
Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      29-Aug-99 02:12:23
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Netscape and two Inet providers

From: nospam@savebandwidth.invalid     (John Thompson)

In <37c87864.19223365@news.direct.ca>, dunmunro@direct.ca (Duncan Munro)
writes:

>Same in 4.04, however it does not let me specify two different
>usernames or passwords.

smtp doesn't use username/password authentication so if you can 
send through smtp and receive with POP3 you should be set.

-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     29-Aug-99 11:38:07
  To: All                                               29-Aug-99 15:49:08
Subj: Re: Can't retrieve mail

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Sun, 29 Aug 1999 02:49:15 GMT, Michael Robertson wrote:

->	I'm stumped and frustrated.  For the past couple of weeks I haven't been
able to retrieve mail from my ISP.  I'm using MR2ICE, 1.62 and it will send
messages OK.  It gives me the message "Retrieving 1 of n" and then the
percentage indicator stays at zero and nothing more happens.  What is really
getting me is that Netscape Mail, YARN mail and even Eudora Lite, which I
installed just to see if a Win proggie would work, all do the same thing. 
They all say they are starting to retrieve message one of n and then hang.  My 
ISP, flashnet, is completely clueless and just suggests I get my messages from 
their mail web site via the mail URL using Netscape, which is what I've been
doing.  Its very slow that way, however.  Anyone have any idea what might be
happening?

<Yuck, all one line!>

Possibility #1 - someone has zipped up and sent you their entire computer!
It has a gigantic attachment and you're seeing it working correctly. The
percentage of the message retrieved really hasn't gone over 0%!

I've also seen problems like this. In my case I had to adjust the MTU size
of my ppp connection before it would work. Try running netstat -n to find
out what your current MTU size is then adjust it using

ifconfig ppp0 mtu 1006

and keep reducing the number 'til it works. Give up if you hit 512 bytes
and it still doesn't work.


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: jpedone_no_spam@flash.net                         29-Aug-99 12:42:07
  To: All                                               29-Aug-99 15:49:09
Subj: Re: Netscape and two Inet providers

From: jpedone_no_spam@flash.net

In <37c87864.19223365@news.direct.ca>, dunmunro@direct.ca (Duncan Munro)
writes:
>Same in 4.04, however it does not let me specify two different
>usernames or passwords.
>
>I work for a university. I want to recieve my mail through my employer
>at work and at home (which I  do)  but when I am at home I want to
>send it via my private ISP. the university prohibits send mailing from
>off campus location except through telnet or  webmail. Both methods
>are very clumsy for the volume of mail that I get.
>

Have you tried looking at the profile option?  I.e. with NS 4.04 and later
you can start netscape as netscape.exe -mail -P"isp1" This will bring up
the e-mail portion of NS with the the appropriated settings for isp1.
  It's not as convenient as a program like pmmail but it works for
multiple accounts.


 
J. Pedone
jpedone@flash.net
http://www.flash.net/~jpedone
 
Windows NT?  New Technology?  I don't think so...
Beware of programmers who carry screwdrivers.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: jpedone_no_spam@flash.net                         29-Aug-99 12:42:08
  To: All                                               29-Aug-99 15:49:09
Subj: Re: Can't retrieve mail

From: jpedone_no_spam@flash.net

In <pVHy30cYjSre092yn@206.149.24.9>, mikelrob@206.149.24.9 (Michael Robertson) 
writes:
>>	I'm stumped and frustrated.  For the past couple of weeks I haven't 
>been able to retrieve mail from my ISP.  I'm using MR2ICE, 1.62 and it 
>will send messages OK.  It gives me the message "Retrieving 1 of n" and 
>then the percentage indicator stays at zero and nothing more happens.  What 
>is really getting me is that Netscape Mail, YARN mail and even Eudora Lite, 
>which I installed just to see if a Win proggie would work, all do the same 
>thing.  They all say they are starting to retrieve message one of n and then 
>hang.  My ISP, flashnet, is completely clueless and just suggests I get my 
>messages from their mail web site via the mail URL using Netscape, which 
>is what I've been doing.  Its very slow that way, however.  Anyone have any 
>idea what might be happening?

Try downloading a trial copy of pmmail and use the remote control feature
to see what's actually on the server.  You probably just need to
delete message #1.

 
J. Pedone
jpedone@flash.net
http://www.flash.net/~jpedone
 
Windows: The Gates of hell.
BREAKFAST.COM halted... cereal port not responding!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: jpedone_no_spam@flash.net                         29-Aug-99 12:42:08
  To: All                                               29-Aug-99 15:49:09
Subj: Re: 4-digit year in 'dir' list??

From: jpedone_no_spam@flash.net

In <37c8af66@news1.us.ibm.net>, your.user.name@your.host.name () writes:
>In article <37C6A580.9A360C36@nospam.com>, Jim Lewis wrote:
>>Stefan A. Deutscher wrote:
>>

>
>>>
>>> And boy would I wish they'd add a switch to show full time (4 digit
>>> year), as well as last access and creation times also from the command
>>> line!  I know it can be done with REXX and what not, but that's not the
>
>How do you do that in REXX, please?   (Stefan?) 

/* */
rc=sysfiletree('e:\config.sys','files','l')
say files.1
exit 0

output:
1999-08-28 11:01:14       12791  A----  e:\config.sys


 
J. Pedone
jpedone@flash.net
http://www.flash.net/~jpedone
 
If you want it done right, forget Microsoft.
A)bort, R)etry or S)elf-destruct?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: bdavis@fn.net                                     29-Aug-99 13:44:06
  To: All                                               29-Aug-99 15:49:09
Subj: Re: Warp4-and-HPFS386

From: bdavis@fn.net (Brian Davis)

On Sat, 28 Aug 1999 18:39:15, "Kelly Robinson" <ispy@groovyshow.com> wrote:

> Man, you OS/2 people are so loyal and faithful and not above the law...
> 
> 

How true. Why don't you go d/l some of that pirated Windows
slopware. 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: prather@infi.net                                  29-Aug-99 13:44:06
  To: All                                               29-Aug-99 15:49:09
Subj: Re: StarOffice and Java 1.1.8

From: prather@infi.net (Jerry Prather)

In message
<37c86322$1$yunqyrl1$mr2ice@news.pego1.on.wave.home.com> -
lhadley@nospam.net writes:
:>
:>Has anyone got Java to work with Star Office?
:>
:>I've enabled it in the appropriate places, but it keeps saying "Java
:>installation not found"
:>
:>I've listed the \Java11 and \Java11\NS directories as class paths.
:>
:>Any suggestions?
:>
:>[Warp3 , fp40]

Just to let you know you're not alone, me too!  I can use the
Star Office browser for non-Java sites, but usually the entire SO
will crash and burn if it encounters Java.  I've also checked the
directories and paths without success.

WARP 4, FP11, Java 1.1.8


Jerry Prather                    prather@infi.net

"Many religions are worth dying for; no religion is worth killing
for."
					- Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          29-Aug-99 13:45:27
  To: All                                               29-Aug-99 15:49:09
Subj: Re: Important News From Dan Porter of Innoval

From: piquant00@uswestmail.net (Annie K.)

On Sun, 29 Aug 1999 04:17:33, baden@unixg.ubc.ca   (Baden Kudrenecky) 
wrote:

:  How do we know this is true, i.e, why didn't i, as a licensed
: JStreet user get any notice about this, and why didn't Dan post
: it anywhere on his WWW site, which BTW, has nothing else on it
: but "Iceptur"?

 See http://st6.yahoo.com/innoval/os2software.html

-- 
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: piquant00@uswestmail.net                          29-Aug-99 13:49:00
  To: All                                               29-Aug-99 15:49:09
Subj: Re: Can't retrieve mail

From: piquant00@uswestmail.net (Annie K.)

On Sun, 29 Aug 1999 12:42:16, jpedone_no_spam@flash.net wrote:

: >> I'm stumped and frustrated.  For the past couple of weeks I haven't 
: >been able to retrieve mail from my ISP.  I'm using MR2ICE, 1.62 and it 
: >will send messages OK.  It gives me the message "Retrieving 1 of n" and 
: >then the percentage indicator stays at zero and nothing more happens.

[snip]
    
: Try downloading a trial copy of pmmail and use the remote control feature
: to see what's actually on the server. 

 MR/2 ICE has remote control, it's called "manual mode."

-- 
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: nobody@neuropa.net                                29-Aug-99 14:33:06
  To: All                                               29-Aug-99 15:49:09
Subj: (1/2)  The case for OS/2 Warp, a Super-Charged OS 

From: Anonymous <nobody@neuropa.net>

Check: alt.binaries.warez.os2

IF YOU ARE AN EXISTING OS/2 WARP USER, THIS GUIDE WILL DESCRIBE HOW YOU
MAY IMPROVE SYSTEM FILE I/O BY 5X TO 10X FACTOR.

note:  This information is provided for educational, and entertainment
purposes only.  

IT is Recommended to print this guide now or save to a file for future
reference.... ;)

Introduction

This is a guide or informative doc,  how to install a quite IMPROVED 
OS/2 Warp v4 to your PC.  This guide is published for intermediate to
power PC users.  Why could you be interested in OS/2?.:
 => Because it is a robust 32-bit OS
 => Excellent Internet services (TCP/IP)
 => Excellent GUI, (named as the best on an important Linux web site)
 => Good support from IBM (Service pak #11 released in july)
 => Excellent 32-bit applications available and 1000's of utilities
 => JVM v1.1.8  The best JVM as reported by Volano and other benchmarks
 => YEAR 2K READY!, and more

Want' to try a FREE screensaver?:
http://www.os2ss.com/warpcast/wc1129.html

When installing Wipeout Screen saver, don't install the toolkit with 
OS/2 v4...

This is a guide to OS/2 information, software, resources and more,.. 
if you like challenges, keep reading!.  This time you can setup a more 
powerful PC system than ever.  The final result of this setup maybe
called OS/2 Brutal-Force...

PC newspersons are welcome to build this setup for testing purposes 
and they can have a better prisma to report how good or bad OS/2 is.
Reporting about OS/2 without making reserch, installing it, and
installing appropiate Fixpacks is to be an UN-PROFESSIONAL newsperson.

ATTENTION INTERNATIONAL USERS!, LOTUS SMART SUITE V1.1 FOR OS/2 WARP 4
IS NOW AVAILABLE WITH MULTI-LANGUAGE SUPPORT!!

Sample of OS/2 Applications & Utilities, some with url links:
1) Lotus Smart Suite v1.1 (123, Word Pro, Organizer, 
Approach,Freelance)
http://www.lotus.com/home.nsf/welcome/smartsuiteos2
2) Netscape Communicator v4.61 (July 14, 1999 edition)
http://www.software.ibm.com/warp/netscape
3) IBM Visual Age for JAVA v2 (v3 in beta right now)
http://www.software.ibm.com/ad/vajava
4) Star Office v5.1 (German Office Suite that resembles Office)
http://www.stardivision.com
5) IBM Visual Age for C++ v4
http://www.spoftware.ibm.com/ad/visualge_c++
6) Doctor Solomon Anti-Virus, VirusScan v4.02
http://www.nai.com
7) SETI@OS2
http://www.os2ss.com/seti
8) Emtec FTP 5.06 (with resume capabilities)
ftp://ftp.us.emtec.com/netsuite/eftp506.zip
9)Gamma Tech v4.0
http://www.gt-online.com
10) Object desktop v2.0
http://www.stardock.com
11) PKZIP v2.50
http://www.pkware.com/shareware/pkos2250.html
12) MainActor v3.0 (in development)
13) Pronews v1.51 (excellent usenet reader)
http://hobbes.nmsu.edu
14) IBM TCP/IP v4.1 (32-bit)
15) Innoval PostRoad Mailer (email, now FREE)
http://st6.yahoo.com/innoval/os2software.html
16) Innoval web WilliWatch (Net Nanny)
http://st6.yahoo.com/innoval/os2software.html
17) and more files
http://hobbes.nmsu.edu

One of our goals is to demonstrate that OS/2 is an excellent OS
alternative.

You need a FTP client with resume downloads capabilities.  If you are an
existing OS/2 user, try; Emtec FTP 5.06.  To follow OS/2 topics, use;
Pronews Usenet Reader [highly recommended]

1)  ftp://merlin.itep.ru (lss;os2warez) 

Be patient, many persons are loggin almost every hour and every minute.
Best hours are 2-5 AM.  Warning: Stardock Essentials v2.0 crash OS/2. Be
careful and avoid installing it.  Process Commander is a nice
application, it will save you many problems. But it is recommended to
uninstall it before installing a Fixpack.  Install Process Commander
-=AFTER=- installing FP #11.

Note: OS/2 should be installed to a HPFS partition.  System behavior 
is much better than FAT.

IMPORTANT!!!
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~
HPFS386 IS NOT COMPATIBLE WITH PARTITION MAGIC (ACL).  Also, you could
have BIG trouble executing HD utils NOT compatible with HPFS386!. This
makes
sense for an standalone OS/2 system.
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~

Always check hardware for compatibility with OS/2,  Suggested 
installation procedure:
   1- Browse through KEY OS/2 web sites and learn about OS/2 
   2- Install OS/2 v4
   3- Install Must-Have utilities (more at the end of the doc)
   4- Get and install Netscape Communicator v4.61
      http://www.software.ibm.com/os/warp/netscape/
   5- Get and install OS/2 Feature Install Version 1.2.4 
      http://service.boulder.ibm.com/asd-bin/doc/en_us/catalog.htm  
   6- Get and install latest JAVA (1.1.7 or latest)
      http://service.boulder.ibm.com/asd-bin/doc/en_us/catalog.htm
   7- Enable software updates through the WWW                   
http://ps.boulder.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/softupd.htm
   8- Update OS/2 v4 (click the OS/2 v4 column, RSU, and Fixpack #11)
   9- Update Spooler
  10- Follow the instructions (be sure to NOT have other applications
running.)
  11- Go and hunt for TCP/IP v4.1 and install it.  This baby will allow
much better 'Interneting'
  12- Go and hunt for other OS/2 applications, particularly in FTP sites
in Russia
  13- Install Lotus Smart Suite v1.1, Star Office, File Manager and 
others. 
  14- Remember TEST DRIVE THEM and buy after 60 dayS TEST DRIVE

     
-------------------------------------------------------------------
and NOW Our Featured Presentation...

SUPER-CHARGE YOUR OS/2 SETUP.  HOW TO USE A BIGGER CACHE, 32-BIT FILE
SYSTEM AND 32-BIT DEVICE DRIVER.  MAKE YOUR OS/2 SYSTEM FASTER THAN
EVER.

HPFS386  --=> High Performance File System 

check fir it in alt.binaries.warez.os2, comp.os.os2.apps
or check around....

This hpfs386 is dated 06/11/99 and is the latest release.  if you're
just using hpfs.ifs,  you can improve your system performance with the
hpfs386 driver.

The hpfs386 is 32bit and can have any cache size you want, plus its
about 4x faster at writing and a bit faster at reading.  It will improve
the speed of your system. Instructions for installing are inside the
hpfs386 zip file. It is easy to do. The instructions are inside the ini
file itself in case you get lost. 

Another note: you'll need to update your config.sys. That information 
is also found in the hpfs386.zip file in the readme instructions.  The
entries are easy to add.  They can be  included at the end of your path
statements and you can literally mark/copy/paste the entry from the 
instruction file directly into your config.sys  paths.   

Make sure you make those entries in your config.sys before you reboot
your system so your system knows  what driver to use and where to find
it. You'll know it worked when 
you reboot and a single  statement across your screen says the hpfs386
driver was found.

HPFS INSTALLATION:
HPFS386 Installation on Warp3, Warp4 ..etc.

Make a directory under c:\ called ibm386fs and copy everything
in this package there..

Edit your config.sys, REM out the hpfs.ifs line, and add these:
IFS=C:\IBM386FS\HPFS386.IFS /A:*
CALL=C:\OS2\CMD.EXE /Q /C C:\IBM386FS\CACHE386.EXE >NUL

Add C:\IBM386FS; to your PATH, LIBPATH and DPATH

Edit HPFS386.INI and change the cachesize to whatever you want
(don't edit anything else!)

Reboot and enjoy!
----------------------------------------------------------------------
--
2) DANIS506 --=>
http://hobbes.nmsu.edu/pub/os2/system/drivers/storage/danis506.zip


                       Daniela's S506 ADD - Gamma 5
                        ------------------------------
Check for latest release in http://hobbes.nmsu.edu/incoming

NAME
     DaniS506.ADD  -  replacement for IBM1S506.ADD

ATTENTION, Test Results!

RESULTS REPORTED FROM INTEGRATING DANIS506.ADD -=>AND<=- HPFS386 
TO OS/2 AN WARP v4 SYSTEM:  Enjoy...... :)

Before Danis506+HPFS386  (Sysbench 0.9.4e)
>  File I/O - Drive D:
>    4Kb seq.   Uncached w :     3878.003    Kilobytes/second
>    4Kb seq.   Uncached r :     5811.515    Kilobytes/second
	.
	.
>    64K random Cached   w :     4906.782    Kilobytes/second
>    64K random Cached   r :     2672.974    Kilobytes/second
>    -----------------------------------------------------------------------
>    Total                 :     3096.124    File I/O-marks
>                               ==========

AFTER DANIS506+HPFS386
>  File I/O - Drive D:
>    4Kb seq.   Uncached w :     2268.435    Kilobytes/second
>    4Kb seq.   Uncached r :    30223.332    Kilobytes/second
	.
	.
>    64K random Cached   w :    57649.151    Kilobytes/second
>    64K random Cached   r :    52182.161    Kilobytes/second
>    -----------------------------------------------------------------------
>    Total                 :    31493.542    File I/O-marks
>                              ============

System File I/O-marks increased by a factor of 10X!, sure your results
will vary but it seems a definitive and substantial improvement that
positions OS/2 Warp v4 as a quite attractive computing and SOHO
platform.

What is a Fixpack?

For a complete description,check:
http://www.os2ezine.com/v1n4/fixpak.html

To UPDATE your system to the most recent fixpack level check:
http://ps.boulder.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/softupd.htm

TIP: You will need a file named RSUINST.EXE  download it from

http://ps.boulder.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/softupd.htm
l#warp34

Now your OS/2 v4 should run like a champ!, browse through OS/2
newsgroups for any help or question you may have :/

If for any reason OS/2 'hangs' while booting, you have a 'MIRACLE' 
KEYpress ALT-F1 while OS/2 boots (There will be a small OS/2 rectangle
in the upper left corner of your monitor...  Follow the alternatives o
FIX the CONFIG.SYS file  if you messed with it...It will be wise to 
make backup copies of OS2.INI and OS2SYS.INI files. Use FM/2 file
manager to do it.

Try to have BACKUP copies of CONFIG.SYS.  just in case......If you need
help:
comp.os.os2.apps,comp.os.os2.beta,comp.os.os2.bugs,comp.os.os2.setup.misc
comp.os.os2.setup.video,comp.os.os2.setup.storage

Hardware considerations:

IBM HAS DEVELOPED OS/2 DEVICE DRIVER PAK ONLINE, THIS WEB SITE HAVE
THOUNSANDS OF DRIVERS.  
http://service.software.ibm.com/os2ddpak/index.htm

-=-> Last choice, replace the UNSUPPORTED COMPONENT for a supported
ONE.  This will depend on your motivation to use OS/2 Warp v4 <-=-=-

OS/2 WARP - SYSTEM REQUIREMENTS
Minimum Hardware Configuration. The hardware requirements for OS/2 
Warp 4 vary depending on the 
options installed and the applications you wish to run on the   
machine. Here are the minimum requirements for 
a typical computer environment: 486 or better CPU, 32MB RAM (or more),
ATAPI CD ROM, 100-300 MB HD.
OS/2 supported sound card for audio and multimedia applications
       
TIP:
If after installing an application you notice problems, edit OS2.INI 
file and remove references to the 
application.

KEY LINKS: --=> These are the best places for  OS/2 information: <=--

Information for OS/2 new users or potential ones:
A must for anyone that want to know the TRUTH about OS/2!
http://www.os2ss.com/Information/NewUsers/
http://www.honeycomb.net/os/oses/os2.htm

EZINES:
http://www.os2ezine.com
http://www.os2ss.com
http://www.edm2.com/
http://os2about.com

OS/2 FILES
http://hobbes.nmsu.edu
http://www.os2bbs.com
http://service.boulder.ibm.com/asd-bin/doc/en_us/catalog.htm
http://www.leo.org/archiv/software/os2/
ftp://merlin.itep.ru   [lss;os2warez]

OS/2 NEWS
http://www.os2ss.com/news
http://www.warpcast.com

VENDORS:
http://www.indelible-blue.com/scott/ibnews.nsf
http://www.bmtmicro.com

JAVA IDES THAT SUPPORT OS/2
Visual Age For JAVA - less than $90
http://www.software.ibm.com/ad/

Netbeans - FREE
http://www.netbeans.com

Simplicity for JAVA
http://www.datarepresentations.com/

Netrexx - FREE
http://www2.hursley.ibm.com/netrexx/

IBM ALPHAWORKS Web Site -  FREE
http://www.alphaWorks.ibm.com/formula

More information about OS/2 and JAVA
http://www.doofus.org/Java/

Check The OS/2 alternative Web Site: 
http://www.tstonramp.com/~freiheit/os2apps.shtml

WIN32 Support in OS/2:
http://www.netlabs.org/odin/

Linux/Unix and OS/2:
http://www.netlabs.org/everblue/

Check OS/2 organizations like:
http://www.netlabs.org
http://en.os2.org

Virtual Pascal
http://www.fprint.co.uk/products/virtual_pascal/

OS/2 and Sound Cards
http://www.tabi.org/timur/crystalos2.html

PKZIP v2.50
http://www.pkware.com

Remember:  Buy those applications  *IF*  you decide to continue use 
them's after 6 months TEST DRIVE

Other links:
Watcom C++ Compiler v11.0a
Nader Letter to IBM:
http://www.zdnet.com/sr/breaking/980608/980608f.html
WWW WYSIWYG editor
http://ourworld.compuserve.com/homepages/clerin/
Large OS/2 Customer list
http://rover.wiesbaden.netsurf.de/~meile/los2cl.html
XIMATI OS/2 Web Server - FREE
http://www.imatix.com/html/xitami/index.htm
V C++ GUI Development framework
http://www.objectcentral.com/
Warp 4  Engage
http://www2.hu-berlin.de/~h0444vnd/os2.htm
White Paper:  Advantages of OS/2 v4 over  WIN NT v4
http://www.minzdat.ch/forum/tanos/pages/merlinnt2.htm
Cable modems and OS/2 Warp v4
http://members.home.net/bhubley/cableintro.html
Blackdeath software
http://sprk.com/blackdeath/
Pillarsoft
http://www.pillarsoft.net/
DIGITAL Cameras and OS/2
http://users.uniserve.ca/~software/dcitu/index.html
Independent developer
http://en.os2.org/projects/indos2/
Config documentation
http://www.online.de/home/os2/csdp/about.htm
The OS/2 HISTORY
http://www.hartnell.cc.ca.us/student/hacnc/altos/OS2History.html
Visual PROLOG
http://www.visual-prolog.com/vip/vipinfo/freeware_version.htm
SETI
http://www.os2ss.com/seti

Like Arcade GAMES?, try M.A.M.E.

http://hobbes.nmsu.edu/cgi-bin/h-search?key=mame&pushbutton=Search
ROMS:
http://www.ArcadeAtHome.com/

Last but not least,we are seeking developers to join OS/2.  Tools 
available includes JAVA, C++ (GNU, Visual 
Age for C++ v4),  Pascal, Rexx, Netrexx. There are others.

THE OS/2 WARP DEVELOPERS TOOLKIT IS AVAILABLE AT ONE OF THE TWO URL'S
PROVIDED HERE. JOIN OS/2 NOW!

Join one of many projects at http://www.netlabs.org

Maybe, it will be WISE to buy OS/2 V4 rather than try to download it 
since it is a 250MB file.  LOTUS SS v1.1 
could be downloaded with EMTEC FTP and resuming file download will be 
required since many users are
connecting to those URL's. YES This message is working!...

Note:
OS/2 v4 is available from Indelible Blue..

NOTE:

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: mail2news@nym.alias.net (1:109/42)

+----------------------------------------------------------------------------+

From: nobody@neuropa.net                                29-Aug-99 14:33:06
  To: All                                               29-Aug-99 15:49:09
Subj: (2/2)  The case for OS/2 Warp, a Super-Charged OS 

If you don't want to bother downloading The OS/2 Warp 250MB file or 
LOTUS SMART SUITE V1.1 (1999) 
Edition , Goto INDELIBLE BLUE:

   * LOTUS SMART SUITE ACADEMIC VERSION IS ONLY $83  (AN648NA)
http://www.indelible-blue.com/ibapps/products.nsf/by+partnumber/AN645N
A

   * OS/2 V4 ACADEMIC VERSION IS ONLY $85 (84H7459)
http://www.indelible-blue.com/ibapps/products.nsf/by+partnumber/84H745
9)

What it takes?  The  GUTS to install OS/2 Are you so GOOD?

TIP:
USE ALT-F1 WHEN BOOTING FAILS.  IT IS NOT COMMON BUT THIS IS A GREAT
TRICK!
 
----------------------------------------------------------------------
--
IMPORTANT NOTE:
If you find this info interesting or useful, save to a file NOW!.  You
don't know when you may need it!.  Also, 
you could make copies (or forward through email) for your friends.  
This guide will not be posted
anymore to usenet.  Maybe someone could post it from time to time...

WHAT YOU CAN DO?:
   * Forward this message to your friends. You could forward through 
an
     anonymous remailer.  More about remailers later..
   * Forward (through anonymous remailers also) to PC Newspersons
        o Techwire
        o Infoworld
        o PC World
        o ZDNet
        o Or other
   * Post (anonymously, if you want) to OS-related Newsgroups
   * Tell PC media you use, like and use OS/2
   * Ask the press for better coverage of OS/2 (ZDNet, Infoworld,
     Techweb)
   * If you are an OS expert and have capabilities and bandwidth
     resources to put online an FTP server,(someone in Europe? 
     or latin america?) with key apps, utils, etc..

Must Have utilities (THE BASICS):

A)    INFOZIP UNZIP (EQUIVALENT TO PKUNZIP.EXE)
ftp://hobbes.nmsu.edu/pub/os2/archiver/unz540x2.exe
Installation:
1)make dir \UNZIP in c: d: or whatever OS/2 partition
2)copy and extract unz540x2.exe into \unzip
3)edit config.sys and add \unzip to the path
4)remember to end \unzip reference in the path with ;

B)    FILE_MANAGER
ftp://ftp.bmtmicro.com/bmtmicro/fm2_301.zip
Installation:
1)make dir \FM2 (or whatever) in c: d: or whatever OS/2 partition
2)copy and extract fm2_301.zip \FM2 (or whatever)
3)run install.cmd

C)    CONFIG.SYS  ANALYZER OPTIMIZER
ftp://hobbes.nmsu.edu/pub/os2/util/config/cfgmt100.zip
Installation
1) Make dir \cfgmt (or whatever)
2) Copy cfgmt100.zip and extract with unzip.exe
3) run install.cmd

D)    EMX (optional, required for some utilities and GNU)
ftp://hobbes.nmsu.edu/pub/os2/dev/emx/v0.9d/emxrt.zip

Installation
1) copy emxrt.zip to c:\ (root)
2) unzip with unzip.exe (it should create a sub-dir \emx, test first 
in
other dir if you want)
3) Add \emx\bin to config.sys path, add emx\dll to config.sys library
path

E)    Sysbench 0.9.e
ftp://hobbes.nmsu.edu/pub/os2/util/benchmark/sysb094e.zip

F)    Memsize - System Resources Monitor
http://www.msen.com/~rpapo

G)    Process Commander (after basic Install, upgrade with pcfix1.zip)
-------------------------------------------------------------------
PC Newsreporters, what we can do with them?.  Ok, we can suggest to 
forward (anonymously) this message to the news person of your choice.
This will tell them how to 'tweak' OS/2 for greater performance.  Linux
user's like to tweak their systems (and press people respect that) we 
have the right to make the same to our 
OS.

You can choose anyone and send this message to make them aware that 
OS/2 can be Super-Charged.  Maybe, one of them could have the guts (or
courage) to make it and run some benchmarks against Win 98, Win 2000,
and Win NT 4.  It should be interesting to see results with  a
Super-Charged OS/2 setup (FP11, DANIS506, and HPFS386) against Win 98,
Win 2000, and Win NT 4.
----------------------------------------------------------------------
--
Newspersons and email contact info...
You may also send a copy of this guide to your prefered newsperson to 
make he(she) aware of the OS/2 
"Tweak" and Tricks included here.  You may want to send via 
anonymous... see below...

 Name                   	email address                 
Publication/WebSite
 Infoworld              	electric@infoworld.com        	InfoWorld
 Mary Joe Foley         	mfoley@zd.com                 	Sm@rtReseller
 Tom Yager              	tyager@maxx.net               	InfoWorld
 Charles Cooper         	charles_cooper@zd.com         	ZDNET News
 Editor                 	pcmag@zd.com                  	PC Magazine 
 John Clyman            	john_clyman@zd.com            	PC Magazine 
 Michael Fitzgerald     	michael_fitzgerald@zd.com     	ZDNET
 Maria Seminerio        	maria_seminerio@zd.com        	ZDNET
 Sean Silverthorne      	sean_silverthorne@zd.com      	ZDNET
 ZDNet Benchmarks 	zdbopwebmaster@zd.com 	ZD Benchmarks
 Scott Berlinato        	scott_berinato@zd.com         	PC Week
 Claudia Graziano       	claudia_graziano@zd.com       	PC Week
 John Madden            	john_madden@zd.com            	PC Week
 James Miller           	james_miller@zd.com           	PC Magazine
 Alan Zeichick          	zeichick@camdenassociates.com TechWeb/CMP
 David Lidski           	dlidsky@zd.com               	PC Magazine
 Sharon Terdeman 	sharon_terdeman@zd.com        	PC Magazine
 Wayne Rash     	wrash@mindspring.com          	TechWeb/CMP
----------------------------------------------------------------------
How to send anonymous email and/or post anonimously to usenet:
http://www.skuz.net/potatoware/reli/UserMan.htm
http://www.replay.com/remailer/
http://mail2news.cjb.net/
ttp://www.mute.dircon.co.uk/remailers.html
http://www.metcorp.com/sean/remail.html
http://www.skuz.net/potatoware/reli/UserMan.htm
NEWSGROUP: alt.privacy.anon-server
thread--=> List of Reliable Remailers --=> Updated daily!

NOTE: SOME REMAILERS ARE UP/AND DOWN EASILY. Test First!, and test 
with
dummy messages to some dummy newsgroup.  

::
request-remailing-to: remailer@replay.com

::
request-remailing-to: remailer@xxxxx.com

::
Anon-post-to:newsgroup
or 
Anon-to: john_doe@columbia.net

##
subject:whatever
----------------------------------------------------------------------
--
Remailers reliability and info...
alt.privacy.anon-server

Attention if you receive this doc, please forward to a fellow worker 
who might be interested in this info...

INTERESTING TIP:
You can forward this message from usenet to your own email account 
(Pronews forward, right side) and 'Edit Message as New' with
Communicator 4.61 and repost to usenet if you want or forward to a
friend or to a newsperson.

Chiao!

Extra:
modify config.sys
SET MENUSFOLLOWPOINTER=YES

and you will have a more functional mouse pointer..ala Win 95!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: mail2news@nym.alias.net (1:109/42)

+----------------------------------------------------------------------------+

From: ape@spacetec.no                                   29-Aug-99 16:54:27
  To: All                                               29-Aug-99 15:49:09
Subj: xscanimage testers ?

From: Asbjoern Pettersen <ape@spacetec.no>

Hello.

I need testers for xscanimage with GIMP/2 since
i have no scanner myself.

xscanimage is a graphical scanner-oriented SANE frontend.

Tester will need:
1. A scanner        :)
2. XFree86/2  
3. sane101b1.zip library
4. Gimp/2 1.1.9 developer version.

Anyone ?


Asbjoern Pettersen

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: spacetec.no (1:109/42)

+----------------------------------------------------------------------------+

From: gbritton@!britton.dhs.org                         29-Aug-99 15:20:02
  To: All                                               29-Aug-99 15:49:09
Subj: Re: Important News From Dan Porter of Innoval

From: "Gerry Britton" <gbritton@!britton.dhs.org>

On Sun, 29 Aug 1999 04:17:33 GMT, Baden Kudrenecky wrote:

>>I have just received the following from Dan Porter of
>>Innoval Systems Solutions, Inc.:
>
>   How do we know this is true, i.e, why didn't i, as a licensed
>JStreet user get any notice about this, and why didn't Dan post
>it anywhere on his WWW site, which BTW, has nothing else on it
>but "Iceptur"?

It's true, Baden. Warpcast carried the announcement from Mr. Porter.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: nobody@neuropa.net                                29-Aug-99 16:22:02
  To: All                                               29-Aug-99 16:52:17
Subj: HPFS386, The Reality...

From: Anonymous <nobody@neuropa.net>

Installing HPFS386 into a Warp v4 client makes your system FASTER!.  If
you think, this hurts IBM, think again.  The reason IBM does'nt include
HPFS386 into Warp v4 is because MS charges HUGE royalties for EACH copy
of HPFS386!.  Therefore, IBM only includes it with Warp Server.

NOTE: HPFS386 makes sense for a stand-alone OS/2 system!, that's because
Partition
Magic is not compatible with it....

Check: alt.binaries.warez.os2

IF YOU ARE AN EXISTING OS/2 WARP USER, YOU MAY IMPROVE SYSTEM FILE I/O
BY 5X TO 10X FACTOR.

NOTE:
Now, that IBM seems to be abandoning OS/2, we must play a guerilla war
strategy to fight Windows and MS.
We all KNOW that OS/2 is superior to the Windows counterpart.  We will
fight with all our resources.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: mail2news@nym.alias.net (1:109/42)

+----------------------------------------------------------------------------+

From: furd@mit.edu                                      29-Aug-99 13:37:14
  To: All                                               29-Aug-99 16:52:17
Subj: Re: Lotues 123G null values question

From: "Frank Field" <furd@mit.edu>

On Sat, 28 Aug 1999 15:59:57 GMT, dpalmer@olywa.net wrote:

:>Has anyone written a macro to change spreadsheets 0's to actual nulls?
:>What else might work?

The best approach would be to (1) import the non-existent data as zeroes,
then to convert them to @NA with a search and replace.  @NA plots as
discontinuities in most plots, as I recall.



Frank Field
furd@alum.mit.edu
O-


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Massachvsetts Institvte of Technology (1:109/42)

+----------------------------------------------------------------------------+

From: nenad@my-deja.com                                 29-Aug-99 17:59:14
  To: All                                               29-Aug-99 16:52:17
Subj: Re: Latest of XFree86?

From: Nenad <nenad@my-deja.com>

  veit@simi.gmd.de (Holger Veit) wrote:

> I have binaries of 3.3.5 for a week at the server but I can't
> release them unless XFree86 themselves does not announce 3.3.5 :-(

Will it work on Aurora?

Nenad


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: nenad@my-deja.com                                 29-Aug-99 17:59:11
  To: All                                               29-Aug-99 16:52:17
Subj: Re: Latest of XFree86?

From: Nenad <nenad@my-deja.com>

  veit@simi.gmd.de (Holger Veit) wrote:

> I have binaries of 3.3.5 for a week at the server but I can't
> release them unless XFree86 themselves does not announce 3.3.5 :-(

Will it work on Aurora?

Nenad


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: spamnot@mylittlepoopoo.net                        29-Aug-99 14:36:02
  To: All                                               29-Aug-99 16:52:17
Subj: Re: Important News From Dan Porter of Innoval

From: "Harry Thompson" <spamnot@mylittlepoopoo.net>

Tim Martin <OS2Guy@WarpCity.com> wrote in message
news:37C899FF.D4371FE0@WarpCity.com...
> I have just received the following from Dan Porter of
> Innoval Systems Solutions, Inc.:
>
> From: Dan Porter  6:21 PM (PST), August 28, 1999
> Subject: InnoVal and OS/2
> To: os2guy@warpcity.com
>
> Effective immediately, InnoVal Systems Solutions, Inc. is withdrawing
> the following products from marketing and support.
>
> Post Road Mailer for OS/2
> J Street Mailer for Java
> Web Willy Watch for OS/2
>
> Anyone may download free copies of these products from our online store

------------------snip----------------------------

Thanks, but no thanks.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ameritech.Net www.ameritech.net  Complaints: abus
(1:109/42)

+----------------------------------------------------------------------------+

From: virobik@MAPS.onr.com                              28-Aug-99 19:17:09
  To: All                                               29-Aug-99 19:53:18
Subj: Re: Smack - speedy resolution

From: virobik@MAPS.onr.com

I got my version via e-mail. send a note to "sales@perfectniche.com" 

kevin

On Sat, 28 Aug 1999 22:40:17, "Esko Kauppinen" 
<esko.kauppinen@ibm.net> wrote:

> On Thu, 26 Aug 1999 00:19:11 GMT, virobik@MAPS.onr.com wrote:
> 
> >Anyone who has to print labels on a regular (or irregular) basis under
> >OS/2 should own this program. Highly recommended. 
> >(www.perfectniche.com).
> 
> Sounds interesting but why isn't it available by e-mail? 
> Does it include a manual?
> Ordering by post just brings extra cost ( to get here in europe ).
> 
> Also some screenshots would be nice.
> 
> By the way, this site seems to be problematic to my NS4.61B2.
> It just silently died three times when I was visiting the site.  
> 
> 

virobik@MAPS.onr.com
Please remove "MAPS." when replying

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Onramp Access, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: ibm.net@ibm.net                                   29-Aug-99 15:18:16
  To: All                                               29-Aug-99 19:53:18
Subj: CAD recommendation

From: ibm.net@ibm.net (SERWAS1)

-----------------------------------------------------------
Greetings all,

Would appreciate any advise on a CAD program, or a good drawing program.

I've been using IBM's very old CAD for os2 and it's too arcane, giving
what's available in windose.

Any help is appreciated.

Mat

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: cstumpf@monmouth.com                              29-Aug-99 15:41:14
  To: All                                               29-Aug-99 19:53:18
Subj: Re: CAD recommendation

From: "Chris Stumpf" <cstumpf@monmouth.com>

The only CAD programs I know of for OS/2 are BlueCad and Microstation. 
BluCad is an inexpensive program from italy and is for basic 2D drawing. 
Microstation is a full blown cad package from Bentley in the same realm as
AutoCad, that includes price.  Bentley's student discounts are very good
though.  I think you can get it for about $250 instead of $3000 with the
student discount.  If you only need the the feaures that the core program
provides, Microstation is an excellent choice as they support many platforms.
 There are almost no add ons for the OS/2 version though.  Here is there url:


		http://www.bentley.com


On Sun, 29 Aug 1999 15:18:33 -0400, SERWAS1 wrote:

:>-----------------------------------------------------------
:>Greetings all,
:>
:>Would appreciate any advise on a CAD program, or a good drawing program.
:>
:>I've been using IBM's very old CAD for os2 and it's too arcane, giving
:>what's available in windose.
:>
:>Any help is appreciated.
:>
:>Mat



		Chris Stumpf
		C.S.E. Computer Services (serving central New Jersey)
		Computer Consultant (OS/2, Lan, Wan)
		Team OS/2
		IBM Certified Systems Expert - OS/2 Warp 4

email:	cstumpf@monmouth.com
phone: (732)918-2480


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Monmouth Internet (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               29-Aug-99 22:42:00
  To: All                                               29-Aug-99 19:53:19
Subj: Re: Warp4-and-HPFS386

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Kelly Robinson schrieb:
> 
> Man, you OS/2 people are so loyal and faithful and not above the law...

Oh well... If you'd read these groups on a more or less regular basis
you would have noticed that this special person has posted messages like
this some times before and that he got a lot of replies of people
expressing their discomfort with him doing so. So far as for you saying
"you OS/2 people". And you won't find any shareware or commercial
software on my computer that's not been paid/registered, be it OS/2
software or Windows games.

BTW, what about the estimated 90% of non-corporate Windows users that
have more or less all of their software pirated? And that's what they
call software availability, nearly everybody has illegal copies of MS
Office or the like.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  29-Aug-99 17:16:11
  To: All                                               29-Aug-99 19:53:19
Subj: Re: Sony VAIO os2 compatibility

From: mchasson@ibm.net

In <37c340dc@news.sisna.com>, on 08/24/99 at 07:03 PM,
   blevins@sisna.com said:

>I'm looking at a 1-2 yr old Sony Notebook PCG-705 P150mmx, with Sony
>modem. In a few minutes it loaded Warp3, but I didn't get to try the
>modem. Do any of you os2 users have any experience with this machine? I
>run mainly  os2 apps and use the internet. I'm upgrading from a 486 /
>100. Thanks for the support that allows me to continue using os2. Steve
>Blevins

My wife has a 1 Year old Sony under W98.  Since she gave up with CPM on
the original Osborne, the operating system is of no interest to her.  As
for the modem, I can tell you that I could not get any decent strings for
the init.  Sony did not have a clue, and I guess probably still doesn't. 
Hers is a Rockwell chip.  The only way to make it work well is to try to
disable dual mode, and in this I failed.  In any event PCMCIA is pretty
cheap these days and may be the way to go if you dont like the internal. -- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: rjfreem@ibm.net                                   29-Aug-99 15:16:24
  To: All                                               30-Aug-99 03:42:11
Subj: Re: No desktop!

From: rjfreem@ibm.net

In <7q99u1$c3p$1@gaia.ns.utk.edu>, on 08/28/99 
   at 06:31 PM, rdegenna@utk.edu said:

I can't help your problem as I have had similar failures in the past. What
has not failed, has been many restorations via XCOPY. You will need a
maintance partition on a hard drive other than that on which OS2 exits.
Use the WPS option of BOOTOS2 to create the partition . XCOPY /S /E /V /H
/R /T C:\*.* D:\C8-29   Running xcopy from a floppy boot is very slow. RJF


>My son's 486, dedicated to games, had a disk crash.  OS/2 4.0 fix 10 is
>on an  ide drive C:.  The scsi drive, D:, is the one that crashed.  I had
>most of the  stuff backed up, and it was just games anyway, so that isn't
>a problem (a  low-level format seems to have fixed the drive, too).

>So, just restore to D: and be on my way, right?  Not so: The system can
>no  longer find my desktop (It creates a temporary one.)

>I have NINE backups of my desktop: three Unimaint, three Deskman, and
>three  by OS/2.  NONE of those nine can find a working desktop.  Only
>once (the  newest Unimaint) did I get a desktop other than a temporary
>one, and that  failed again almost immediately.  And now, that same
>Unimaint backup can no  longer produce a working desktop.

>Short of a complete reinstall of OS/2, what can I do?

>Thanks,

>Ray DeGennaro

-- 
-----------------------------------------------------------
rjfreem@ibm.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: ernfisch@home.com                                 29-Aug-99 23:07:21
  To: All                                               30-Aug-99 03:42:11
Subj: Re: CAD recommendation

From: ernfisch@home.com (Ernie Fisch)

On Sun, 29 Aug 1999 19:18:33, ibm.net@ibm.net (SERWAS1) wrote:

> 
> Would appreciate any advise on a CAD program, or a good drawing program.
> 
> I've been using IBM's very old CAD for os2 and it's too arcane, giving
> what's available in windose.

My primary CAD program is Generic CADD 6.1, a DOS program.  It runs 
very nicely
under DOS in OS/2.

It is an old program.  I have a much newer version of ACADLT that runs
under Windows.
I do all of my design in Generic CADD because it works and I know it.

ernie fisch

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: sdenbes1@san.rr.com                               29-Aug-99 16:24:09
  To: All                                               30-Aug-99 03:42:11
Subj: Re: Warp4-and-HPFS386

From: sdenbes1@san.rr.com (Steven C. Den Beste)

On Sun, 29 Aug 1999 22:42:01 +0200, Christian Hennecke recycled some holes
into the following pattern:

>Kelly Robinson schrieb:
>> 
>> Man, you OS/2 people are so loyal and faithful and not above the law...
>
>Oh well... If you'd read these groups on a more or less regular basis
>you would have noticed that this special person has posted messages like
>this some times before and that he got a lot of replies of people
>expressing their discomfort with him doing so. So far as for you saying
>"you OS/2 people". And you won't find any shareware or commercial
>software on my computer that's not been paid/registered, be it OS/2
>software or Windows games.
>
>BTW, what about the estimated 90% of non-corporate Windows users that
>have more or less all of their software pirated? And that's what they
>call software availability, nearly everybody has illegal copies of MS
>Office or the like.
>
>Christian Hennecke

I think you may have gotten that statistic slightly wrong. 90% of Windows
users which steal 100% of their software? Not likely...

I think maybe it's more like 90% of Windows users who steal >0% of their
software. That's a much different thing. And come to think of it, I bet
that's equally true for OS/2 users.

Let's try to keep the hateful hyperbole under control, shall we?

--------
Steven C. Den Beste    sdenbes1@san.rr.com
Home page: http://home.san.rr.com/denbeste

"My hovercraft is full of eels."

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Time Warner Cable of San Diego, CA (1:109/42)

+----------------------------------------------------------------------------+

From: mikelrob@206.149.24.9                             30-Aug-99 00:39:13
  To: All                                               30-Aug-99 03:42:11
Subj: Re: Can't retrieve mail

From: mikelrob@206.149.24.9 (Michael Robertson)

In article <geribeurzfyrlqvnycvcrkpbz.fh8grr1.pminews@news.dial.pipex.com>,
"Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com> wrote:
>
><Yuck, all one line!>

	My lines come out OK in YARN and in Smalled, which is the editor I use to
write my replies.  What is making them one line for you?

>Possibility #1 - someone has zipped up and sent you their entire computer!
>It has a gigantic attachment and you're seeing it working correctly. The
>percentage of the message retrieved really hasn't gone over 0%!

	I had already tried this.  It was Flashnets one suggestion.  They checked the
message lengths for me and none of them was big.  I also deleted message one
and
no luck.

>I've also seen problems like this. In my case I had to adjust the MTU size
>of my ppp connection before it would work. Try running netstat -n to find
>out what your current MTU size is then adjust it using
>
>ifconfig ppp0 mtu 1006
>
>and keep reducing the number 'til it works. Give up if you hit 512 bytes
>and it still doesn't work.
>
	This did the trick!  I reduced it to 512 and it works like a charm.  Thanks
much
Trevor.  You, and the other OS2 gurus like you, are not the least reason why
this is
my OS of choice.

-- 
Michael Robertson                  
>>>>Live simply, that others may simply live<<<<

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: stevem@execpc.com                                 29-Aug-99 20:03:03
  To: All                                               30-Aug-99 03:42:11
Subj: Re: Important News From Dan Porter of Innoval

From: "Steve McCrystal" <stevem@execpc.com>

On Sun, 29 Aug 1999 04:17:33 GMT, Baden Kudrenecky wrote:

>why didn't i, as a licensed JStreet user get any notice about this,

Why didn't I, as a registered user of two of the three programs in question? 
Who the hell know.  Who 
cares.  Trust me, it's true.

> and why didn't Dan post it anywhere on his WWW site, 

Innoval hasn't done anything with their site in some time now.  In fact, you
get linked to Yahoo, IIRC.  



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ExecPC Internet - Milwaukee, WI (1:109/42)

+----------------------------------------------------------------------------+

From: joehenley@worldnet.att.net                        29-Aug-99 20:58:17
  To: All                                               30-Aug-99 05:29:12
Subj: Re: Wanted: Driver for Yamaha YMF724 Sound Card

From: "Joseph O. Henley" <joehenley@worldnet.att.net>

Anyone know if these drivers will work on the Yamaha 740 DS1-L PCI
chip.  I have one of those on my Intel mobo SE440BX-2.  It's disabled
now and I'm using my trusty OLD Creative Labs ISA card.  But I'd love to
use the 740 on the mobo if possible.

Joe

Lorne Sunley wrote:
> 
> It was just added to the list of drivers at the IBM Device Driver Pack
> 
> Look under "Multimedia Audio" - "Yamaha Corporation of America"
> 
> Lorne Sunley
> 
> On Mon, 19 Jul 1999 21:46:39, Tim Martin <OS2Guy@WarpCity.com> wrote:
> 
> > OS/2 user seeking driver for Yamaha YMF724
> > sound card.
> >
> > If you know the status of such a driver or one
> > that can be used in place (generic?) please
> > post here or email me personally.  Thank you.
> >
> > Tim Martin
> > The OS/2 Guy
> > Warp City
> > http://warpcity.com
> > "E-ride the wild surf to Warp City!"
> >

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                30-Aug-99 02:07:11
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Important News From Dan Porter of Innoval

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <37C8BBE3.90229050@WarpCity.com>, Tim Martin <OS2Guy@WarpCity.com> writes:
>Baden Kudrenecky wrote:

>the second message from Dan Porter regarding the  "J Street Mailer
>Initiative".  Warp City has been running exclusive JSM information, files
>and upgrades offered by Samatra Software (Paul vanKeep and now
>Mike Bowler) to Warp City members, many of whom use JSM.  Dan
>may have submitted it to us (Warp City) because he feels confident
>we will report his feelings, public statements and support of the
>the newly created JSM Initiative.  InnoVal has every right on earth
>to be proud as punch of JSM.  It is the finest 100% Java emailer
>program on the market today.  Emerald Mail, MailPuccini and the
>other entries have yet to equal the quality and features of JSM.
>
>Paul vanKeep and Mike Bowler have stepped forward to devote
>their personal time and extraordinary Java programming skills
>to ensure J Street Mailer stays 'out front' in the Java Emailer
>category.  They have released a flurry of upgrades over the
>last few weeks and are improving JSM with each release.  Another
>release is expected any day now (PVK8).  A long list of new features
>and bug fixes have been released.  Paul and Mike intend on improving
>the quality of JSM beyond its current high quality state.  Their time,
>efforts and exemplary work have all been offered for free because of
>their admiration for the fine J Street Mailer.  JSM runs on Linux,
>Windows95/98/NT, Mac and especially well on OS/2.   One program
>that runs under all operating systems.  It is an amazing piece of
>work created by InnoVal.

   Where can obtain the JStreet updates, as there was not on
Innoval's site, even before they ditched everything?

   I am currently looking for a new mail program to replace
UltiMail, and I am testing PMMail, JStreet, and now Post Road,
and the only program that even comes close to my acceptability,
is JStreet, however, it's memory footprint is huge, and that may
preclude me from using it, and besides, I would like to actually
support native OS/2 software.


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: "operagost"@e-mail.com (remove t...               30-Aug-99 02:27:29
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Important News From Dan Porter of Innoval

Message sender: "operagost"@e-mail.com (remove the - )

From: Stephen Eickhoff <"operagost"@e-mail.com (remove the - )>


Tim Martin wrote:

> I have just received the following from Dan Porter of
> Innoval Systems Solutions, Inc.:
>
> From: Dan Porter  6:21 PM (PST), August 28, 1999
> Subject: InnoVal and OS/2
> To: os2guy@warpcity.com
>
> Effective immediately, InnoVal Systems Solutions, Inc. is withdrawing
> the following products from marketing and support.
>
> Post Road Mailer for OS/2
> J Street Mailer for Java
> Web Willy Watch for OS/2

Join the club of plane-jumpers!

>
> Anyone may download free copies of these products from our online store
> at http://stores.yahoo.com/innoval. In addition, anyone may freely
> distribute executable copies of the software through online software
> repositories and websites. You are encouraged to do so because we will
> only be able to keep them in our online store for a limited time. If you

Ooh, I can have a product that will be obsolete in months for FREE!

> For me, personally, this is a sad day. Our company tried to hang in as
> long as possible with OS/2. OS/2 is still my favorite platform and OS/2
> customers are the best customers our company ever had. I have made many
> good friends through my associations with all of you. You ll still see
> me popping in at OS/2 users group meetings throughout the country when
> my travels coincide with a meeting.

I certainly can't speak for everyone, but I'd rather not see ya.

What are you going to do, convince us to move to Windows so we can use your
products?

>
> Our company continues to do very well. The consulting side of the
> business has always been strong. The most exciting area of business,
> however, is Iceptur. Iceptur is our new Internet filtering software for
> the Windows 95/98/NT platform. Despite the fact that there are over two
> hundred competitors in this market niche, we are experiencing phenomenal

>
> success. This is partly because of the unique technology we developed
> and partly because there is a strong demand for high quality Internet
> filtering solutions (release 2.0 will hit the streets by September 5th).

I doubt it. Everyone I speak to has never heard of your company. And I was
plugging Web Willy, it was a product that was actually more than just a
pattern matcher.
However, it's unlikely you'll be able to pull away much market from Cyber
Patrol, much less Microsoft when they enter the market any day now.

>
> We have entered into a number of strategic alliances with several
> companies to market Iceptur and license the underlying technology for
> use in other products.
>

Oh, I guess the terms of the contract was to ditch OS/2.
Hope one of them is MS, if you intend to survive.

>
> I need, now, to focus all of InnoVal s resources on Iceptur and our
> consulting business. I tried, during the past year, to juggle resources
> but in doing so was not doing the right kind of job for our customers,
> the OS/2 community at-large, InnoVal s employees, or InnoVal s owners.
> You made the Post Road Mailer into the number one email client for OS/2.
>

When was that? Nobody I know uses it. It's between PMMail and Netscape.

>
> You worked with us on J Street Mailer as we tried to negotiate a
> platform independent course with Java. You have my thanks and the thanks
>
> of everyone at InnoVal.

Sorry you failed. Better luck with  0.5% of that crowded niche you were
talking about.

>
> We are moving on to bigger things, but not better. OS/2 was better and
> (oh, how I wish) it could have been big.

Lip service.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: "operagost"@e-mail.com (remove t...               30-Aug-99 02:28:29
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Important News From Dan Porter of Innoval

Message sender: "operagost"@e-mail.com (remove the - )

From: Stephen Eickhoff <"operagost"@e-mail.com (remove the - )>


Baden Kudrenecky wrote:

> In <37C899FF.D4371FE0@WarpCity.com>, Tim Martin <OS2Guy@WarpCity.com>
writes:
> >I have just received the following from Dan Porter of
> >Innoval Systems Solutions, Inc.:
>
>    How do we know this is true, i.e, why didn't i, as a licensed
> JStreet user get any notice about this, and why didn't Dan post
> it anywhere on his WWW site, which BTW, has nothing else on it
> but "Iceptur"?

Because Innoval doesn't care about you anymore, now that they got a sack of
money
from their partners.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: "operagost"@e-mail.com (remove t...               30-Aug-99 02:32:11
  To: All                                               30-Aug-99 05:29:13
Subj: Re:  The case for OS/2 Warp, a Super-Charged 

Message sender: "operagost"@e-mail.com (remove the - )

From: Stephen Eickhoff <"operagost"@e-mail.com (remove the - )>

> IMPORTANT!!!
>
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~
> HPFS386 IS NOT COMPATIBLE WITH PARTITION MAGIC (ACL).  Also, you could
> have BIG trouble executing HD utils NOT compatible with HPFS386!. This
> makes
> sense for an standalone OS/2 system.
>
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~

It is compatible. You just have to back up and remove your ACLs first using
PREPACL.

Do a "help prepacl".

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          30-Aug-99 03:07:07
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Important News From Dan Porter of Innoval

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 30 Aug 1999 02:27:59, Stephen Eickhoff <"operagost"@e-mail.com 
(remove the - )> a crit dans un message:

> >
> > Anyone may download free copies of these products from our online store
> > at http://stores.yahoo.com/innoval. In addition, anyone may freely
> > distribute executable copies of the software through online software
> > repositories and websites. You are encouraged to do so because we will
> > only be able to keep them in our online store for a limited time. If you
> 
> Ooh, I can have a product that will be obsolete in months for FREE!

My sentiments, too, except that I've been listening all along for the words
"Open Source" which I haven't heard.

Open Source on these abandoned products would be a nice sincere touch, in 
my opinion. (And I won't mention the money I spent on Innoval products that
had been abandoned long before now, and already written off as useless.)

There's also the factor of the ongoing developers like Nick Knight, who may
or may not see a downward blip in their registrations when a competing mail
client gets dumped for free. For anybody considering this, I'll just say 
here that I've owned both Postroad and MR2 mail and have used MR2 
exclusively.

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                30-Aug-99 03:15:26
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Important News From Dan Porter of Innoval

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <P_ly3.343$cM2.81390@typhoon1.gnilink.net>, Stephen Eickhoff
<"operagost"@e-mail.com (remove the - )> writes:

   Who the hell are you?  You sure aren't an OS/2 user, or you
would know about Innoval and their products.  You sure aren't a
positive person, or you would not have posted this crap.  I have
nothing but praise for Innoval's products, and I am only sorry
that there was not enough revenue to help keep Dan supporting 
his discontinued products.


>Tim Martin wrote:
>
>> I have just received the following from Dan Porter of
>> Innoval Systems Solutions, Inc.:
>>
>> From: Dan Porter  6:21 PM (PST), August 28, 1999
>> Subject: InnoVal and OS/2
>> To: os2guy@warpcity.com
>>
>> Effective immediately, InnoVal Systems Solutions, Inc. is withdrawing
>> the following products from marketing and support.
>>
>> Post Road Mailer for OS/2
>> J Street Mailer for Java
>> Web Willy Watch for OS/2
>
>Join the club of plane-jumpers!
>
>>
>> Anyone may download free copies of these products from our online store
>> at http://stores.yahoo.com/innoval. In addition, anyone may freely
>> distribute executable copies of the software through online software
>> repositories and websites. You are encouraged to do so because we will
>> only be able to keep them in our online store for a limited time. If you
>
>Ooh, I can have a product that will be obsolete in months for FREE!

   So, I paid for it, and I'm not complaining.  They still work.

>> For me, personally, this is a sad day. Our company tried to hang in as
>> long as possible with OS/2. OS/2 is still my favorite platform and OS/2
>> customers are the best customers our company ever had. I have made many
>> good friends through my associations with all of you. You ll still see
>> me popping in at OS/2 users group meetings throughout the country when
>> my travels coincide with a meeting.
>
>I certainly can't speak for everyone, but I'd rather not see ya.
>
>What are you going to do, convince us to move to Windows so we can use your
>products?
>
>>
>> Our company continues to do very well. The consulting side of the
>> business has always been strong. The most exciting area of business,
>> however, is Iceptur. Iceptur is our new Internet filtering software for
>> the Windows 95/98/NT platform. Despite the fact that there are over two
>> hundred competitors in this market niche, we are experiencing phenomenal
>
>>
>> success. This is partly because of the unique technology we developed
>> and partly because there is a strong demand for high quality Internet
>> filtering solutions (release 2.0 will hit the streets by September 5th).
>
>I doubt it. Everyone I speak to has never heard of your company. And I was
>plugging Web Willy, it was a product that was actually more than just a
>pattern matcher.
>However, it's unlikely you'll be able to pull away much market from Cyber
>Patrol, much less Microsoft when they enter the market any day now.
>
>>
>> We have entered into a number of strategic alliances with several
>> companies to market Iceptur and license the underlying technology for
>> use in other products.
>>
>
>Oh, I guess the terms of the contract was to ditch OS/2.
>Hope one of them is MS, if you intend to survive.
>
>>
>> I need, now, to focus all of InnoVal s resources on Iceptur and our
>> consulting business. I tried, during the past year, to juggle resources
>> but in doing so was not doing the right kind of job for our customers,
>> the OS/2 community at-large, InnoVal s employees, or InnoVal s owners.
>> You made the Post Road Mailer into the number one email client for OS/2.
>>
>
>When was that? Nobody I know uses it. It's between PMMail and Netscape.
>
>>
>> You worked with us on J Street Mailer as we tried to negotiate a
>> platform independent course with Java. You have my thanks and the thanks
>>
>> of everyone at InnoVal.
>
>Sorry you failed. Better luck with  0.5% of that crowded niche you were
>talking about.
>
>>
>> We are moving on to bigger things, but not better. OS/2 was better and
>> (oh, how I wish) it could have been big.
>
>Lip service.


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: yaztromo@idirect.com                              29-Aug-99 23:36:01
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Important News From Dan Porter of Innoval

From: Brad Barclay <yaztromo@idirect.com>

Buddy Donnelly wrote:

> On Mon, 30 Aug 1999 02:27:59, Stephen Eickhoff <"operagost"@e-mail.com
> (remove the - )> a ?crit dans un message:
>
> > >
> > > Anyone may download free copies of these products from our online store
> > > at http://stores.yahoo.com/innoval. In addition, anyone may freely
> > > distribute executable copies of the software through online software
> > > repositories and websites. You are encouraged to do so because we will
> > > only be able to keep them in our online store for a limited time. If you
> >
> > Ooh, I can have a product that will be obsolete in months for FREE!
>
> My sentiments, too, except that I've been listening all along for the words
> "Open Source" which I haven't heard.

    Why - are POP and SMTP suddenly going to change?  These protocols have
been
around for years and are quite stable.

    There isn't much you can do with an E-Mail program these days.  When it's
done, it's done.  The protocols won't be changing anytime soon, so unless you
plan on moving to a Microsoft Exchange based E-Mail system, these products
will
continue to work for many, many, many years, without being obsolete.

Brad BARCLAY


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: rw@nospam.net                                     29-Aug-99 23:43:10
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Important News From Dan Porter of Innoval

From: "Heinz Weissmuller" <rw@nospam.net>

Baden Kudrenecky <baden@unixg.ubc.ca> wrote in message
news:JHmy3.6058$2k6.77680@news1.rdc1.bc.home.com...
> In <P_ly3.343$cM2.81390@typhoon1.gnilink.net>, Stephen Eickhoff
<"operagost"@e-mail.com (remove the - )> writes:
>
>    Who the hell are you?  You sure aren't an OS/2 user, or you
> would know about Innoval and their products.

I was an OS/2 user once... Never cared for Innoval stuff, and now I don't
care for OS/2. Don't spam me, OK?

>You sure aren't a
> positive person, or you would not have posted this crap.

Give me an example of a "positive person" so that I can post to your liking.

> I have
> nothing but praise for Innoval's products, and I am only sorry
> that there was not enough revenue to help keep Dan supporting
> his discontinued products.

Why don't you send him your piggybank?




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ameritech.Net www.ameritech.net  Complaints: abus
(1:109/42)

+----------------------------------------------------------------------------+

From: mike.luther@ziplog.com                            30-Aug-99 04:34:16
  To: All                                               30-Aug-99 05:29:13
Subj: Re: No desktop!

From: mike.luther@ziplog.com

In <37c9b372$2$ewserrz$mr2ice@news-s01.ny.us.ibm.net>, rjfreem@ibm.net writes:
>In <7q99u1$c3p$1@gaia.ns.utk.edu>, on 08/28/99 
>   at 06:31 PM, rdegenna@utk.edu said:
>
>
>>Short of a complete reinstall of OS/2, what can I do?
>
>>Thanks,
>
>>Ray DeGennaro

Ray .. before you give up and tru re-install, get a copy of CHECKINI
that is part of the WPTOOL29.ZIP suite.  It's on Hobbs, current version
is Version 29, to my knowledge - that's what the #29 means.

Read the docs carefully and try it.  A similar accident took down my
Desktop recently and CHECKINI was able to recover it...

My situation was to the point where the only way I could get to the
Desktop was to use the SET DESKTOP=C:\DESKTOP deal in CONFIG.SYS and
Unimaint couldn't recover it by itself...

Worth a try rather than a complete re-install..

//-----------------------------------
Mike.Luther@ziplog.com
Mike.Luther@f3000.n117.z1.fidonet.org


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: esko.kauppinen@ibm.net                            30-Aug-99 07:37:05
  To: All                                               30-Aug-99 05:29:13
Subj: Re: Smack - speedy resolution

From: "Esko Kauppinen" <esko.kauppinen@ibm.net>

On Sat, 28 Aug 1999 19:17:19 GMT, virobik@MAPS.onr.com wrote:

>I got my version via e-mail. send a note to "sales@perfectniche.com" 
>
>kevin

OK, thanks. Got message that it is available at BMT so I ordered
it from there.

Esko


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: domi@kenavo.NOSPAM.fi                             30-Aug-99 05:55:07
  To: All                                               30-Aug-99 12:22:12
Subj: Re: Important News From Dan Porter of Innoval

From: domi@kenavo.NOSPAM.fi (Dominique Pivard)

On Mon, 30 Aug 1999 02:07:23, baden@unixg.ubc.ca   (Baden Kudrenecky) 
wrote:

>   I am currently looking for a new mail program to replace
> UltiMail, and I am testing PMMail, JStreet, and now Post Road,
> and the only program that even comes close to my acceptability,
> is JStreet, however, it's memory footprint is huge, and that may
> preclude me from using it, and besides, I would like to actually
> support native OS/2 software.

Have you had a look at Nick Knight's MR2/ICE? He's still supporting 
and enhancing his product (version 1.62 was just released).

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: sdenbes1@san.rr.com                               29-Aug-99 22:37:22
  To: All                                               30-Aug-99 12:22:12
Subj: Re: Important News From Dan Porter of Innoval

From: sdenbes1@san.rr.com (Steven C. Den Beste)

On Sun, 29 Aug 1999 23:36:03 -0400, Brad Barclay recycled some holes into
the following pattern:

>Buddy Donnelly wrote:
>
>> On Mon, 30 Aug 1999 02:27:59, Stephen Eickhoff <"operagost"@e-mail.com
>> (remove the - )> a ?crit dans un message:
>>
>> > >
>> > > Anyone may download free copies of these products from our online store
>> > > at http://stores.yahoo.com/innoval. In addition, anyone may freely
>> > > distribute executable copies of the software through online software
>> > > repositories and websites. You are encouraged to do so because we will
>> > > only be able to keep them in our online store for a limited time. If
you
>> >
>> > Ooh, I can have a product that will be obsolete in months for FREE!
>>
>> My sentiments, too, except that I've been listening all along for the words
>> "Open Source" which I haven't heard.
>
>    Why - are POP and SMTP suddenly going to change?  These protocols have
been
>around for years and are quite stable.
>
>    There isn't much you can do with an E-Mail program these days.  When it's
>done, it's done.  The protocols won't be changing anytime soon, so unless you
>plan on moving to a Microsoft Exchange based E-Mail system, these products
will
>continue to work for many, many, many years, without being obsolete.
>
>Brad BARCLAY
>

Sorry to disagree with you, but in fact there's a lot you can do with a mail
program.

How about more intelligent filtering? (Agent lets me use regular expressions
on the subject line, but I'd like to be able to filter on the contents of a
message, so that anything which contains the phrase "MLM" goes straight into
the trash bin.) Automated responses to messages? ("I'm on vacation right
now, but I'll get back to you in two weeks.")

Better folder manipulation?

Searching of folders using complex search rules?

Easy connection to multiple servers?

Oh, I can think of many things. The interface with the mail server may be
mature, but there's much that can be done with the interface with the human
user.

--------
Steven C. Den Beste    sdenbes1@san.rr.com
Home page: http://home.san.rr.com/denbeste

"We're just ordinary earthlings, not weirdos from another planet!"
              -- Calvin

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Time Warner Cable of San Diego, CA (1:109/42)

+----------------------------------------------------------------------------+

From: karin@btsoftware.com                              30-Aug-99 09:58:02
  To: All                                               30-Aug-99 12:22:13
Subj: HomePage Publisher  !!!!!!!

From: "karin" <karin@btsoftware.com>

HomePage Publisher 
**************************

HomePage Publisher (HPP) is a WYSIWYG Web Page Design tool for 
OS/2.

HPP is an integrated WYSIWYG HTML Publisher and Editor/Browser. 
HomePage is a new product that will allow you to create or modify any 
HTML pages. Easy to use, it does not require knowledge of HTML tags. 
With HPP, you will be able to modify pages and images directly in your 
document. Select text and objects you want to
change attributes of and make changes by simply clicking toolbars, etc... 
In short, HPP is a Web browser that offers you, as an extra, all the 
possibilities of a word processor. HomePage generates a high quality 
HTML code.

HomePage Publisher Version 2.1 includes Frames support, DBCS, 
Publishing, Drag/Drop, Undo/Redo, Toolbar Designer, Dictionary, and 
more...
  


Check it out and download HomePage Publisher for a free trial period 
from:
	http://www.btsoftware.com/os2/hpp.htm




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: karin (1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            30-Aug-99 08:17:29
  To: All                                               30-Aug-99 12:22:13
Subj: Re: 4-digit year in 'dir' list??

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On Fri, 27 Aug 1999 12:54:09 -0500, Jim Lewis <jklewis@nospam.com> wrote:
>Stan Goodman wrote:
>
>> There are probably a lot of people around that can't remember what century
>> this is, and that would therefore find the program useful.
>>
>
>  Even worse are the people who blindly think that the files they currently
have
>today all have a century number of 19.  The dir command only shows the last 2
>digits regardless of the century and this has caused quite a few problems in
Y2K
>testing. That was the main reason I modified my file finder to display a
4-digit
>year and is why I'm writing this other program now.
>
> It's almost done already, are there any beta testers out there? All you have 
to
>do is put it on your path and run it. It will not do anything to your INI
files
>or to config.sys, etc. So far it shows filename, size, creation date/time,
and
>last update. I plan to add the file attributes, and the size of the EAs if
any
>(when I figure out how to do that).

Hi Jim,

  thanks for your effort. Being probably one of the younger command line
kind of guys who still started on punch cards (there was a time when I
could _read_ them holding them against the light!) I'll be very happy to
use & test your tool. I was always pondering writing a REXX script
myself, but I trust you're "where I want to go tomorrow" already :-)

 Cheers,
               Stefan


-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: volker.zielowski@huk-coburg.de                    30-Aug-99 10:19:01
  To: All                                               30-Aug-99 12:22:13
Subj: Printing Problem with Comm 404 & PSCRIPT

From: Volker Zielowski <volker.zielowski@huk-coburg.de>

Hello Folks:

I have the following Problem:

Netscape Comm 4.04, OS/2 Warp 4 Fixpack 6 and Lexmark Optra PostScript
Driver.
Netscape seems to smear its own Postscript, because i'm not able to
choose any paper trays. The printer always picks its paper from
default-tray.
I printed ps-files with different settings (upper and lower tray), but
there's absolutely no difference between these files. Netscape 2.02 has
proper entries in its ps-files for choosing trays.
So: Is there any way to avoid applications to interact with the
postscript driver - maybe a system-wide option?
I know this is possible from some win-installations. Or may be there is
another way...
Please mail to 
mailto:volker.zielowski@huk-coburg.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: T-Online (1:109/42)

+----------------------------------------------------------------------------+

From: volker.zielowski@huk-coburg.de                    30-Aug-99 10:19:29
  To: All                                               30-Aug-99 12:22:13
Subj: Printing Problem with Comm 404 & PSCRIPT

From: Volker Zielowski <volker.zielowski@huk-coburg.de>

Hello Folks:

I have the following Problem:

Netscape Comm 4.04, OS/2 Warp 4 Fixpack 6 and Lexmark Optra PostScript
Driver.
Netscape seems to smear its own Postscript, because i'm not able to
choose any paper trays. The printer always picks its paper from
default-tray.
I printed ps-files with different settings (upper and lower tray), but
there's absolutely no difference between these files. Netscape 2.02 has
proper entries in its ps-files for choosing trays.
So: Is there any way to avoid applications to interact with the
postscript driver - maybe a system-wide option?
I know this is possible from some win-installations. Or may be there is
another way...
Please mail to 
mailto:volker.zielowski@huk-coburg.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: T-Online (1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            30-Aug-99 08:25:08
  To: All                                               30-Aug-99 12:22:13
Subj: Re: 4-digit year in 'dir' list??

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On 29 Aug 1999 03:56:22 GMT, your.user.name@your.host.name
<your.user.name@your.host.name> wrote:
>In article <37C6A580.9A360C36@nospam.com>, Jim Lewis wrote:
>>Stefan A. Deutscher wrote:
>>> On Fri, 27 Aug 1999 01:35:22 GMT, John Thompson
>>> <nospam@savebandwidth.invalid> wrote:
>>> >In <37C5A4F0.3924@ibm.net>, Wm D Loughman <wdlkhl@ibm.net> writes:
>>> >>After changing from FAT partions to HPFS partions, I re-installed
>>> >>Warp-4, FP-9.  My 'dir' listings show (only) 2-digit years.  Am I
>>> >>imagining, that before this I had a 4-digit year in my 'dir'
>>> >>listings?? If this isn't pure invention on my part, how do I get
>>> >>back to 4-digit years?
>>> >I've never seen 4-digit years displayed in a commnd-line directory
>>> >listing.  Perhaps you're thinking of the folder "Details view"
>>> >which does show a 4-digit year.

[snip]

>>> And boy would I wish they'd add a switch to show full time (4 digit
>>> year), as well as last access and creation times also from the
>>> command line!  I know it can be done with REXX and what not, but
>>> that's not the
>
>How do you do that in REXX, please?   (Stefan?) 

Short reply:  1. Let me quote my Tae-Kwon Do Master: You just do it :-)
Longer reply: 2. Read the online docs, then go to 1. ;->
Honest reply: 3. I have no clue yet, since I haven't done 2. But I was
                 sure I'd get lots of "what for, it can be done in REXX
		 on the back of an envelope" replies, and I am
		 _convinced_ it can be done. Of course, I never even
		 inhaled the docs for the appropriate REXX function
		 calls. Maybe I'll peek a bit in the docs one of these
		 days, could be fun.


Cheers,
              Stefan


-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            30-Aug-99 08:27:02
  To: All                                               30-Aug-99 12:22:13
Subj: Re: 4-digit year in 'dir' list??

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On Sat, 28 Aug 1999 18:53:29 -0400, James Knott <jknott@ibm.net> wrote:
>In article <slrn7sd3c4.n7c.stefand@ferrari.lcam.u-psud.fr>,
>stefand@lcam.u-psud.fr (Stefan A. Deutscher) wrote:
>
>>And boy would I wish they'd add a switch to show full time (4 digit
>>year), as well as last access and creation times also from the command
>>line!  I know it can be done with REXX and what not, but that's not the
>>same thing as
>>
>> dir /show_me_all_you_know_about_these_files
>>
>>would be.
>
>Or
>
>dir 
>/show_me_all_you_know_about_these_files_but_not_the_stuff_I_don't_care
>_about  ;-)

I admit in admiration that that is even better. (BTW, you speak VMS, too
then?)
              Cheers,
	                     Stefan


-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            30-Aug-99 08:31:26
  To: All                                               30-Aug-99 12:22:13
Subj: Re: 4-digit year in 'dir' list??

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On Sat, 28 Aug 1999 02:32:02 -0400, Jerry McBride <mcbrides@erols.com> wrote:
>In article <37C6A580.9A360C36@nospam.com>,
>Jim Lewis <jklewis@nospam.com> wrote:
>>Stefan A. Deutscher wrote:
>>> And boy would I wish they'd add a switch to show full time (4 digit
>>> year), as well as last access and creation times also from the
>>> command line!  I know it can be done with REXX and what not, but
>>> that's not the same thing as
>>>
>>>  dir /show_me_all_you_know_about_these_files
>>>
>>> would be.

>>I have thought about writing a C program to do just that a few times.
>>It would work almost just like dir, except would not have the /s
>>(subdirectory) option. In fact, to save time it won't have any
>>options, but it will show the data as you requested including creation
>>times/dates, 4-digit year, etc.  My file finder (available below)
>>already shows a 4-digit year. How many other people would use this if
>>I make it available? Freeware of course.

>A most welcomed offer. But... no sort option? :')

Good one. But for starters, just pipe it through gnu sort. Much better
than the 64kB sort limit in cmd.exe and sort.exe (sort.com?).

What I'd love to see are options like -c, -m, -a for creation,
modification, access times, and also the flexibility to accept both the
DOS/2ish / as well as the UNIXish - as option lead in. (I use UNIX shell
ports most of the time in my OS/2 windows).

Later, stuff like -n for 'show file notes' and -a for 'play national
anthymn based on country setting' would round up the tool :-)

 Cheers,
               Stefan


-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: volker.zielowski@huk-coburg.de                    30-Aug-99 12:14:18
  To: All                                               30-Aug-99 12:22:13
Subj: Printing Problem with Comm 404 & PSCRIPT

From: Volker Zielowski <volker.zielowski@huk-coburg.de>

Hello Folks:

I have the following Problem:

Netscape Comm 4.04, OS/2 Warp 4 Fixpack 6 and Lexmark Optra PostScript
Driver.
Netscape seems to smear its own Postscript, because i'm not able to
choose any paper trays. The printer always picks its paper from
default-tray.
I printed ps-files with different settings (upper and lower tray), but
there's absolutely no difference between these files. Netscape 2.02 has
proper entries in its ps-files for choosing trays.
So: Is there any way to avoid applications to interact with the
postscript driver - maybe a system-wide option?
I know this is possible from some win-installations. Or may be there is
another way...
Please mail to 
mailto:volker.zielowski@huk-coburg.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: T-Online (1:109/42)

+----------------------------------------------------------------------------+

From: volker.zielowski@huk-coburg.de                    30-Aug-99 12:19:24
  To: All                                               30-Aug-99 12:22:13
Subj: Printing Problem with Comm 404 & PSCRIPT

From: Volker Zielowski <volker.zielowski@huk-coburg.de>

Hello Folks:

I have the following Problem:

Netscape Comm 4.04, OS/2 Warp 4 Fixpack 6 and Lexmark Optra PostScript
Driver.
Netscape seems to smear its own Postscript, because i'm not able to
choose any paper trays. The printer always picks its paper from
default-tray.
I printed ps-files with different settings (upper and lower tray), but
there's absolutely no difference between these files. Netscape 2.02 has
proper entries in its ps-files for choosing trays.
So: Is there any way to avoid applications to interact with the
postscript driver - maybe a system-wide option?
I know this is possible from some win-installations. Or may be there is
another way...
Please mail to 
mailto:volker.zielowski@huk-coburg.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: T-Online (1:109/42)

+----------------------------------------------------------------------------+

From: robin.hinde@nzpca.org.nz                          30-Aug-99 21:56:00
  To: All                                               30-Aug-99 12:22:13
Subj: Re: Netscape and two Inet

From: robin.hinde@nzpca.org.nz (ROBIN HINDE)

jpedone_no_spam@flash.net wrote:


JNS>In <37c87864.19223365@news.direct.ca>, dunmunro@direct.ca (Duncan Munro)
wr
JNS>:
JNS>>Same in 4.04, however it does not let me specify two different
JNS>>usernames or passwords.
JNS>>
JNS>>I work for a university. I want to recieve my mail through my employer
JNS>>at work and at home (which I  do)  but when I am at home I want to
JNS>>send it via my private ISP. the university prohibits send mailing from
JNS>>off campus location except through telnet or  webmail. Both methods
JNS>>are very clumsy for the volume of mail that I get.
JNS>>

JNS>Have you tried looking at the profile option?  I.e. with NS 4.04 and later
JNS>you can start netscape as netscape.exe -mail -P"isp1" This will bring up
JNS>the e-mail portion of NS with the the appropriated settings for isp1.
JNS>  It's not as convenient as a program like pmmail but it works for
JNS>multiple accounts.

Earlier versions of Netscape can use differing .ini files, there is an
excellent article :-) about this at

        http://www.nzpca.org.nz/megabyte/1999/02/art09.htm

Netscape is surprisingly customisable using these methods - ideal where
one PC is being used by more than one person.

---
 * OLX 2.1 TD * (robin.hinde@nzpca.org.nz      3:771/1680)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MegaBaud BBS, NZPCA, Wellington, New Zealand, 64-
(1:109/42)

+----------------------------------------------------------------------------+

From: volker.zielowski@huk-coburg.de                    30-Aug-99 12:20:26
  To: All                                               30-Aug-99 12:22:13
Subj: Printing Problem with Comm 404 & PSCRIPT

From: Volker Zielowski <volker.zielowski@huk-coburg.de>

Hello Folks:

I have the following Problem:

Netscape Comm 4.04, OS/2 Warp 4 Fixpack 6 and Lexmark Optra PostScript
Driver.
Netscape seems to smear its own Postscript, because i'm not able to
choose any paper trays. The printer always picks its paper from
default-tray.
I printed ps-files with different settings (upper and lower tray), but
there's absolutely no difference between these files. Netscape 2.02 has
proper entries in its ps-files for choosing trays.
So: Is there any way to avoid applications to interact with the
postscript driver - maybe a system-wide option?
I know this is possible from some win-installations. Or may be there is
another way...
Please mail to 
mailto:volker.zielowski@huk-coburg.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: T-Online (1:109/42)

+----------------------------------------------------------------------------+

From: DCritel@ibm.net                                   30-Aug-99 07:34:08
  To: All                                               30-Aug-99 12:22:13
Subj: Re: CAD recommendation

From: Dave Critelli <DCritel@ibm.net>

I own BlueCAD.  It's a good package.  However I won't make it my production
CAD
package (current Generic CAD for DOS) because BlueCAD's technical support (at
best) _stinks_.  They take forever to respond to your e-mails (sometimes
months)
when they decide to do so.  It's unfortunate because I think BlueCAD has the
makings of a very good program if it were only supported and marketed
properly.

Good Luck.
Dave

Chris Stumpf wrote:

> The only CAD programs I know of for OS/2 are BlueCad and Microstation.
> BluCad is an inexpensive program from italy and is for basic 2D drawing.
> Microstation is a full blown cad package from Bentley in the same realm as
> AutoCad, that includes price.  Bentley's student discounts are very good
> though.  I think you can get it for about $250 instead of $3000 with the
> student discount.  If you only need the the feaures that the core program
> provides, Microstation is an excellent choice as they support many
platforms.
>  There are almost no add ons for the OS/2 version though.  Here is there
url:
>
>                 http://www.bentley.com
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Insulated Wire Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: paul_belsack@my-deja.com                          30-Aug-99 12:53:10
  To: All                                               30-Aug-99 14:26:20
Subj: Fixpack

From: paul_belsack@my-deja.com

Problem with IBM fixpack 40 for os/2 v 3
OS/2 runs on a pc server 500(P390)
If I apply the following corrective service facility cs_140 for os/2v3;

*   This is a sample response file which can be used when applying
service
*   for the first time using FSERVICE when there is no existing
*   archive of the product being serviced.
*   It will service all partitions, and place an archive in each
partition.
*   It does not take a backup of changed files.
*
*   :LOGFILE C:\OS2\INSTALL\SERVICE.LOG
*   :FLAGS REPLACE_PROTECTED REPLACE_NEWER
:FLAGS REPLACE_PROTECTED
:SOURCE A:\
:SERVICE
:SYSLEVEL \OS2\INSTALL\SYSLEVEL.OS2
:ARCHIVE \ARCHIVE
:SERVICE
:SYSLEVEL \MMOS2\INSTALL\SYSLEVEL.MPM
:ARCHIVE \ARCHIVEM
*
*   End of sample SERVICE response file without backup.

The fixpack ends after I want to apply the first disk and I get a
message
CSF257 : No product has been selected

Even though syslevel.os2 (=v3.0 r8.2) and syslevel.mpm(=v3.0) are know
when I turn
Syslevel.exe.

And It seems that I am not able to start the csf?
Does anyone have any suggestions?


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: forkd4nisse@dtek.chalmers.se                      30-Aug-99 15:01:11
  To: All                                               30-Aug-99 14:26:21
Subj: Re: Important News From Dan Porter of Innoval

From: forkd4nisse@dtek.chalmers.se (Martin Nisshagen)

Brad Barclay [via Internet Direct - http://www.mydirect.com/] ->
comp.os.os2.misc:

 > My sentiments, too, except that I've been listening all along for the
words
 > "Open Source" which I haven't heard.
 
     Why - are POP and SMTP suddenly going to change?  These protocols have
been
 around for years and are quite stable.

No, but I think they will in some cases perhaps be replaced by never protocols
like for example IMAP, which almost every email client seems to target and who
has many advantages, especially in non ISP cases of servers (and no - IMAP is
not any Microsoft only standard if anyone thinks so).

I agree with Donnelly. Open source would be the best thing in this case.

All this said I agree that for most people (including myself) POP3 will do
fine for many years to come.
 
I also can't see why some people is trying to blame Tim for this. He is only
_reporting_ the news, not the one who has stopped the development of them.

Best regards,

m a r t i n | n

-- 
Martin Nisshagen                  PGP 6.0: 0x45D423AC         K R A F T W E R
K
CS/CE, Chalmers, Sweden           ICQ UIN: 689662             2x 300A @ 450
MHz
d4nisse-at-dtek-chalmers-se       http://go.to/martin_n       http://zap.to/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTH (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               30-Aug-99 15:30:01
  To: All                                               30-Aug-99 16:56:26
Subj: Re: Warp4-and-HPFS386

Message sender: christian.hennecke@ruhr-uni-bochum.de

From: Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de>

Steven C. Den Beste schrieb:

> I think you may have gotten that statistic slightly wrong. 90% of Windows
> users which steal 100% of their software? Not likely...
> 
> I think maybe it's more like 90% of Windows users who steal >0% of their
> software. That's a much different thing. And come to think of it, I bet
> that's equally true for OS/2 users.

Maybe 90% is a bit much. However, I was talking about homeusers and from
what I KNOW most of them haven't paid for their copy of MS Office, Adobe
Photoshop and the like. That's a plain fact!

> Let's try to keep the hateful hyperbole under control, shall we?

Well, I am NOT one of those diehard "there is only one OS that's good
and that's the one I use and anyone who is using another should drop
dead" people :-). I just can't stand it seeing this person accusing the
whole "OS/2 community" because of Mr. Anonymous' posting with ignoring
the fact that the Windows world is much worse.

Christian Hennecke
-- 
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: evzen@netbrno.cz                                  30-Aug-99 16:01:03
  To: All                                               30-Aug-99 16:56:26
Subj: Re: FTP Browser 1.71 bug?

From: "Evzen Polenka" <evzen@netbrno.cz>

Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de> wrote:


> I have tried FTP Browser 1.71 for some days now. It's a nice program,
> but it definitely has a few annoying bugs. E.g. I can't get it to change
> to directory with spaces in the name. Any workaround?

The last version is 1.72, but it has the same problem, IIRC.

I liked the program very much (especially for it's FXP function - connect to
two ftp sites and drag'n'drop files from one window to the another), but
because of this and another bugs I started using NFTP which is developed
further and doesn't have this problem. (however, it lacks the FXP function
:-( )

    Bye, Evzen



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Cesnet (1:109/42)

+----------------------------------------------------------------------------+

From: osric@apk.net                                     30-Aug-99 10:25:08
  To: All                                               30-Aug-99 16:56:26
Subj: Re: Important News From Dan Porter of Innoval

From: Tarquelne <osric@apk.net>

>Sorry to disagree with you, but in fact there's a lot you can do with a mail
>program.
>
>How about more intelligent filtering? (Agent lets me use regular expressions
>on the subject line, but I'd like to be able to filter on the contents of a
>message, so that anything which contains the phrase "MLM" goes straight into
>the trash bin.) Automated responses to messages? ("I'm on vacation right
>now, but I'll get back to you in two weeks.")

Can't several e-mailers do that already?

>Better folder manipulation?

It's probably always possible to do something "better."

>
>Searching of folders using complex search rules?

Can do that.

>Easy connection to multiple servers?

Seems easy enough. . . see "better."

>Oh, I can think of many things. The interface with the mail server may be
>mature, but there's much that can be done with the interface with the human
>user.

I'm not trying to be snide, but what e-mailer are you using?
                                            Tarquelne
                                       <osric@apk.net>
        I know how God can make a rock so big He can't move it.
                                  ************************
Use the address above to reply - not the anti-spam "Reply-to" address
___________________________________________________________
"Television is an invention that permits you to be entertained
 in your living room by people you wouldn't have in your home."--David Frost   
                                                                               
                                   


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: APK Net (1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  30-Aug-99 14:37:13
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: l_luciano@da.mob (Stan Goodman)

On Mon, 30 Aug 1999 13:01:22, forkd4nisse@dtek.chalmers.se (Martin 
Nisshagen) wrote:

> Brad Barclay [via Internet Direct - http://www.mydirect.com/] ->
> comp.os.os2.misc:
> 
>  > My sentiments, too, except that I've been listening all along for the
words
>  > "Open Source" which I haven't heard.
>  
>      Why - are POP and SMTP suddenly going to change?  These protocols have 
been
>  around for years and are quite stable.
> 
> No, but I think they will in some cases perhaps be replaced by never
protocols
> like for example IMAP, which almost every email client seems to target and
who
> has many advantages, especially in non ISP cases of servers (and no - IMAP
is
> not any Microsoft only standard if anyone thinks so).
> 
> I agree with Donnelly. Open source would be the best thing in this case.
> 
> All this said I agree that for most people (including myself) POP3 will do
> fine for many years to come.
>  
> I also can't see why some people is trying to blame Tim for this. He is only
> _reporting_ the news, not the one who has stopped the development of them.

Aw, c'mon Martin. Impaling the messenger is a time-honored response to bad 
news.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: swanee@pillarsoft.net                             30-Aug-99 09:43:03
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: Wayne Swanson <swanee@pillarsoft.net>

"Steven C. Den Beste" wrote:
> 
> Sorry to disagree with you, but in fact there's a lot you can do with a mail
> program.
> 
> How about more intelligent filtering? (Agent lets me use regular expressions
> on the subject line, but I'd like to be able to filter on the contents of a
> message, so that anything which contains the phrase "MLM" goes straight into
> the trash bin.) Automated responses to messages? ("I'm on vacation right
> now, but I'll get back to you in two weeks.")

Got it years ago with MR/2 ICE
> 
> Better folder manipulation?

Got it years ago with MR/2 ICE
> 
> Searching of folders using complex search rules?

hmmm... never tried this... Maybe I don't have it! If not... I'll have
to "Rexxify" it.
> 
> Easy connection to multiple servers?

Got it years ago with MR/2 ICE
> 
> Oh, I can think of many things. The interface with the mail server may be
> mature, but there's much that can be done with the interface with the human
> user.

Filters? Oh baby!! Simple, Free form, Rexx based and special filters.

Roll your own complex filters with rexx.
Mail manipulation with rexx. (Go anywhere, do anything)
Mailing list setup.
Automatically manipulate any binary messages.
Filter Header, From, To, Subject, Body or any combination.
Free form filters extend boolean logic to searches.
Personalized AutoReply
Automatic Forwarding

The rexx thing is the one that really makes it hugely powerful for
almost anything. Maybe Agent or Eudora could add that someday with
Windows built in scripting.


One thing OS/2 has always had is some "very" good email clients.

I can't survive without my MR/2 ICE...

Wayne Swanson
------------------------------------------------------------
email: swanee@pillarsoft.net
PillarSoft: http://www.pillarsoft.net
Developers of: WarpZip, DeskTop Backup (DTB), SFX Installer
               ShowTime/2 and the Enhanced E Editors
Vice President: VOICE (Virtual OS/2 International Consumer Education)
VOICE: http://www.os2voice.org
------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PillarSoft (1:109/42)

+----------------------------------------------------------------------------+

From: swanee@pillarsoft.net                             30-Aug-99 09:52:05
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: Wayne Swanson <swanee@pillarsoft.net>


Wayne Swanson wrote:
> 
> "Steven C. Den Beste" wrote:
> >
> > Sorry to disagree with you, but in fact there's a lot you can do with a
mail
> > program.
> >
> > How about more intelligent filtering? (Agent lets me use regular
expressions
> > on the subject line, but I'd like to be able to filter on the contents of
a
> > message, so that anything which contains the phrase "MLM" goes straight
into
> > the trash bin.) Automated responses to messages? ("I'm on vacation right
> > now, but I'll get back to you in two weeks.")
> 
> Got it years ago with MR/2 ICE
> >
> > Better folder manipulation?
> 
> Got it years ago with MR/2 ICE
> >
> > Searching of folders using complex search rules?
> 
> hmmm... never tried this... Maybe I don't have it! If not... I'll have
> to "Rexxify" it.
> >
> > Easy connection to multiple servers?
> 
> Got it years ago with MR/2 ICE
> >
> > Oh, I can think of many things. The interface with the mail server may be
> > mature, but there's much that can be done with the interface with the
human
> > user.
> 
> Filters? Oh baby!! Simple, Free form, Rexx based and special filters.
> 
> Roll your own complex filters with rexx.
> Mail manipulation with rexx. (Go anywhere, do anything)
> Mailing list setup.
> Automatically manipulate any binary messages.
> Filter Header, From, To, Subject, Body or any combination.
> Free form filters extend boolean logic to searches.
> Personalized AutoReply
> Automatic Forwarding
> 
> The rexx thing is the one that really makes it hugely powerful for
> almost anything. Maybe Agent or Eudora could add that someday with
> Windows built in scripting.
> 
> One thing OS/2 has always had is some "very" good email clients.

Oh yeah... "some "very" good email clients" AND Rexx...

Wayne Swanson
------------------------------------------------------------
email: swanee@pillarsoft.net
PillarSoft: http://www.pillarsoft.net
Developers of: WarpZip, DeskTop Backup (DTB), SFX Installer
               ShowTime/2 and the Enhanced E Editors
Vice President: VOICE (Virtual OS/2 International Consumer Education)
VOICE: http://www.os2voice.org
------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PillarSoft (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          30-Aug-99 15:00:25
  To: All                                               30-Aug-99 16:56:27
Subj: Re: FTP Browser 1.71 bug?

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 30 Aug 1999 14:01:06, "Evzen Polenka" <evzen@netbrno.cz> a crit 
dans un message:

> Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de> wrote:
> 
> 
> > I have tried FTP Browser 1.71 for some days now. It's a nice program,
> > but it definitely has a few annoying bugs. E.g. I can't get it to change
> > to directory with spaces in the name. Any workaround?
> 
> The last version is 1.72, but it has the same problem, IIRC.
> 
> I liked the program very much (especially for it's FXP function - connect to
> two ftp sites and drag'n'drop files from one window to the another), but
> because of this and another bugs I started using NFTP which is developed
> further and doesn't have this problem. (however, it lacks the FXP function

Does that FXP function transfer the files directly from one remote site to 
another without coming to your local machine?


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               30-Aug-99 15:08:21
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: esther@bitranch.com (Esther Schindler)

On Mon, 30 Aug 1999 05:37:44, sdenbes1@san.rr.com (Steven C. Den 
Beste) wrote:

| Oh, I can think of many things. The interface with the mail server may be
| mature, but there's much that can be done with the interface with the human
| user.

That may be true, Steven, but as I'm sure you know, most people don't 
do _anything_ with the user interface other than read-and-reply. I'm 
quite sure that a high percentage of Internet users have never even 
created a new message folder.

I still think it's a class act. It makes the product available to 
those who want to use it.

--Esther 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               30-Aug-99 15:13:08
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: esther@bitranch.com (Esther Schindler)

Stephen,

I'm surprised that you encountered such ignorance of Innoval's 
products. Dan Porter did indeed visit the Phoenix OS/2 Society. I know
he was a guest at user groups in southern California and northern 
California, and was (is?) a member of a NY-area OS/2 user group. I 
consider the product line reasonably well known (though not quite as 
much as others).

I've had several conversations with Dan, over the years, and I know 
personally how much he cared about the OS/2 platform and about serving
its users. I'm quite sure that posting that message caused him a great
deal of pain; like other OS/2 ISVs whose desire to pay the mortgage 
forced them to consider alternatives, it can't have been an easy 
decision. I'm sure that it's not a decision he ever wanted to reach.

Perhaps you might show a little empathy for his situation.

--Esther
  who had to turn away from her 100%-OS/2 business, too

On Mon, 30 Aug 1999 02:27:59, Stephen Eickhoff <"operagost"@e-mail.com
(remove the - )> wrote:

| 
| 
| Tim Martin wrote:
| 
| > I have just received the following from Dan Porter of
| > Innoval Systems Solutions, Inc.:
| >
| > From: Dan Porter  6:21 PM (PST), August 28, 1999
| > Subject: InnoVal and OS/2
| > To: os2guy@warpcity.com
| >
| > Effective immediately, InnoVal Systems Solutions, Inc. is withdrawing
| > the following products from marketing and support.
| >
| > Post Road Mailer for OS/2
| > J Street Mailer for Java
| > Web Willy Watch for OS/2
| 
| Join the club of plane-jumpers!
| 
| >
| > Anyone may download free copies of these products from our online store
| > at http://stores.yahoo.com/innoval. In addition, anyone may freely
| > distribute executable copies of the software through online software
| > repositories and websites. You are encouraged to do so because we will
| > only be able to keep them in our online store for a limited time. If you
| 
| Ooh, I can have a product that will be obsolete in months for FREE!
| 
| > For me, personally, this is a sad day. Our company tried to hang in as
| > long as possible with OS/2. OS/2 is still my favorite platform and OS/2
| > customers are the best customers our company ever had. I have made many
| > good friends through my associations with all of you. You ll still see
| > me popping in at OS/2 users group meetings throughout the country when
| > my travels coincide with a meeting.
| 
| I certainly can't speak for everyone, but I'd rather not see ya.
| 
| What are you going to do, convince us to move to Windows so we can use your
| products?
| 
| >
| > Our company continues to do very well. The consulting side of the
| > business has always been strong. The most exciting area of business,
| > however, is Iceptur. Iceptur is our new Internet filtering software for
| > the Windows 95/98/NT platform. Despite the fact that there are over two
| > hundred competitors in this market niche, we are experiencing phenomenal
| 
| >
| > success. This is partly because of the unique technology we developed
| > and partly because there is a strong demand for high quality Internet
| > filtering solutions (release 2.0 will hit the streets by September 5th).
| 
| I doubt it. Everyone I speak to has never heard of your company. And I was
| plugging Web Willy, it was a product that was actually more than just a
| pattern matcher.
| However, it's unlikely you'll be able to pull away much market from Cyber
| Patrol, much less Microsoft when they enter the market any day now.
| 
| >
| > We have entered into a number of strategic alliances with several
| > companies to market Iceptur and license the underlying technology for
| > use in other products.
| >
| 
| Oh, I guess the terms of the contract was to ditch OS/2.
| Hope one of them is MS, if you intend to survive.
| 
| >
| > I need, now, to focus all of InnoVal s resources on Iceptur and our
| > consulting business. I tried, during the past year, to juggle resources
| > but in doing so was not doing the right kind of job for our customers,
| > the OS/2 community at-large, InnoVal s employees, or InnoVal s owners.
| > You made the Post Road Mailer into the number one email client for OS/2.
| >
| 
| When was that? Nobody I know uses it. It's between PMMail and Netscape.
| 
| >
| > You worked with us on J Street Mailer as we tried to negotiate a
| > platform independent course with Java. You have my thanks and the thanks
| >
| > of everyone at InnoVal.
| 
| Sorry you failed. Better luck with  0.5% of that crowded niche you were
| talking about.
| 
| >
| > We are moving on to bigger things, but not better. OS/2 was better and
| > (oh, how I wish) it could have been big.
| 
| Lip service.
| 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: schampn@ibm.net                                   30-Aug-99 17:16:09
  To: All                                               30-Aug-99 16:56:27
Subj: NFS & OS/2 Warp 4.0

From: "Stephane Champneuf" <schampn@ibm.net>

Where can I get a NFS software that runs with OS/2 Warp 4.0 ?
(NFS doesn't seem to be provided with this version)

Thanks

schampn@ibm.net



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: l_luciano@da.mob                                  30-Aug-99 15:31:26
  To: All                                               30-Aug-99 16:56:27
Subj: Re: FTP Browser 1.71 bug?

From: l_luciano@da.mob (Stan Goodman)

I am a registered user, and have been using v1.71 for a long time. Where is
v1.72 available?

On Mon, 30 Aug 1999 14:01:06, "Evzen Polenka" <evzen@netbrno.cz> wrote:

> Christian Hennecke <christian.hennecke@ruhr-uni-bochum.de> wrote:
> 
> 
> > I have tried FTP Browser 1.71 for some days now. It's a nice program,
> > but it definitely has a few annoying bugs. E.g. I can't get it to change
> > to directory with spaces in the name. Any workaround?
> 
> The last version is 1.72, but it has the same problem, IIRC.
> 
> I liked the program very much (especially for it's FXP function - connect to
> two ftp sites and drag'n'drop files from one window to the another), but
> because of this and another bugs I started using NFTP which is developed
> further and doesn't have this problem. (however, it lacks the FXP function
> :-( )
> 
>     Bye, Evzen
> 
> 
> 

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to l_luciano@da.mob will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@sover.net                                30-Aug-99 08:52:16
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: letoured@sover.net

>   I am currently looking for a new mail program to replace
>UltiMail, and I am testing PMMail, JStreet, and now Post Road, and the
>only program that even comes close to my acceptability, is JStreet,
>however, it's memory footprint is huge, and that may preclude me from
>using it, and besides, I would like to actually support native OS/2
>software.

Then get MR2.


_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: gmcleod@idirect.com                               30-Aug-99 11:52:15
  To: All                                               30-Aug-99 16:56:27
Subj: Re: CAD recommendation

From: "gordon mcleod" <gmcleod@idirect.com>

IBM Cad for OS2 was a very powerfull 2d cad system and IBMCad3x was a very
good light version  CadKey v7 for dos runs very well under OS2 as does
DataCad for Dos
A company in England bought Cad3x and I understand there is now a 4X but I
haven't any info on it and I don't think there is a web site for it
Acad 10, and 12 for Dos will also sun in OS2
 On Sun, 29 Aug 1999 15:18:33 -0400, SERWAS1 wrote:

>-----------------------------------------------------------
>Greetings all,
>
>Would appreciate any advise on a CAD program, or a good drawing program.
>
>I've been using IBM's very old CAD for os2 and it's too arcane, giving
>what's available in windose.
>
>Any help is appreciated.
>
>Mat



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: rerbert@wxs.nl                                    30-Aug-99 17:59:29
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: rerbert@wxs.nl (Gerben Bergman)

After a long, hard day of battling the soulless minions of orthodoxy, I came
home just in time to see Tarquelne writing:

| >Oh, I can think of many things. The interface with the mail server may be
| >mature, but there's much that can be done with the interface with the human
| >user.
| 
| I'm not trying to be snide, but what e-mailer are you using?

As he said, he uses Fort Agent (as do I). What he described are several
known shortcomings in the program, and even though other mailers might
address those shortcomings, they typically lack other features/
characteristics which make Agent the fine program that it is. (For example,
I gave up multiple-server support, filtering of outgoing messages, and HTML
support for a better spell checker, a WYSIWYG editor, virtually unlimited
configurability, combined email and news functionality, and more stability
when I dropped PMMail 98 for Agent a while ago.)

The perfect mailer hasn't been written yet, meaning there's still room for
improvement. I believe that's the point Steven was trying to make.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chaos & Disorder, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: cawort01@spam.netcom.com                          30-Aug-99 16:05:13
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: cawort01@spam.netcom.com

In <3804173f.390955730@news-server>, sdenbes1@san.rr.com (Steven C. Den Beste) 
writes:
>On Sun, 29 Aug 1999 23:36:03 -0400, Brad Barclay recycled some holes into
>the following pattern:
>
>>Buddy Donnelly wrote:
>>
>>> On Mon, 30 Aug 1999 02:27:59, Stephen Eickhoff <"operagost"@e-mail.com
>>> (remove the - )> a crit dans un message:
>>>
>>> > >
>>> > > Anyone may download free copies of these products from our online
store
>>> > > at http://stores.yahoo.com/innoval. In addition, anyone may freely
>>> > > distribute executable copies of the software through online software
>>> > > repositories and websites. You are encouraged to do so because we will
>>> > > only be able to keep them in our online store for a limited time. If
you
>>> >
>>> > Ooh, I can have a product that will be obsolete in months for FREE!
>>>
>>> My sentiments, too, except that I've been listening all along for the
words
>>> "Open Source" which I haven't heard.
>>
>>    Why - are POP and SMTP suddenly going to change?  These protocols have
been
>>around for years and are quite stable.
>>
>>    There isn't much you can do with an E-Mail program these days.  When
it's
>>done, it's done.  The protocols won't be changing anytime soon, so unless
you
>>plan on moving to a Microsoft Exchange based E-Mail system, these products
will
>>continue to work for many, many, many years, without being obsolete.
>>
>>Brad BARCLAY
>>
>
>Sorry to disagree with you, but in fact there's a lot you can do with a mail
>program.
>
>How about more intelligent filtering? (Agent lets me use regular expressions
>on the subject line, but I'd like to be able to filter on the contents of a
>message, so that anything which contains the phrase "MLM" goes straight into
>the trash bin.) Automated responses to messages? ("I'm on vacation right
>now, but I'll get back to you in two weeks.")
>
>Better folder manipulation?
>
>Searching of folders using complex search rules?
>
>Easy connection to multiple servers?
>
>Oh, I can think of many things. The interface with the mail server may be
>mature, but there's much that can be done with the interface with the human
>user.
>


Well I'd suggest you get PMMail/2 it does all those things :)

and doesn't crash.  I bought One innoval product, and it didn't work as
advertised.
I was disappointed and never bought another thing from them.

Chris

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Louisville (1:109/42)

+----------------------------------------------------------------------------+

From: gsf@ibm.net                                       30-Aug-99 16:10:21
  To: All                                               30-Aug-99 16:56:27
Subj: Re: NFS & OS/2 Warp 4.0

From: Gilbert Saint-flour <gsf@ibm.net>

In <37ca92b4@news.uk.ibm.net>, on 30 Aug 1999 at 17:16, "Stephane
Champneuf" <schampn@ibm.net> said:

>Where can I get a NFS software that runs with OS/2 Warp 4.0 ? (NFS
>doesn't seem to be provided with this version)

I think IBM no longer sells or supports the "old" NFS code; you have to
get TCP/IP 4.1 to get the new one.

Some time ago, I downloaded a number of NFS-related files from the
Internet and managed to merge them and get the NFS client working (I
didn't try the server).  I forgot what I exactly did and no longer have
the code, but look in the FilePile site and the IBM fixes for NFS and you
may be able to build your own NFS client like I did.

Gilbert Saint-flour


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: gnrm@earth.gh.net                                 30-Aug-99 12:22:20
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: "os2pal" <gnrm@earth.gh.net>

Esther Schindler <esther@bitranch.com> wrote in message
news:LoEFmgJJ9ecw-pn2-vcn7O1bd34sJ@agave.bitranch.com...

> Stephen,
>
> I'm surprised that you encountered such ignorance of Innoval's
> products.
-----------snipped-----------------

Surprise? Are you under the assumption that their products were the pillars
of intelligence?


> I'm quite sure that posting that message caused him a great
> deal of pain;

Nah, why post unless there is a hidden agenda behind it? If you'd read the
post carefully...

> like other OS/2 ISVs whose desire to pay the mortgage
> forced them to consider alternatives, it can't have been an easy
> decision. I'm sure that it's not a decision he ever wanted to reach.

His accountants (if he had any) probably reached this decision for him :)
He faces another problem: If he didn't make it here, my guess is, he might
have problems elsewhere. He is already branded, if I may say so.

He'll have to do a tad better than JWalking and free Willy. If worse comes
to worse, I am guessing, he can always end up having a few Cyberbeers online
with Brad Wardell and chat about the good 'ol times - when they used to fill
our brains up with empty talk.

>
> Perhaps you might show a little empathy for his situation.

I am. Shall I send him flowers or a sympathy card?

>
> --Esther
>   who had to turn away from her 100%-OS/2 business, too


<chuckle>  Had a hunch you'll see the light sooner or later <another
chuckle>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ameritech.Net www.ameritech.net  Complaints: abus
(1:109/42)

+----------------------------------------------------------------------------+

From: gnrm@earth.gh.net                                 30-Aug-99 12:25:18
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: "os2pal" <gnrm@earth.gh.net>


> >   I am currently looking for a new mail program to replace
> >UltiMail, and I am testing PMMail

MR/2 ICE is good.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ameritech.Net www.ameritech.net  Complaints: abus
(1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         30-Aug-99 16:35:16
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Wav to CD Audio

From: racette@cablevision.qc.ca (Martin Racette)

On Sun, 29 Aug 1999 10:30:44, 
torsten.balle.koefoed@somewhere.dk 
(Torsten Balle Koefoed) wrote:

> On Sat, 28 Aug 1999 21:32:58, racette@cablevision.qc.ca (Martin Racette)
wrote:
> 
> > Is it possible to copy some .WAV and 
> > write them on a CD-R in Audio format 
> > i.e.: that can be read by a standard CD 
> > play in a car or home by using RSJ 2.83 
> > ?
> 
> Just drag the Wav-files into CDView and burn.
> 
> Yours etc.
>   Torsten Balle Koefoed
> 
> (Replace servername in address with: writeme<dot>com)

I tried it but it won't work here the 
error message I get :

"Can't open drive 
[d:\mmos2\sounds\boo.wav]. Make sure the
drive is ready and not use by any other 
application"

and when I use the INFO... button here's
what I get:

SOURCE: cdif.c, Aug 16 1999
LINE: 2064
PM ERROR: 0x1017
C ERRNO: (none)
CD ERROR: (none)

I use the demo d/l directly from the RSJ
web site and it's 2.83 (I will buy it 
soon :-) )

BTW. I tried with WAV file that comes 
with OS/2 to see if it would work

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rjf@yyycomasia.com                                30-Aug-99 16:48:13
  To: All                                               30-Aug-99 16:56:27
Subj: Re: Important News From Dan Porter of Innoval

From: rjf@yyycomasia.com (rj friedman)

On Mon, 30 Aug 1999 15:08:43, esther@bitranch.com (Esther 
Schindler) wrote:

That may be true, Steven, but as I'm sure you know, most people don't 
do _anything_ with the user interface other than read-and-reply. I'm 
quite sure that a high percentage of Internet users have never even 
created a new message folder.

To say nothing of the fact that - for the user with more 
sophisticated requirements - the mailers available for OS/2 
- including PostRoad and JStreet - have the sophisticated 
features (nested folders, filters, multiple accounts, exit 
script capability, et. al), that Mr. Broccolli appeared to 
be not aware of.


________________________________________________________

[RJ]                 OS/2 - Live it, or live with it. 
rj friedman          Team ABW              
Taipei, Taiwan       rjf@yyycomasia.com 

To send email - remove the `yyy'
________________________________________________________

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SEEDNet News Service (1:109/42)

+----------------------------------------------------------------------------+

From: abacab@swissonline.ch                             30-Aug-99 17:45:06
  To: All                                               30-Aug-99 16:56:27
Subj: Exchanging addresses between Organizer and Psion ?

From: Francois Hurter <abacab@swissonline.ch>

Has anybody experience in exchanging addresses from the Lotus Organizer for
Warp 4 and a   
Psion 3a ? 
TIA 
Francois 



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Swiss Online (Cablecom Media), Zurich, Switzerlan
(1:109/42)

+----------------------------------------------------------------------------+

From: abacab@swissonline.ch                             30-Aug-99 17:45:08
  To: All                                               30-Aug-99 16:56:27
Subj: Problem defining mapping in Organizer

From: Francois Hurter <abacab@swissonline.ch>

Hi, 
When I'm exporting addresses from the Organizer and using the "All Fields"
mapping,   
everything is ok. 
As soon as I'm defining my own mapping, I get an 
Error 23 (Ox17) ERROR_CRC Data error (cyclic redundancy check) occured on "". 
Has anybody seen this ? 
Regards 
Francois 



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Swiss Online (Cablecom Media), Zurich, Switzerlan
(1:109/42)

+----------------------------------------------------------------------------+

From: ames@deltrak.demon.co.uk                          30-Aug-99 17:58:20
  To: All                                               30-Aug-99 16:56:28
Subj: Re: Important News From Dan Porter of Innoval

From: ames@deltrak.demon.co.uk (Andrew Stephenson)

In article <yHQxxE9f8dqd-pn2-FFRQjmOcVHPd@POBLANO>
	   l_luciano@da.mob "Stan Goodman" writes:

> Aw, c'mon Martin. Impaling the messenger is a time-honored
> response to bad news.

At one time, AFAIR, some people would sacrifice bearers of _good_
news to the gods, as a 'thankyou'.  I guess we're too modern for
any of that.  Now we just beat up Tim, as a matter of principle.
--
Andrew Stephenson

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DNS (1:109/42)

+----------------------------------------------------------------------------+

From: hjmurray@home.com                                 30-Aug-99 18:37:00
  To: All                                               30-Aug-99 16:56:28
Subj: Re: Wav to CD Audio

From: "Hal Murray" <hjmurray@home.com>

 > > > Is it possible to copy some .WAV and 
 > > > write them on a CD-R in Audio format 
 > > > i.e.: that can be read by a standard CD 
 > > > play in a car or home by using RSJ 2.83 
 > > > ?
 > > 
 > > Just drag the Wav-files into CDView and burn.
 > > 
 > > Yours etc.
 > >   Torsten Balle Koefoed
 > > 
 > > (Replace servername in address with: writeme<dot>com)
 > 
 > I tried it but it won't work here the 
 > error message I get :

The easiest I have found is to use CD View. By the looks of the error
message you have 'attached' the writer drive before selecting your
files to copy.

Open CD View of your regular CD and you will see the audio files.
Then open CD View of your writer drive. Drag the audio files to the
writer drive and hit the record button. When done close the session.

If you have WAVs on you hard drive open CD View of your hard drive
and go to the directory where you have the WAV files. Drag the files
you want to the window of your CD View writer drive and drag them
over to it and hit record.

My regular old CD drive can not read audio data tracks well, they
'skip' so I use my CD writer to copy audio tracks to my hard drive.
this creats WAV files. Then using CD View I drag them back to the CD
writer drive.

Hal Murray Calgary, AB

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: flash-bounce@nym.alias.net                        30-Aug-99 21:16:11
  To: All                                               30-Aug-99 16:56:28
Subj: (1/2)  Warp_v4_SuperCharged! 

From: Anonymous <flash-bounce@nym.alias.net>

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Installing HPFS386 into a Warp v4 client makes your system FASTER!.  If
you think, this hurts IBM, think again.  The reason IBM does'nt include
HPFS386 into Warp v4 is because MS charges HUGE royalties for EACH copy
of
HPFS386!.  Therefore, IBM only includes it with Warp Server.
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
IF YOU ARE AN EXISTING OS/2 WARP USER, THIS GUIDE WILL DESCRIBE HOW YOU
MAY IMPROVE SYSTEM FILE I/O BY 5X TO 10X FACTOR.

note:  This information is provided for educational, and entertainment
purposes only.  

IT is Recommended to print this guide now or save to a file for future
reference.... ;)

Introduction

This is a guide or informative doc,  how to install a quite IMPROVED 
OS/2 Warp v4 to your PC.  This guide is published for intermediate to
power PC users.  Why could you be interested in OS/2?.:
 => Because it is a robust 32-bit OS
 => Excellent Internet services (TCP/IP)
 => Excellent GUI, (named as the best on an important Linux web site)
 => Good support from IBM (Service pak #11 released in july)
 => Excellent 32-bit applications available and 1000's of utilities
 => JVM v1.1.8  The best JVM as reported by Volano and other 
benchmarks
 => YEAR 2K READY!, and more

Want' to try a FREE screensaver?:
http://www.os2ss.com/warpcast/wc1129.html

When installing Wipeout Screen saver, don't install the toolkit with 
OS/2 v4...

This is a guide to OS/2 information, software, resources and more,.. 
if you like challenges, keep reading!.  This time you can setup a more 
powerful PC system than ever.  The final result of this setup maybe
called OS/2 Brutal-Force...

PC newspersons are welcome to build this setup for testing purposes 
and they can have a better prisma to report how good or bad OS/2 is.
Reporting about OS/2 without making reserch, installing it, and
installing appropiate Fixpacks is to be an UN-PROFESSIONAL newsperson.

ATTENTION INTERNATIONAL USERS!, LOTUS SMART SUITE V1.1 FOR OS/2 WARP 4
IS NOW AVAILABLE WITH MULTI-LANGUAGE SUPPORT!!

Sample of OS/2 Applications & Utilities, some with url links:
1) Lotus Smart Suite v1.1 (123, Word Pro, Organizer, 
Approach,Freelance)
http://www.lotus.com/home.nsf/welcome/smartsuiteos2
2) Netscape Communicator v4.61 (July 14, 1999 edition)
http://www.software.ibm.com/warp/netscape
3) IBM Visual Age for JAVA v2 (v3 in beta right now)
http://www.software.ibm.com/ad/vajava
4) Star Office v5.1 (German Office Suite that resembles Office)
http://www.stardivision.com
5) IBM Visual Age for C++ v4
http://www.spoftware.ibm.com/ad/visualge_c++
6) Doctor Solomon Anti-Virus, VirusScan v4.02
http://www.nai.com
7) SETI@OS2
http://www.os2ss.com/seti
8) Emtec FTP 5.06 (with resume capabilities)
ftp://ftp.us.emtec.com/netsuite/eftp506.zip
9)Gamma Tech v4.0
http://www.gt-online.com
10) Object desktop v2.0
http://www.stardock.com
11) PKZIP v2.50
http://www.pkware.com/shareware/pkos2250.html
12) MainActor v3.0 (in development)
13) Pronews v1.51 (excellent usenet reader)
http://hobbes.nmsu.edu
14) IBM TCP/IP v4.1 (32-bit)
15) and more files
http://hobbes.nmsu.edu

One of our goals is to demonstrate that OS/2 is an excellent OS
alternative.

You need a FTP client with resume downloads capabilities.  If you are an
existing OS/2 user, try; Emtec FTP 5.06.  To follow OS/2 topics, use;
Pronews Usenet Reader [highly recommended]

1)  ftp://merlin.itep.ru (lss;os2warez) 

Be patient, many persons are loggin almost every hour and every minute.
Best hours are 2-5 AM.  Warning: Stardock Essentials v2.0 crash OS/2. Be
careful and avoid installing it.  Process Commander is a nice
application, it will save you many problems. But it is recommended to
uninstall it before installing a Fixpack.  Install Process Commander
-=AFTER=- installing FP #11.

Note: OS/2 should be installed to a HPFS partition.  System behavior 
is much better than FAT.

IMPORTANT!!!
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~
HPFS386 IS NOT COMPATIBLE WITH PARTITION MAGIC (ACL).  Also, you could
have
BIG trouble executing HD utils NOT compatible with HPFS386!. This makes
sense for
an standalone OS/2 system.
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~

Always check hardware for compatibility with OS/2,  Suggested 
installation procedure:
   1- Browse through KEY OS/2 web sites and learn about OS/2 
   2- Install OS/2 v4
   3- Install Must-Have utilities (more at the end of the doc)
   4- Get and install Netscape Communicator v4.61
      http://www.software.ibm.com/os/warp/netscape/
   5- Get and install OS/2 Feature Install Version 1.2.4 
      http://service.boulder.ibm.com/asd-bin/doc/en_us/catalog.htm  
   6- Get and install latest JAVA (1.1.7 or latest)
      http://service.boulder.ibm.com/asd-bin/doc/en_us/catalog.htm
   7- Enable software updates through the WWW                   
http://ps.boulder.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/softupd.htm
   8- Update OS/2 v4 (click the OS/2 v4 column, RSU, and Fixpack #11)
   9- Update Spooler
  10- Follow the instructions (be sure to NOT have other applications
running.)
  11- Go and hunt for TCP/IP v4.1 and install it.  This baby will allow
much better 'Interneting'
  12- Go and hunt for other OS/2 applications, particularly in FTP sites
in Russia
  13- Install Lotus Smart Suite v1.1, Star Office, File Manager and 
others. 
  14- Remember TEST DRIVE THEM and buy after 60 dayS TEST DRIVE

     
-------------------------------------------------------------------
and NOW Our Featured Presentation...

SUPER-CHARGE YOUR OS/2 SETUP.  HOW TO USE A BIGGER CACHE, 32-BIT FILE
SYSTEM AND 32-BIT DEVICE DRIVER.  MAKE YOUR OS/2 SYSTEM FASTER THAN
EVER.

HPFS386  --=> High Performance File System 

check fir it in alt.binaries.warez.os2, comp.os.os2.apps
or check around....

This hpfs386 is dated 06/11/99 and is the latest release.  if you're
just using hpfs.ifs,  you can improve your system performance with the
hpfs386 driver.

The hpfs386 is 32bit and can have any cache size you want, plus its
about 4x faster at writing and a bit faster at reading.  It will improve
the speed of your system. Instructions for installing are inside the
hpfs386 zip file. It is easy to do. The instructions are inside the ini
file itself in case you get lost. 

Another note: you'll need to update your config.sys. That information 
is also found in the hpfs386.zip file in the readme instructions.  The
entries are easy to add.  They can be  included at the end of your path
statements and you can literally mark/copy/paste the entry from the 
instruction file directly into your config.sys  paths.   

Make sure you make those entries in your config.sys before you reboot
your system so your system knows  what driver to use and where to find
it. You'll know it worked when 
you reboot and a single  statement across your screen says the hpfs386
driver was found.

HPFS INSTALLATION:
HPFS386 Installation on Warp3, Warp4 ..etc.

Make a directory under c:\ called ibm386fs and copy everything
in this package there..

Edit your config.sys, REM out the hpfs.ifs line, and add these:
IFS=C:\IBM386FS\HPFS386.IFS /A:*
CALL=C:\OS2\CMD.EXE /Q /C C:\IBM386FS\CACHE386.EXE >NUL

Add C:\IBM386FS; to your PATH, LIBPATH and DPATH

Edit HPFS386.INI and change the cachesize to whatever you want
(don't edit anything else!)

Reboot and enjoy!
----------------------------------------------------------------------
--
2) DANIS506 --=>
http://hobbes.nmsu.edu/pub/os2/system/drivers/storage/danis506.zip


                       Daniela's S506 ADD - Gamma 5
                        ------------------------------
Check for latest release in http://hobbes.nmsu.edu/incoming

NAME
     DaniS506.ADD  -  replacement for IBM1S506.ADD

ATTENTION, Test Results!

RESULTS REPORTED FROM INTEGRATING DANIS506.ADD -=>AND<=- HPFS386 
TO OS/2 AN WARP v4 SYSTEM:  Enjoy...... :)

Before Danis506+HPFS386  (Sysbench 0.9.4e)
>  File I/O - Drive D:
>    4Kb seq.   Uncached w :     3878.003    Kilobytes/second
>    4Kb seq.   Uncached r :     5811.515    Kilobytes/second
	.
	.
>    64K random Cached   w :     4906.782    Kilobytes/second
>    64K random Cached   r :     2672.974    Kilobytes/second
>    -----------------------------------------------------------------------
>    Total                 :     3096.124    File I/O-marks
>                               ==========

AFTER DANIS506+HPFS386
>  File I/O - Drive D:
>    4Kb seq.   Uncached w :     2268.435    Kilobytes/second
>    4Kb seq.   Uncached r :    30223.332    Kilobytes/second
	.
	.
>    64K random Cached   w :    57649.151    Kilobytes/second
>    64K random Cached   r :    52182.161    Kilobytes/second
>    -----------------------------------------------------------------------
>    Total                 :    31493.542    File I/O-marks
>                              ============

System File I/O-marks increased by a factor of 10X!, sure your results
will vary but it seems a definitive and substantial improvement that
positions OS/2 Warp v4 as a quite attractive computing and SOHO
platform.

What is a Fixpack?

For a complete description,check:
http://www.os2ezine.com/v1n4/fixpak.html

To UPDATE your system to the most recent fixpack level check:
http://ps.boulder.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/softupd.htm

TIP: You will need a file named RSUINST.EXE  download it from

http://ps.boulder.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/softupd.htm
l#warp34

Now your OS/2 v4 should run like a champ!, browse through OS/2
newsgroups for any help or question you may have :/

If for any reason OS/2 'hangs' while booting, you have a 'MIRACLE' 
KEYpress ALT-F1 while OS/2 boots (There will be a small OS/2 rectangle
in the upper left corner of your monitor...  Follow the alternatives o
FIX the CONFIG.SYS file  if you messed with it...It will be wise to 
make backup copies of OS2.INI and OS2SYS.INI files. Use FM/2 file
manager to do it.

Try to have BACKUP copies of CONFIG.SYS.  just in case......If you need
help:
comp.os.os2.apps,comp.os.os2.beta,comp.os.os2.bugs,comp.os.os2.setup.misc
comp.os.os2.setup.video,comp.os.os2.setup.storage

Hardware considerations:

IBM HAS DEVELOPED OS/2 DEVICE DRIVER PAK ONLINE, THIS WEB SITE HAVE
THOUNSANDS OF DRIVERS.  
http://service.software.ibm.com/os2ddpak/index.htm

-=-> Last choice, replace the UNSUPPORTED COMPONENT for a supported
ONE.  This will depend on your motivation to use OS/2 Warp v4 <-=-=-

OS/2 WARP - SYSTEM REQUIREMENTS
Minimum Hardware Configuration. The hardware requirements for OS/2 
Warp 4 vary depending on the 
options installed and the applications you wish to run on the   
machine. Here are the minimum requirements for 
a typical computer environment: 486 or better CPU, 32MB RAM (or more),
ATAPI CD ROM, 100-300 MB HD.
OS/2 supported sound card for audio and multimedia applications
       
TIP:
If after installing an application you notice problems, edit OS2.INI 
file and remove references to the 
application.

KEY LINKS: --=> These are the best places for  OS/2 information: <=--

Information for OS/2 new users or potential ones:
A must for anyone that want to know the TRUTH about OS/2!
http://www.os2ss.com/Information/NewUsers/
http://www.honeycomb.net/os/oses/os2.htm

EZINES:
http://www.os2ezine.com
http://www.os2ss.com
http://www.edm2.com/
http://os2about.com

OS/2 FILES
http://hobbes.nmsu.edu
http://www.os2bbs.com
http://service.boulder.ibm.com/asd-bin/doc/en_us/catalog.htm
http://www.leo.org/archiv/software/os2/
ftp://merlin.itep.ru   [lss;os2warez]

OS/2 NEWS
http://www.os2ss.com/news
http://www.warpcast.com

VENDORS:
http://www.indelible-blue.com/scott/ibnews.nsf
http://www.bmtmicro.com

JAVA IDES THAT SUPPORT OS/2
Visual Age For JAVA - less than $90
http://www.software.ibm.com/ad/

Netbeans - FREE
http://www.netbeans.com

Simplicity for JAVA
http://www.datarepresentations.com/

Netrexx - FREE
http://www2.hursley.ibm.com/netrexx/

IBM ALPHAWORKS Web Site -  FREE
http://www.alphaWorks.ibm.com/formula

More information about OS/2 and JAVA
http://www.doofus.org/Java/

Check The OS/2 alternative Web Site: 
http://www.tstonramp.com/~freiheit/os2apps.shtml

WIN32 Support in OS/2:
http://www.netlabs.org/odin/

Linux/Unix and OS/2:
http://www.netlabs.org/everblue/

Check OS/2 organizations like:
http://www.netlabs.org
http://en.os2.org

Virtual Pascal
http://www.fprint.co.uk/products/virtual_pascal/

OS/2 and Sound Cards
http://www.tabi.org/timur/crystalos2.html

PKZIP v2.50
http://www.pkware.com

Remember:  Buy those applications  *IF*  you decide to continue use 
them's after 6 months TEST DRIVE

Other links:
Watcom C++ Compiler v11.0a
Nader Letter to IBM:
http://www.zdnet.com/sr/breaking/980608/980608f.html
WWW WYSIWYG editor
http://ourworld.compuserve.com/homepages/clerin/
Large OS/2 Customer list
http://rover.wiesbaden.netsurf.de/~meile/los2cl.html
XIMATI OS/2 Web Server - FREE
http://www.imatix.com/html/xitami/index.htm
V C++ GUI Development framework
http://www.objectcentral.com/
Warp 4  Engage
http://www2.hu-berlin.de/~h0444vnd/os2.htm
White Paper:  Advantages of OS/2 v4 over  WIN NT v4
http://www.minzdat.ch/forum/tanos/pages/merlinnt2.htm
Cable modems and OS/2 Warp v4
http://members.home.net/bhubley/cableintro.html
Blackdeath software
http://sprk.com/blackdeath/
Pillarsoft
http://www.pillarsoft.net/
DIGITAL Cameras and OS/2
http://users.uniserve.ca/~software/dcitu/index.html
Independent developer
http://en.os2.org/projects/indos2/
Config documentation
http://www.online.de/home/os2/csdp/about.htm
The OS/2 HISTORY
http://www.hartnell.cc.ca.us/student/hacnc/altos/OS2History.html
Visual PROLOG
http://www.visual-prolog.com/vip/vipinfo/freeware_version.htm
SETI
http://www.os2ss.com/seti

Like Arcade GAMES?, try M.A.M.E.

http://hobbes.nmsu.edu/cgi-bin/h-search?key=mame&pushbutton=Search
ROMS:
http://www.ArcadeAtHome.com/

Last but not least,we are seeking developers to join OS/2.  Tools 
available includes JAVA, C++ (GNU, Visual 
Age for C++ v4),  Pascal, Rexx, Netrexx. There are others.

THE OS/2 WARP DEVELOPERS TOOLKIT IS AVAILABLE AT ONE OF THE TWO URL'S
PROVIDED HERE. JOIN OS/2 NOW!

Join one of many projects at http://www.netlabs.org

Maybe, it will be WISE to buy OS/2 V4 rather than try to download it 
since it is a 250MB file.  LOTUS SS v1.1 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: mail2news@nym.alias.net (1:109/42)

+----------------------------------------------------------------------------+

From: flash-bounce@nym.alias.net                        30-Aug-99 21:16:11
  To: All                                               30-Aug-99 16:56:28
Subj: (2/2)  Warp_v4_SuperCharged! 

could be downloaded with EMTEC FTP and resuming file download will be 
required since many users are
connecting to those URL's. YES This message is working!...

Note:
OS/2 v4 is available from Indelible Blue..

NOTE:
If you don't want to bother downloading The OS/2 Warp 250MB file or 
LOTUS SMART SUITE V1.1 (1999) 
Edition , Goto INDELIBLE BLUE:

   * LOTUS SMART SUITE ACADEMIC VERSION IS ONLY $83  (AN648NA)
http://www.indelible-blue.com/ibapps/products.nsf/by+partnumber/AN645N
A

   * OS/2 V4 ACADEMIC VERSION IS ONLY $85 (84H7459)
http://www.indelible-blue.com/ibapps/products.nsf/by+partnumber/84H745
9)

What it takes?  The  GUTS to install OS/2 Are you so GOOD?

TIP:
USE ALT-F1 WHEN BOOTING FAILS.  IT IS NOT COMMON BUT THIS IS A GREAT
TRICK!
 
----------------------------------------------------------------------
--
IMPORTANT NOTE:
If you find this info interesting or useful, save to a file NOW!.  You
don't know when you may need it!.  Also, 
you could make copies (or forward through email) for your friends.  
This guide will not be posted
anymore to usenet.  Maybe someone could post it from time to time...

WHAT YOU CAN DO?:
   * Forward this message to your friends. You could forward through 
an
     anonymous remailer.  More about remailers later..
   * Forward (through anonymous remailers also) to PC Newspersons
        o Techwire
        o Infoworld
        o PC World
        o ZDNet
        o Or other
   * Post (anonymously, if you want) to OS-related Newsgroups
   * Tell PC media you use, like and use OS/2
   * Ask the press for better coverage of OS/2 (ZDNet, Infoworld,
     Techweb)
   * If you are an OS expert and have capabilities and bandwidth
     resources to put online an FTP server,(someone in Europe? 
     or latin america?) with key apps, utils, etc..

Must Have utilities (THE BASICS):

A)    INFOZIP UNZIP (EQUIVALENT TO PKUNZIP.EXE)
ftp://hobbes.nmsu.edu/pub/os2/archiver/unz540x2.exe
Installation:
1)make dir \UNZIP in c: d: or whatever OS/2 partition
2)copy and extract unz540x2.exe into \unzip
3)edit config.sys and add \unzip to the path
4)remember to end \unzip reference in the path with ;

B)    FILE_MANAGER
ftp://ftp.bmtmicro.com/bmtmicro/fm2_301.zip
Installation:
1)make dir \FM2 (or whatever) in c: d: or whatever OS/2 partition
2)copy and extract fm2_301.zip \FM2 (or whatever)
3)run install.cmd

C)    CONFIG.SYS  ANALYZER OPTIMIZER
ftp://hobbes.nmsu.edu/pub/os2/util/config/cfgmt100.zip
Installation
1) Make dir \cfgmt (or whatever)
2) Copy cfgmt100.zip and extract with unzip.exe
3) run install.cmd

D)    EMX (optional, required for some utilities and GNU)
ftp://hobbes.nmsu.edu/pub/os2/dev/emx/v0.9d/emxrt.zip

Installation
1) copy emxrt.zip to c:\ (root)
2) unzip with unzip.exe (it should create a sub-dir \emx, test first 
in
other dir if you want)
3) Add \emx\bin to config.sys path, add emx\dll to config.sys library
path

E)    Sysbench 0.9.e
ftp://hobbes.nmsu.edu/pub/os2/util/benchmark/sysb094e.zip

F)    Memsize - System Resources Monitor
http://www.msen.com/~rpapo

G)    Process Commander (after basic Install, upgrade with pcfix1.zip)
-------------------------------------------------------------------
PC Newsreporters, what we can do with them?.  Ok, we can suggest to 
forward (anonymously) this message to the news person of your choice.
This will tell them how to 'tweak' OS/2 for greater performance.  Linux
user's like to tweak their systems (and press people respect that) we 
have the right to make the same to our 
OS.

You can choose anyone and send this message to make them aware that 
OS/2 can be Super-Charged.  Maybe, one of them could have the guts (or
courage) to make it and run some benchmarks against Win 98, Win 2000,
and Win NT 4.  It should be interesting to see results with  a
Super-Charged OS/2 setup (FP11, DANIS506, and HPFS386) against Win 98,
Win 2000, and Win NT 4.
----------------------------------------------------------------------
--
Newspersons and email contact info...
You may also send a copy of this guide to your prefered newsperson to 
make he(she) aware of the OS/2 
"Tweak" and Tricks included here.  You may want to send via 
anonymous... see below...

 Name                   	email address                 
Publication/WebSite
 Infoworld              	electric@infoworld.com        	InfoWorld
 Mary Joe Foley         	mfoley@zd.com                 	Sm@rtReseller
 Tom Yager              	tyager@maxx.net               	InfoWorld
 Charles Cooper         	charles_cooper@zd.com         	ZDNET News
 Editor                 	pcmag@zd.com                  	PC Magazine 
 John Clyman            	john_clyman@zd.com            	PC Magazine 
 Michael Fitzgerald     	michael_fitzgerald@zd.com     	ZDNET
 Maria Seminerio        	maria_seminerio@zd.com        	ZDNET
 Sean Silverthorne      	sean_silverthorne@zd.com      	ZDNET
 ZDNet Benchmarks 	zdbopwebmaster@zd.com 	ZD Benchmarks
 Scott Berlinato        	scott_berinato@zd.com         	PC Week
 Claudia Graziano       	claudia_graziano@zd.com       	PC Week
 John Madden            	john_madden@zd.com            	PC Week
 James Miller           	james_miller@zd.com           	PC Magazine
 Alan Zeichick          	zeichick@camdenassociates.com TechWeb/CMP
 David Lidski           	dlidsky@zd.com               	PC Magazine
 Sharon Terdeman 	sharon_terdeman@zd.com        	PC Magazine
 Wayne Rash     	wrash@mindspring.com          	TechWeb/CMP
----------------------------------------------------------------------
How to send anonymous email and/or post anonimously to usenet:
http://www.skuz.net/potatoware/reli/UserMan.htm
http://www.replay.com/remailer/
http://mail2news.cjb.net/
ttp://www.mute.dircon.co.uk/remailers.html
http://www.metcorp.com/sean/remail.html
http://www.skuz.net/potatoware/reli/UserMan.htm
NEWSGROUP: alt.privacy.anon-server
thread--=> List of Reliable Remailers --=> Updated daily!

NOTE: SOME REMAILERS ARE UP/AND DOWN EASILY. Test First!, and test 
with
dummy messages to some dummy newsgroup.  

::
request-remailing-to: remailer@replay.com

::
request-remailing-to: remailer@xxxxx.com

::
Anon-post-to:newsgroup
or 
Anon-to: john_doe@columbia.net

##
subject:whatever
----------------------------------------------------------------------
--
Remailers reliability and info...
alt.privacy.anon-server

Attention if you receive this doc, please forward to a fellow worker 
who might be interested in this info...

INTERESTING TIP:
You can forward this message from usenet to your own email account 
(Pronews forward, right side) and 'Edit Message as New' with
Communicator 4.61 and repost to usenet if you want or forward to a
friend or to a newsperson.

Chiao!

Extra:
modify config.sys
SET MENUSFOLLOWPOINTER=YES

and you will have a more functional mouse pointer..ala Win 95!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: mail2news@nym.alias.net (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         30-Aug-99 19:31:09
  To: All                                               30-Aug-99 19:58:00
Subj: Re: Wav to CD Audio

From: racette@cablevision.qc.ca (Martin Racette)

On Mon, 30 Aug 1999 18:37:01, "Hal 
Murray" <hjmurray@home.com> wrote:

>  > > > Is it possible to copy some .WAV and  > > > write them on a CD-R in
Audio format  > > > i.e.: that can be read by a standard CD  > > > play in a
car or home by using RSJ 2.83  > > > ? > >  > > Just drag the Wav-files into
CDView and burn. > >  > > Yours etc. > >   Torsten Balle Koefoed > >  > >
(Replace servername in address with: writeme<dot>com) >  > I tried it but it
won't work here the  > error message I get :The easiest I have found is to use 
CD View. By the looks of the error
> message you have 'attached' the writer drive before selecting your
> files to copy.Open CD View of your regular CD and you will see the audio
files.
> Then open CD View of your writer drive. Drag the audio files to the
> writer drive and hit the record button. When done close the session.If you
have WAVs on you hard drive open CD View of your hard drive
> and go to the directory where you have the WAV files. Drag the files
> you want to the window of your CD View writer drive and drag them
> over to it and hit record.My regular old CD drive can not read audio data
tracks well, they
> 'skip' so I use my CD writer to copy audio tracks to my hard drive.
> this creats WAV files. Then using CD View I drag them back to the CD
> writer drive.Hal Murray Calgary, AB

What you do, I already now how to do it,
but what I want to do is to copy some 
WAV files that I already got and were 
not created with CDVIEW i.e.: copy a WAV
file into an Audio CD

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dink@dont.spam.me                                 30-Aug-99 15:24:16
  To: All                                               30-Aug-99 19:58:00
Subj: my os/2 apps website fixed

From: "dinkmeister" <dink@dont.spam.me>

http://dink.org was down for the last couple of days
because of a dns problem, everything should be up
to snuff again =)

- dink ( http://dink.org )




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       30-Aug-99 19:43:29
  To: All                                               30-Aug-99 19:58:00
Subj: Re: CAD recommendation

From: Will Rose <cwr@cts.com>

gordon mcleod <gmcleod@idirect.com> wrote:
: IBM Cad for OS2 was a very powerfull 2d cad system and IBMCad3x was a very
: good light version  CadKey v7 for dos runs very well under OS2 as does
: DataCad for Dos
: A company in England bought Cad3x and I understand there is now a 4X but I
: haven't any info on it and I don't think there is a web site for it
: Acad 10, and 12 for Dos will also sun in OS2

Cad 3X won't run at 1024x764 by > 256 colours - it's fine under that.
I don't think it was ever patched or updated; I tried hard to get a
working version for OS/2 a while back, since it's small and does all
I want a CAD program to do.  Anyone knowing about an upgrade, please
let me know too.


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       30-Aug-99 19:53:11
  To: All                                               30-Aug-99 19:58:00
Subj: Process Commander and DOS box.

From: Will Rose <cwr@cts.com>

I've been hunting down problems with Process Commander, and have found
an odd one; the full-screen version seems to prevent a DOS box running
more than once.  That is, you can start a windowed DOS session just fine,
but if that window is closed and you try to re-open it you get an error
message "Cannot run" or words to that effect.  I've been trying to find
this problem's source for some time; at a guess it appeared with FP 22.
However, I've confirmed its appearance and disappearance with Process
Command 1.02 and FP 40.

Anyone seen anything similar?  I very much like Process Commander - it's
not the essential that it used to be, but I still miss it a lot.


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          30-Aug-99 20:17:24
  To: All                                               30-Aug-99 21:34:14
Subj: Re: Important News From Dan Porter of Innoval

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 30 Aug 1999 15:08:43, esther@bitranch.com (Esther Schindler) a 
crit dans un message:

snippercized
> 
> I still think it's a class act. It makes the product available to 
> those who want to use it.

Oh, I'll stop a moment and quibble on that point, thanks. (Hot out, ain't 
it?)

Well, it would have been classier to post the source. 

As it is, Innoval's partial action only makes the product AS IT STANDS 
TODAY available for those who want to test it. 

Should conditions change, for instance should it fail to be 100% Y2K just 
to pick a looming possibility, what's someone to do who has begun using it 
for all their mail, sorting stuff into folders and making the program's 
interface more personalized, and all? They'll just have to dump it.

On the other hand, were Innoval to rescue their shall we say "debatable" 
standing in this community by not just leaving the Halloween candy on the 
porch in a big cardboard box, but by wrapping each piece in the source 
code, even in a GNU thingie, they would be giving us a Fighting Chance of 
staying alive staying alive woo wooo woo wooop staying alive.

And whoever there is among those smarter than I who can take that code, 
suss it out, and say, well sir here's where the gol-blimey thing was 
gol-blimey screwy from day one, or whatever, and issue his/her little Fix 
for it, might even be able to charge a few bucks to each of us for the 
fixkit.

It would be a neat experiment. 

As committed as I am to Nick Knight's ongoing work with making MR2Ice even 
better, I'm a registered user of PostRoad products and would enjoy having 
the chance to promote the wider support of anyone brave enough to tackle 
something like this.

And if things change even more, and Innoval decides one day to come back 
into OS2land, their stock with us would be very high indeed. They would 
naturally be coming out with brand new product, based on brand new code, 
and my theory is they wouldn't be hurt a bit by having the old version 
banging around for free, as some tin-hearted accountants would be worrying 
about.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: Ted_E@bc.sympatico.ca                             30-Aug-99 12:45:22
  To: All                                               30-Aug-99 21:34:14
Subj: Re: Can OS/2 users grow up and think like Linux users? 

From: Ted Edwards <Ted_E@bc.sympatico.ca>

John Hong wrote:
 
> John L. Daschbach (jldasch@3-cities.com) wrote:
 
> : especially when using *real* applications, the WPS gets totally
> : ...
> : using the combination of Navigator and a Lotus product (WordPro, 123,
> : Approach, Freelance).

These are *real* applications?  Do I detect some bias?  I always thought
123 was a toy for those who can't do math.  ;-)
 
>         Do you have WatchCat installed?  I have found that to help out in
> the rare occasions of OS/2 distress...

What is WatchCat please?

Ted


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Ted_E@bc.sympatico.ca                             30-Aug-99 12:57:24
  To: All                                               30-Aug-99 21:34:14
Subj: Re: Any experience with "TAME"?

From: Ted Edwards <Ted_E@bc.sympatico.ca>

> : :>Does a good job if you've got DOS apps that hog the CPU.  

Missed the start of this thread but I have an old DOS app (READY! - it's
an outliner).  When I moved to OS/2, I installed this as a DOS app. 
Problem is, it's a TSR and hogs the CPU big time.  A friend suggested to
go to the DOS properties and set IDLE_SECONDS  to 2 and IDLE_SENSITIVITY
to 25.  This cured the problem.

BTW, anyone know of a more modern but similar outliner?  It's great for
phone lists, etc.

Ted


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Ted_E@bc.sympatico.ca                             30-Aug-99 13:21:28
  To: All                                               30-Aug-99 21:34:14
Subj: Re: CAD recommendation

From: Ted Edwards <Ted_E@bc.sympatico.ca>

SERWAS1 wrote:
 
> Would appreciate any advise on a CAD program, or a good drawing program.

I'm using Generic CADD 6.1.1, a DOS program which runs well on my system
(IBM ThinkPad 385XD with OS/2 Warp 4 FP-10).  I've not seen better for
2D work.  Unfortunately, Autodesk bought it and then killed it - too
much competition for AutoCad at one tenth the price.  If you can lay
hands on a copy (I hear there are still some around), you won't regret
it.

A friend of mine runs TurboCAD under OS/2.  Not as much jam as Generic
but not bad.

Ted

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   30-Aug-99 14:35:04
  To: All                                               30-Aug-99 21:34:14
Subj: Re: Wav to CD Audio

From: Kris Kadela <kris@dgraph.com>


Martin Racette wrote:
> 
> On Mon, 30 Aug 1999 18:37:01, "Hal
> Murray" <hjmurray@home.com> wrote:
> 
> >  > > > Is it possible to copy some .WAV and  > > > write them on a CD-R in 
Audio format  > > > i.e.: that can be read by a standard CD  > > > play in a
car or home by using RSJ 2.83  > > > ? > >  > > Just drag the Wav-files into
CDView and burn. > >  > > Yours etc. > >   Torsten Balle Koefoed > >  > >
(Replace servername in address with: writeme<dot>com) >  > I tried it but it
won't work here the  > error message I get :The easiest I have found is to use 
CD View. By the looks of the error
> > message you have 'attached' the writer drive before selecting your
> > files to copy.Open CD View of your regular CD and you will see the audio
files.
> > Then open CD View of your writer drive. Drag the audio files to the
> > writer drive and hit the record button. When done close the session.If you 
have WAVs on you hard drive open CD View of your hard drive
> > and go to the directory where you have the WAV files. Drag the files
> > you want to the window of your CD View writer drive and drag them
> > over to it and hit record.My regular old CD drive can not read audio data
tracks well, they
> > 'skip' so I use my CD writer to copy audio tracks to my hard drive.
> > this creats WAV files. Then using CD View I drag them back to the CD
> > writer drive.Hal Murray Calgary, AB
> 
> What you do, I already now how to do it,
> but what I want to do is to copy some
> WAV files that I already got and were
> not created with CDVIEW i.e.: copy a WAV
> file into an Audio CD
> 
> //-------------------------
> Thank you in advance
> 
> Merci a l'avance
> 
> Martin
> 
> http://205.237.57.73/

-- 

The WAVs have to be in a very specific format, 16bit PCM, 44.1(or
sometnionh like that) kHz.
Check them first.



**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: ZIKONYL@IBM.NET                                   30-Aug-99 22:57:17
  To: All                                               30-Aug-99 21:34:14
Subj: Re: CAD recommendation

From: ROBERTO GAINZA <ZIKONYL@IBM.NET>


Dave Critelli escribi:

> I own BlueCAD.  It's a good package.  However I won't make it my production
CAD
> package (current Generic CAD for DOS) because BlueCAD's technical support
(at
> best) _stinks_.  They take forever to respond to your e-mails (sometimes
months)
> when they decide to do so.  It's unfortunate because I think BlueCAD has the
> makings of a very good program if it were only supported and marketed
properly.
>
> Good Luck.
> Dave
>

I suscribe this mail, BlueCad, is very good but only 2D. I work with it, and
you can
dowload a demo from hobbes.

> Chris Stumpf wrote:
>
> > The only CAD programs I know of for OS/2 are BlueCad and Microstation.
> > BluCad is an inexpensive program from italy and is for basic 2D drawing.
> > Microstation is a full blown cad package from Bentley in the same realm as
> > AutoCad, that includes price.  Bentley's student discounts are very good
> > though.  I think you can get it for about $250 instead of $3000 with the
> > student discount.  If you only need the the feaures that the core program
> > provides, Microstation is an excellent choice as they support many
platforms.
> >  There are almost no add ons for the OS/2 version though.  Here is there
url:
> >
> >                 http://www.bentley.com
> >



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: cfrank@rumms.uni-mannheim.de                      30-Aug-99 21:20:20
  To: All                                               30-Aug-99 21:34:14
Subj: Warp Server and HPFS386

From: cfrank@rumms.uni-mannheim.de (Carsten Frank)

On my small server I'm going to try out the hpfs386 filesystem. 
After installing, if I would have trouble Can I deinstall it?

Would this be a performance improvement?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jpedone_no_spam@flash.net                         30-Aug-99 21:27:22
  To: All                                               30-Aug-99 21:34:15
Subj: Re: 4-digit year in 'dir' list??

From: jpedone_no_spam@flash.net

In <slrn7skjst.uo.stefand@ferrari.lcam.u-psud.fr>, stefand@lcam.u-psud.fr
(Stefan A. Deutscher) writes:
>On 29 Aug 1999 03:56:22 GMT, your.user.name@your.host.name
><your.user.name@your.host.name> wrote:
>>In article <37C6A580.9A360C36@nospam.com>, Jim Lewis wrote:
>>>Stefan A. Deutscher wrote:

>
>Short reply:  1. Let me quote my Tae-Kwon Do Master: You just do it :-)
>Longer reply: 2. Read the online docs, then go to 1. ;->
>Honest reply: 3. I have no clue yet, since I haven't done 2. But I was
>                 sure I'd get lots of "what for, it can be done in REXX
>		 on the back of an envelope" replies, and I am
>		 _convinced_ it can be done. Of course, I never even
>		 inhaled the docs for the appropriate REXX function
>		 calls. Maybe I'll peek a bit in the docs one of these
>		 days, could be fun.
>
>

It is possible with either the Stream or SysFileTree functions but both of
these will only return the last mod date of the file in question.  What I
should
have mentioned in my earlier post is that if you want the other dates (like
ceated) you'll have to go into the file EAs with SysPutEA and SysGetEA.
If this is what you're after pick up a recent copy of rexx tips and tricks
from hobbes for a really good example.

 
J. Pedone
jpedone@flash.net
http://www.flash.net/~jpedone
 
Windows NT: From the makers of Windows 3.1!
Better ... stronger ... faster!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: jklewis@nospam.com                                30-Aug-99 16:24:28
  To: All                                               30-Aug-99 21:34:15
Subj: Re: 4-digit year in 'dir' list??

From: Jim Lewis <jklewis@nospam.com>

 Okay, I have this util just about done. Doing what was asked for took about
10
seconds to do, trying to make it work like dir was the real challenge. I tried 
every
combination I could think of, let me know if there are any problems.

 For those that missed the original post, I have written a util which shows
the
following, kind of like dir:

Filename    Size      Creation info           Update info           
Attributes
------------------------------------------
jdir.c          2345       8/30/1999  5:00p    8/30/1999  5:00p    A

 This util, named "jdir", shows all files in the directory even hidden and
system
ones. It does not have any parms, except for "-h" which is a crude help
message. I
do not yet show the size of the EAs because I do not know how to do that
without
opening the file (I think it will take too long to open each file just to list 
a
dir. The internal dir command must "cheat" somehow). I might add an option to
do
this in a later version.

 Send problems, requests, etc. to "jklewis at austin.ibm.com" or post them
here.  I
will be sending  the util to Bob, Stefand, and Bill. If anyone else requests a 
copy
be sure to include a valid email address.


--

Jim Lewis
Not speaking for IBM.
Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Network Computing Division (1:109/42)

+----------------------------------------------------------------------------+

From: jack.troughton@nospam.videotron.ca                30-Aug-99 21:52:22
  To: All                                               30-Aug-99 21:34:15
Subj: Re: Help! Runworkplace Winstartapp %1

From: jack.troughton@nospam.videotron.ca (Jack Troughton)

On Fri, 27 Aug 1999 12:51:33, Martin Bunzel FH <bunzel@fh-muenchen.de>
wrote:

If you can't reboot with the archive-function, try to look up the
archived files in you [drive]\os2\archives\ directory and the mappings
for the files are in 'll find the specific and renamed files from 1...to
5 (this depends on the list in archives.$$$) Normally there must be
subdirectories 0X, 1X, 2X, 3X and current. Start at current and then try
1X-3X (0X is the installation configuration) but only if Alt-F1 will
miss. You can also use the makeini - command from os/2 to create new
(plain) ini-files for a standard - desktop. Good luck!

Martin

borsen@my-deja.com schrieb:
> 
> After 7 years of running Warp, I can't boot as the following error
> appears:
> Program Pointed to by set runworkplace = line in config.sys, this file
> could not be started.  Winstartapp returned %1.
> 
> A gray screen appears and nothing....cancel or ignore.
> 
> I have run check disk (HPFS), booted from floppies to verify all was
> there to no avail.  I have not installed anything in months.  This
> system has been very stable!  It is currently W4 FP9 - - I believe I
> upgraded this way back when.  Does anyone know what to "fix".
> 
> Please respond to my email (sborsen@ibm.net) and to this group (I have
> scanned dejanews and have not located any good advice.

To me this sounds more like corruption of the PMSHELL.EXE file.  You 
could try getting a copy of it from either your install cd, or from 
the last fixpack you installed, and copy it back onto the hard drive.

Good Luck!

Jack Troughton   ICQ:7494149
http://jakesplace.dhs.org
jack.troughton at videotron.ca
jake at jakesplace.dhs.org
Montral PQ Canada

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: mcbrides@erols.com                                30-Aug-99 17:39:04
  To: All                                               30-Aug-99 21:34:15
Subj: Re: Warp Server and HPFS386

From: mcbrides@erols.com (Jerry McBride)

In article <41ZkE0rRdj2J-pn2-4z246NKJJP0z@localhost>,
cfrank@rumms.uni-mannheim.de (Carsten Frank) wrote:
>On my small server I'm going to try out the hpfs386 filesystem.
>After installing, if I would have trouble Can I deinstall it?
>

Yes...

>Would this be a performance improvement?
>

Yes...

--

*******************************************************************************

*            Sometimes, the BEST things in life really ARE free...           
*
*       Get a FREE copy of NetRexx 1.150 for your next java project at:      
*
*                     http://www2.hursley.ibm.com/netrexx                    
*
*******************************************************************************


/----------------------------------------\
| From the desktop of: Jerome D. McBride |
|         mcbrides@erols.com             |
\----------------------------------------/

--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TEAM-NETREXX (1:109/42)

+----------------------------------------------------------------------------+

From: ispalten@austin.rr.com                            30-Aug-99 22:19:14
  To: All                                               30-Aug-99 21:34:15
Subj: Re: Fixpack

From: Irv Spalten <ispalten@austin.rr.com>

From the FP README file,

--------
    - Error message:
      CSF257: No product has been selected.

      Explanation:
      This error message is reported in several situations.  You may
      not have selected a product to service in the RESPONSE.FIL, or
      FSERVICE may not have found any products to service.  If FSERVICE
      didn't find any products to service, either the product
information
      on the system did not match the product information in the FixPak,
      or FSERVICE determined that the FixPak would back-level the
system.

      Solution:
      Check the prerequisites for the FixPak and make sure that the
      system contains the proper pre-requisites.  Also, be sure that
      the FixPak you are trying to install is being applied to the
      appropriate product.  If the product information is incorrect,
      you may need to copy the product SYSLEVEL.xxx file from the
      install media.
---------

Your SYSLEVEL.OS2 is probably damaged, copy the original off the
distribution CD.

Irv


paul_belsack@my-deja.com wrote:
> 
> Problem with IBM fixpack 40 for os/2 v 3
> OS/2 runs on a pc server 500(P390)
> If I apply the following corrective service facility cs_140 for os/2v3;
> 
> *   This is a sample response file which can be used when applying
> service
> *   for the first time using FSERVICE when there is no existing
> *   archive of the product being serviced.
> *   It will service all partitions, and place an archive in each
> partition.
> *   It does not take a backup of changed files.
> *
> *   :LOGFILE C:\OS2\INSTALL\SERVICE.LOG
> *   :FLAGS REPLACE_PROTECTED REPLACE_NEWER
> :FLAGS REPLACE_PROTECTED
> :SOURCE A:\
> :SERVICE
> :SYSLEVEL \OS2\INSTALL\SYSLEVEL.OS2
> :ARCHIVE \ARCHIVE
> :SERVICE
> :SYSLEVEL \MMOS2\INSTALL\SYSLEVEL.MPM
> :ARCHIVE \ARCHIVEM
> *
> *   End of sample SERVICE response file without backup.
> 
> The fixpack ends after I want to apply the first disk and I get a
> message
> CSF257 : No product has been selected
> 
> Even though syslevel.os2 (=v3.0 r8.2) and syslevel.mpm(=v3.0) are know
> when I turn
> Syslevel.exe.
> 
> And It seems that I am not able to start the csf?
> Does anyone have any suggestions?
> 
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: swanee@pillarsoft.net                             30-Aug-99 18:01:03
  To: All                                               31-Aug-99 03:52:24
Subj: Re: Important News From Dan Porter of Innoval

From: Wayne Swanson <swanee@pillarsoft.net>

hamei@pacbell.net wrote:
> 
> In <37CA987B.EFF82627@pillarsoft.net>, Wayne Swanson <swanee@pillarsoft.net> 
writes:
> >"Steven C. Den Beste" wrote:
> >>
> >> Sorry to disagree with you, but in fact there's a lot you can do with a
mail
> >> program.
> >>
> >> How about more intelligent filtering?
> >
> >Got it years ago with MR/2 ICE
> >>
> >> Better folder manipulation?
> >
> >Got it years ago with MR/2 ICE
> >>
> >
> >The rexx thing is the one that really makes it hugely powerful for
> >almost anything. Maybe Agent or Eudora could add that someday with
> >Windows built in scripting.
> >
> 
> BUT : can you write a Rexx script that will *answer* all that darned
> mail for you ?

Haha, yeah but it never gives a sensible answer. :-)

Of course, some say that's the way I answer email anyways. <BG>

Wayne Swanson
------------------------------------------------------------
email: swanee@pillarsoft.net
PillarSoft: http://www.pillarsoft.net
Developers of: WarpZip, DeskTop Backup (DTB), SFX Installer
               ShowTime/2 and the Enhanced E Editors
Vice President: VOICE (Virtual OS/2 International Consumer Education)
VOICE: http://www.os2voice.org
------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PillarSoft (1:109/42)

+----------------------------------------------------------------------------+

From: Spammers@Bite.Me                                  30-Aug-99 23:00:09
  To: All                                               31-Aug-99 03:52:24
Subj: Apache 1.3.9 broke my REXX cgi

From: "Jaime A. Cruz, Jr." <Spammers@Bite.Me>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

Okay, I'm getting frustrated here.  I don't know what happened, these things
worked with every other version of Apache 1.3 that I've tried.  Suddenly,
after upgrading to 1.3.9, whenever I try to access one of my many REXX CGI
scripts, my browser displays this cryptic message:

Internal Server Error

The server encountered an internal error or misconfiguration and was unable
to complete your request.

Please contact the server administrator, spammers@bite.me and inform them of
the time the error occurred, and anything
you might have done that may have caused the error.

More information about this error may be available in the server error log.


Apache/1.3.9 Server at Jaime Port 80

When I check the error_log file, I find this:
[Mon Aug 30 18:50:54 1999] [error] [client 10.0.0.1] Premature end of script
headers: H:\VIRTUAL_HTML\CGI-BIN\TESTCGI.CMD

This script has not changed in months.  Why is Apache 1.3.9 suddenly throwing
up over this (and ALL) of my cgi scripts??  What changed??  Help!!



Jaime A. Cruz, Jr.

o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o
o                                                 o
o  Visit the Nassau Wings Motorcycle Club at:     o
o  http://www.nassauwings.org/                    o
o  A Charter Member of the Motorcycle Web Ring!   o
o                                                 o
o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: cp850

wj8DBQE3yv6MgvzYfxgMc34RAt9VAJwPWQcRIygmyAROY1y0oKTFOPhycgCeL9t7
M4p89lhoZ8evJhlgLJfsfdU=
=4US/
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nassau Wings Motorcycle Club (1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               30-Aug-99 23:11:29
  To: All                                               31-Aug-99 03:52:24
Subj: Re: Important News From Dan Porter of Innoval

From: esther@bitranch.com (Esther Schindler)

Buddy, you might like it if Innoval posted the source. But your 
quibble doesn't take into account that the company may have very good 
reasons to *not* do so?

Don't look gift horses in the mouth. They could have said, "Screw you,
we're cancelling all product support." Instead, they gave the OS/2 
community a gift.

--Esther

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     31-Aug-99 00:16:14
  To: All                                               31-Aug-99 03:52:24
Subj: Re: 4-digit year in 'dir' list??

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Mon, 30 Aug 1999 16:24:56 -0500, Jim Lewis wrote:

-> This util, named "jdir", shows all files in the directory even hidden and
system
->ones. It does not have any parms, except for "-h" which is a crude help
message. I
->do not yet show the size of the EAs because I do not know how to do that
without
->opening the file (I think it will take too long to open each file just to
list a
->dir. The internal dir command must "cheat" somehow). I might add an option
to do
->this in a later version.

Use DosFindFirst with FIL_QUERYEASIZE and you get FILEFINDBUF4 structs
back that tell you this information. The cbList field contains either 4
which means no EAs or a number that's twice the number of bytes of EAs
attached (don't ask why, I don't know but that is the way it works!).


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               30-Aug-99 23:29:08
  To: All                                               31-Aug-99 03:52:24
Subj: Re: Important News From Dan Porter of Innoval

From: esther@bitranch.com (Esther Schindler)

On Mon, 30 Aug 1999 16:22:40, "os2pal" <gnrm@earth.gh.net> wrote:
| Surprise? Are you under the assumption that their products were the pillars
| of intelligence?

Products have intelligence? You mean, someone perfected artificial 
intelligence and *didn't tell me*?!

Seriously, I do understand your point. I'm not speaking to any given 
vendor's application quality. What makes one software package "better"
than another is a matter that's very much in the eye of the beholder, 
and is the reason that the OS/2 community could support three fine 
email clients for all these years. (I chose MR/2 ICE for myself, but I
like features of the other packages, too.) I'm not trying to review 
Innoval's products, here; I've done that for pay elsewhere.

However, there's a distinct difference between "I never liked their 
stuff anyway" and "I thought their support sucked" (which you didn't 
explicitly say), and "they aren't able to keep the doors open, at 
least with this product/os division."

os2pal, I've dealt with more OS/2 ISVs than has anybody else. I've 
listened to their personal and business concerns since 1992. I've seen
some of them succeed, and I've seen some fail. I've met some that are 
(IMNSHO) brainless twits, some that are technically savvy but lack the
business sense of a sparrow, and some that chose a non-viable part of 
the OS/2 application universe. (We've had some really excellent 
graphics applications to choose from, for instance, but without a 
significant Framemaker-type DTP or GoLive-like Web site development 
app, there's nothing on which to peg the graphics you create.)

Some of those ISVs failed because they didn't know how to run a 
business. Some of them extended the scope of their business, to 
include Windows or Java or whatever else seemed appropriate to them. 
Some quit OS/2 entirely, and some left the software business. This 
isn't different from any other section of our industry or, for that 
matter, any other industry. (Teen idol Bobby Sherman is now an LA cop.
Does that mean that the music business is dead?)

While I never personally chose an Innoval product for my own use, I 
have never, for a moment, considered Dan Porter to be less than a man 
of integrity, who believed in his company, in OS/2, and in serving his
customers. (Before you point it out: Sure, they weren't perfect. 
Neither am I, and I suspect neither are you. Business is hard.) He 
wanted OS/2 to be a success, and he wanted Innoval to succeed along 
with it. He gave it his best shot. It didn't work.

| Nah, why post unless there is a hidden agenda behind it? If you'd read the
| post carefully...

Sheesh. Dan has enough integrity to be honest with the OS/2 community.
If he can make a success of his other products, then more power to 
him.

(Strangely enough, this puts me in the position of agreeing with Tim 
Martin. I suspect we'll get over it. <grin>)

| > --Esther
| >   who had to turn away from her 100%-OS/2 business, too
| 
| <chuckle>  Had a hunch you'll see the light sooner or later <another
| chuckle>

I have no idea what you intended to communicate in that sentence, but 
it sure didn't make it across to me.

--Esther

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: mwarshe@earthlink.net                             30-Aug-99 20:34:19
  To: All                                               31-Aug-99 03:52:24
Subj: Star Office 5.1 install

From: Michael Warsheski <mwarshe@earthlink.net>

I downloaded SO51 for OS/2.  When I try to install it on a Warp 4
machine it gives me this error message " Could not unpack file
'setup.zip' Program aborted. 1001"

I used RAR.EXE to verify the executables contents and it reported a
problem with the setup.pdf file.  The rest of the contents are OK.  The
RAR program does not display a file called setup.zip within the
executable.

Any help would be appreciated.

Regards,

Mike Warsheski


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    30-Aug-99 18:15:26
  To: All                                               31-Aug-99 03:52:24
Subj: Re: Important News From Dan Porter of Innoval

From: dcasey@ibm.net (Dan Casey)

In article <37db7676.429159568@news.kraftwerk.net>,
forkd4nisse@dtek.chalmers.se (Martin Nisshagen) wrote:
>
>I agree with Donnelly. Open source would be the best thing in this case.
>

I agree that it would be nice to have the source code available.
However, I would guess that because InnoVal is still doing
development, Sales and support for other Internet products, and these
products may very well contain some of the proprietary code that
InnoVal developed and used in the applications that they have now
released to the public for free. If this be the case, I can't blame
Dan for not wanting to "open source" these applications.

I haven't had any sort of direct contact with Dan Porter, so I can't
say, with any certainty,  what and why he is doing this as he is. My
guess is that he simply wanted to "give" these apps to the OS/2 users
in appreciation of their support for him. Pity it wasn't enough to
keep him going with OS/2 projects.


--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: dmcbride@no.tower.spam.to.org                     31-Aug-99 01:07:19
  To: All                                               31-Aug-99 03:52:25
Subj: Re: Apache 1.3.9 broke my REXX cgi

From: "Darin McBride" <dmcbride@no.tower.spam.to.org>

On Mon, 30 Aug 1999 23:00:18 GMT, Jaime A. Cruz, Jr. wrote:

>-----BEGIN PGP SIGNED MESSAGE-----
>Hash: SHA1
>
>Okay, I'm getting frustrated here.  I don't know what happened, these things
>worked with every other version of Apache 1.3 that I've tried.  Suddenly,
>after upgrading to 1.3.9, whenever I try to access one of my many REXX CGI
>scripts, my browser displays this cryptic message:
>
>Internal Server Error
>
>The server encountered an internal error or misconfiguration and was unable
>to complete your request.
>
>Please contact the server administrator, spammers@bite.me and inform them of
>the time the error occurred, and anything
>you might have done that may have caused the error.
>
>More information about this error may be available in the server error log.
>
>
>Apache/1.3.9 Server at Jaime Port 80
>
>When I check the error_log file, I find this:
>[Mon Aug 30 18:50:54 1999] [error] [client 10.0.0.1] Premature end of script
>headers: H:\VIRTUAL_HTML\CGI-BIN\TESTCGI.CMD
>
>This script has not changed in months.  Why is Apache 1.3.9 suddenly throwing
>up over this (and ALL) of my cgi scripts??  What changed??  Help!!

Probably because the system more tightly checks the headers now?  Could you
post the headers your script provides?  Or perhaps the portion of the code
that produces the headers?

[I switched away from REXX to Perl a while back on my server...]

---
Disclaimer: unless explicitly mentioned otherwise, I do not speak,
nor have I ever spoken, for the company I work for.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: bujvary@usa.net                                   30-Aug-99 21:38:13
  To: All                                               31-Aug-99 03:52:25
Subj: Importin PMMail messages

From: "Brian G. Ujvary" <bujvary@usa.net>

Has anyone successfully imported PMMail messages into Outlook Express?




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FASTNET(r) Internet for everyone! (1:109/42)

+----------------------------------------------------------------------------+

From: Spammers@Bite.Me                                  31-Aug-99 01:50:00
  To: All                                               31-Aug-99 05:26:03
Subj: Re: Apache 1.3.9 broke my REXX cgi

From: "Jaime A. Cruz, Jr." <Spammers@Bite.Me>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

The code is the same as it's always been... here it is:

  Say 'Content-type: text/html'
  Say ''
  Say '<HTML>'


On Tue, 31 Aug 1999 01:07:39 GMT, Darin McBride wrote:

>On Mon, 30 Aug 1999 23:00:18 GMT, Jaime A. Cruz, Jr. wrote:
>
>>
>>Okay, I'm getting frustrated here.  I don't know what happened, these things
>>worked with every other version of Apache 1.3 that I've tried.  Suddenly,
>>after upgrading to 1.3.9, whenever I try to access one of my many REXX CGI
>>scripts, my browser displays this cryptic message:
>>
>>Internal Server Error
>>
>>The server encountered an internal error or misconfiguration and was unable
>>to complete your request.
>>
>>Please contact the server administrator, spammers@bite.me and inform them of
>>the time the error occurred, and anything
>>you might have done that may have caused the error.
>>
>>More information about this error may be available in the server error log.
>>
>>
>>Apache/1.3.9 Server at Jaime Port 80
>>
>>When I check the error_log file, I find this:
>>[Mon Aug 30 18:50:54 1999] [error] [client 10.0.0.1] Premature end of script
>>headers: H:\VIRTUAL_HTML\CGI-BIN\TESTCGI.CMD
>>
>>This script has not changed in months.  Why is Apache 1.3.9 suddenly
throwing
>>up over this (and ALL) of my cgi scripts??  What changed??  Help!!
>
>Probably because the system more tightly checks the headers now?  Could you
>post the headers your script provides?  Or perhaps the portion of the code
>that produces the headers?
>
>[I switched away from REXX to Perl a while back on my server...]
>
>---
>Disclaimer: unless explicitly mentioned otherwise, I do not speak,
>nor have I ever spoken, for the company I work for.

Jaime A. Cruz, Jr.

o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o
o                                                 o
o  Visit the Nassau Wings Motorcycle Club at:     o
o  http://www.nassauwings.org/                    o
o  A Charter Member of the Motorcycle Web Ring!   o
o                                                 o
o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: cp850

wj8DBQE3yya3gvzYfxgMc34RArVrAKDifd/BKT5g7Uzxv1vH7zkvpdhjagCcDt43
I3YBQi+ZbYoCPUImZ/4MGaQ=
=5mwp
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nassau Wings Motorcycle Club (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    31-Aug-99 01:49:16
  To: All                                               31-Aug-99 05:26:03
Subj: Re: Can OS/2 users grow up and think like Linux users? 

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Ted Edwards (Ted_E@bc.sympatico.ca) wrote:

: >         Do you have WatchCat installed?  I have found that to help out in
: > the rare occasions of OS/2 distress...

: What is WatchCat please?

	Process killer. You can access it a number ways; keyboard or even 
a joystick that is hooked up to your soundcard (heck, you can even make a 
parallel port connection switch for it) in order to activate it.  Then it 
will give you a list of processes that you can terminate, or even do a 
shutdown of OS/2.
	Pretty much a must-have, IMO.  And unlike process killers for 
Windows 95/98 (ie. Norton Crashguard, McAfee's Nuts & Bolts), WatchCat 
(or for that matter Process Commander or CAD Commander) don't reduce 
system performance by 15-20%.  It's basically a utility running in the 
background.  Useful in case you get youself into trouble somehow, but not 
infallible (ie. SIQ).


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          31-Aug-99 01:46:29
  To: All                                               31-Aug-99 05:26:03
Subj: Re: Important News From Dan Porter of Innoval

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Mon, 30 Aug 1999 23:11:59, esther@bitranch.com (Esther Schindler) a 
crit dans un message:

> Buddy, you might like it if Innoval posted the source. 

Might? 

Let me make my position very clear. I would LOVE it if EVERY departing 
absconding software vendor posted the source on their abandoned products. 

The market for software is a two-way transaction, and is not just the 
initial act of the Sellers shipping shrinkwrapped boxes and collecting the 
money. 

Their trusting, paying Users have an investment in that software that 
should be honored, and I go so far as to believe the gummint should pass 
laws REQUIRING all software to have the source code posted with third 
parties and available for public review.


> But your quibble doesn't take into account that the company may have
> very good reasons to *not* do so?

Sure, possibly, in a specific case like this, though none has been offered 
by Innvoal and nobody close to the situation has suggested that a special 
condition exists.

But in the general case, we should turn the equation around and make it a 
De Rigueur Condition of doing business with us Trusting, Paying, Users that
we are not going to have our investments in Using their software dishonored
and/or destroyed.


> 
> Don't look gift horses in the mouth. 

And, why not?, I say. 

If you're going to have to ride that "gift" horse on a long journey, you're
a fool *not* looking it in the mouth, and in the leg, and in the strength 
of its withers and in the clarity of its eyes.

['Don't buy a pig in a poke' is another old phrase that comes to mind when 
we're asked by software vendors to "buy this box, and trust us that what's 
in it is good enough to be worth your money."]


> They could have said, "Screw you, we're cancelling all product support." 

As they had already done for PostRoad News, Net Extra, and Web Extra? I've 
got licenses here for all of those previously "declared useless" programs 
of theirs. 


> Instead, they gave the OS/2 community a gift.

And in some scenarios that have yet to be played out, including the Y2K 
mysteries of the future, those "gifts" might come back to bite a lot of 
people one more time. Going one step further into Open Source would at 
least give those who choose to begin depending heavily on their mail client
a fighting chance.



Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: osric@apk.net                                     30-Aug-99 22:30:20
  To: All                                               31-Aug-99 05:26:03
Subj: Re: Important News From Dan Porter of Innoval

From: Tarquelne <osric@apk.net>

>The perfect mailer hasn't been written yet, meaning there's still room for
>improvement. I believe that's the point Steven was trying to make.

Ok.

                                            Tarquelne
                                       <osric@apk.net>
        I know how God can make a rock so big He can't move it.
                                  ************************
Use the address above to reply - not the anti-spam "Reply-to" address
___________________________________________________________
"I may have said something about the NAACP being un-American
 or communist, but I meant no harm by it."--Alabama federal court nominee
Jefferson Sessions.                                                            
                                                                               
                                                                               
                                                                               
                                                                               
                                                                          


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: APK Net (1:109/42)

+----------------------------------------------------------------------------+

From: dpeterso@halcyon.com                              30-Aug-99 20:40:05
  To: All                                               31-Aug-99 11:04:19
Subj: Re: NFS & OS/2 Warp 4.0

From: Dennis Peterson <dpeterso@halcyon.com>

ftp://ftp.void.org/jnfs/

From the readme:
"This package contains a pure java implementation of the NFS server
protocol. It includes the NFS service, the Mountd service and the
Portmapper.  Everything needed to export file systems is provided."

And it works, too. Only thing lacking is the client but I have that for
Unix and OS/2 - what I was missing was nfsd for my crappy windows stuff
at work.

dp


Stephane Champneuf wrote:
> 
> Where can I get a NFS software that runs with OS/2 Warp 4.0 ?
> (NFS doesn't seem to be provided with this version)
> 
> Thanks
> 
> schampn@ibm.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: I'm not organized at all (1:109/42)

+----------------------------------------------------------------------------+

From: domi@kenavo.NOSPAM.fi                             30-Aug-99 22:06:27
  To: All                                               31-Aug-99 11:04:19
Subj: Re: NFS & OS/2 Warp 4.0

From: domi@kenavo.NOSPAM.fi (Dominique Pivard)

On Mon, 30 Aug 1999 16:10:42, Gilbert Saint-flour <gsf@ibm.net> wrote:
> 
> I think IBM no longer sells or supports the "old" NFS code; you have to
> get TCP/IP 4.1 to get the new one.

I don't think so. Look at the following URL:

ftp://service.boulder.ibm.com/ps/products/tcpip/fixes/nfslatest/

Included are files (both client and server) that are intended to be 
added to an existing NFS setup.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: Skree@stubble.jumpers                             30-Aug-99 23:59:22
  To: All                                               31-Aug-99 11:04:19
Subj: Re: Importin PMMail messages

From: Skree@stubble.jumpers

In <7qfbmh$cos$1@news1.fast.net>, on 08/30/99 
   at 09:38 PM, "Brian G. Ujvary" <bujvary@usa.net> said:

Q}Has anyone successfully imported PMMail messages into Outlook Express?

Why on earth would anyone want to????



-- 
-----------------------------------------------------------
Kenn Sunley
MR/2 ICE ver 1.60 reg'd
Date: 1999.08.30
Time: 23:59:44 - -0600

Warp 4
233Mhz PII
ATI Xpert@work
Gradd Rocks - thank you IBM
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                31-Aug-99 06:31:12
  To: All                                               31-Aug-99 11:04:19
Subj: Re: Important News From Dan Porter of Innoval

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <3Bd8PsIG3uxi-pn2-Skp0dxvNUMlT@octek>, domi@kenavo.NOSPAM.fi (Dominique
Pivard) writes:

>On Mon, 30 Aug 1999 02:07:23, baden@unixg.ubc.ca   (Baden Kudrenecky) 
>wrote:
>
>>   I am currently looking for a new mail program to replace
>> UltiMail, and I am testing PMMail, JStreet, and now Post Road,
>> and the only program that even comes close to my acceptability,
>> is JStreet, however, it's memory footprint is huge, and that may
>> preclude me from using it, and besides, I would like to actually
>> support native OS/2 software.
>
>Have you had a look at Nick Knight's MR2/ICE? He's still supporting 
>and enhancing his product (version 1.62 was just released).

   Well thanks initially to "hamei@pacbell.net"'s suggestion, I
am trying out MR/2, and I am very impressed, so I will probably
keep using it, and sent Nick some cash.  What especially
impressed me is that it worked well right from the box, and I
could easily configure different "from" and "return-to" fields,
which I need to so.  So far, I have not found any bugs, which
the other mailers all have.


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: Arnstein.Prytz@jcu.edu.au                         31-Aug-99 16:32:00
  To: All                                               31-Aug-99 11:04:19
Subj: Disk wipe

From: Arnstein Prytz <Arnstein.Prytz@jcu.edu.au>

Does anyone know of a program to clear the free space on a disk.
I know of several utilities that do a `safe delete' of files,
whereby zeros are written to replace the file contents before the
file is deleted.  I am after a utility that does the same zero
(or random, it doesn't matter which) writing to unallocated
areas of the disk so that snoops cannot poke their beady eyes
at information I have already deleted and don't want them to see.

TIA, Arnstein. 
------------------------------------------------------------------
Arnstein Prytz				 Arnstein.Prytz@jcu.edu.au
Department of Physics				ph:  61-7-47815183
James Cook University                    	fax: 61-7-47815880
Townsville, Queensland 4811, Australia
------------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Queensland (1:109/42)

+----------------------------------------------------------------------------+

From: baden@unixg.ubc.ca                                31-Aug-99 06:34:12
  To: All                                               31-Aug-99 11:04:19
Subj: Re: Warp Server and HPFS386

From: baden@unixg.ubc.ca   (Baden Kudrenecky)

In <41ZkE0rRdj2J-pn2-4z246NKJJP0z@localhost>, cfrank@rumms.uni-mannheim.de
(Carsten Frank) writes:

>On my small server I'm going to try out the hpfs386 filesystem. 
>After installing, if I would have trouble Can I deinstall it?

   Yes, as long as you don't enable security, you can just
change your CONFIG SYS lines back to enable HPFS.IFS:

IFS=D:\IBM386FS\HPFS386.IFS /A:* /AUTOCHECK:C
rem IFS=D:\OS2\HPFS.IFS /CACHE:2048 /CRECL:32 /AUTOCHECK:DEFC

>Would this be a performance improvement?

   I think so, but you need the spare RAM for the extra cache.


baden

baden@unixg.ubc.ca
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: engdahlm@NOSPAMse.ibm.com                         31-Aug-99 09:23:20
  To: All                                               31-Aug-99 11:04:19
Subj: Audible notification in Lotus Notes 4.5

From: Mikael Engdahl <engdahlm@NOSPAMse.ibm.com>

Does anyone know if it is possible to manually change the audible
notification (for new mail) in
Notes for OS/2? In the settings one can only turn it on/off, I was more
thinking of replacing it
with another sound...
If it is stored as a .wav file (or in some other format) somewhere this
should be no problem.

Any ideas?

Mikael

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Global Services, South, RTP, NC, US (1:109/42)

+----------------------------------------------------------------------------+

From: lamikr@cc.jyu.fi                                  31-Aug-99 10:28:02
  To: terryfry@toward.com                               31-Aug-99 11:04:19
Subj: Re: Emacs for OS/2?

To: Terry Fry <terryfry@toward.com>
From: lamikr <lamikr@cc.jyu.fi>

> I'd like to find something under OS/2, it doesn't have to be
> Emacs... it just needs to have C++ formatting/hilighting and
> HTML formating/hilighting

Hi,

You should really try out MED from the following site:
    www.utopia-planitia.de

Mika



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Jyvaskyla, Finland (1:109/42)

+----------------------------------------------------------------------------+

From: falko.tesch@bigfoot.com                           31-Aug-99 07:20:03
  To: All                                               31-Aug-99 11:04:19
Subj: Q: How to start PMMail/2 2.0 ignoring its .INI Parameters?

From: Falko Tesch <falko.tesch@bigfoot.com>

Hi,

I have PMMail/2 2.0 up and running here. I use two accounts.
The default settings for those accounts are _not_ to fetch any mail 
when opened.
Now I need a script/parameter that will start PMMail/2, lets it 
automatically fetch email from the two accounts and will close the 
program once all emails are received.
Anyone has a REXX script or so???
Thanks for your help.

CU/2
Falko



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Star Division GmbH, Hamburg, Germany (1:109/42)

+----------------------------------------------------------------------------+

From: gstrazds@idirect.com                              31-Aug-99 04:37:07
  To: All                                               31-Aug-99 11:04:19
Subj: Re: Disk wipe

From: Glenn Strazds <gstrazds@idirect.com>

Try Wipefree.exe

one of the Gamma Tech utilities...  says it can do a DoD wipe

I use it ... Cleans up a previous install so the old contents do not
surface during a chkdsk C: /F:3

Sincerely Glenn Strazds


Arnstein Prytz wrote:

> Does anyone know of a program to clear the free space on a disk.
> I know of several utilities that do a `safe delete' of files,
> whereby zeros are written to replace the file contents before the
> file is deleted.  I am after a utility that does the same zero
> (or random, it doesn't matter which) writing to unallocated
> areas of the disk so that snoops cannot poke their beady eyes
> at information I have already deleted and don't want them to see.
>
> TIA, Arnstein.
> ------------------------------------------------------------------
> Arnstein Prytz                           Arnstein.Prytz@jcu.edu.au
> Department of Physics                           ph:  61-7-47815183
> James Cook University                           fax: 61-7-47815880
> Townsville, Queensland 4811, Australia
> ------------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://www.hololasertech.on.ca (1:109/42)

+----------------------------------------------------------------------------+

From: evzen@netbrno.cz                                  31-Aug-99 10:50:14
  To: All                                               31-Aug-99 11:04:19
Subj: Re: FTP Browser 1.71 bug?

From: "Evzen Polenka" <evzen@netbrno.cz>

"Buddy Donnelly" <donnelly@tampabay.rr.com> wrote:

> Does that FXP function transfer the files directly from one remote site to
> another without coming to your local machine?

Yes, of course, _that_ is FXP function.
The only drawback is that you have to stay connected to both sites all the
time the files are transferred (to be exact, till the last file starts
transferring), because the program sends commands like PORT, RETR, STOR...
to each of the sites.

    Bye, Evzen


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Cesnet (1:109/42)

+----------------------------------------------------------------------------+

From: sborsen"at"ibm.net                                31-Aug-99 10:32:00
  To: All                                               31-Aug-99 11:04:20
Subj: Re: Help! Runworkplace Winstartapp %1

From: sborsen"at"ibm.net (Steve)

On Thu, 26 Aug 1999 13:23:46, borsen@my-deja.com wrote:

> After 7 years of running Warp, I can't boot as the following error
> appears:
>
To all:

Thanks for the suggestions.  Doug Bissetts suggestion worked, although
I had to rebuild my desktop

Luck had it I had just copied my config.sys, but not my os2.ini, which
was the culprit.  So, two things learned here:

1. Use the PM backup utility.
2. Keep a good config.sys around.

I guess after 7 years, I really can't complain.... at least, not until
2007.

Cheers,

Steve


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: nospam_madbrain@thetaband.com                     31-Aug-99 03:44:11
  To: All                                               31-Aug-99 11:04:20
Subj: Theta Band Software releases WarpCharge payment software

From: nospam_madbrain@thetaband.com

Santa Clara, Calif. - Theta Band Software LLC released WarpCharge, a new
product that enables web sites to securely process credit card orders directly
over the Internet.

WarpCharge is the first credit card processing software available for the OS/2
platform.  WarpCharge provides the missing piece in your OS/2 e-commerce
solution : the payment system.

"Until now, merchants running secure web sites on IBM OS/2 Warp Server for
E-business had no means to process payments online. They could accept online
orders, but had to process the payment manually." said Julien Pierre,
President of Theta Band Software. "Shoppers like to get their purchase
immediately, and by processing credit card payments automatically and in
real-time, WarpCharge enables that sort of instant gratification."

WarpCharge is not just for e-commerce - it can be used for nearly all types of
businesses : whether you are taking credit card orders by mail, over the phone
or real-time over the Internet, WarpCharge is the perfect solution.

WarpCharge comes with sample CGI scripts for use on any secure OS/2 web
server, so that you can start taking Internet orders immediately.

WarpCharge also comes with an extensive REXX interface that lets developers
integrate credit card processing facility into any REXX-enabled OS/2
application, or into custom applications.

There are two editions of WarpCharge :

WarpCharge Business

WarpCharge Business is for any business that needs to process credit cards
over the phone, web, or in custom REXX applications. 

WarpCharge for Internet Service Providers

WarpCharge for ISPs lets Internet Service Providers offer credit card
processing capability to all their customers.

AVAILABILITY

WarpCharge is available for purchase from the Theta Band Software web site at
http://www.thetaband.com . WarpCharge Business requires a PC running IBM OS/2
Warp 4, OS/2 Warp Server or OS/2 Warp Server for E-Business. In addition,
WarpCharge for ISPs requires an OS/2 secure web server program.

ABOUT THETA BAND SOFTWARE LLC

Theta Band Software, headquartered in Santa Clara, California, was founded in
1997 and develops Internet and multimedia software products for IBM OS/2 Warp
that are marketed and sold on the world wide web.

-- 
--------------------------------------------------------------------
Julien Pierre               http://www.madbrain.com
Theta Band Software LLC     http://www.thetaband.com
--------------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     31-Aug-99 11:55:25
  To: All                                               31-Aug-99 11:04:20
Subj: Re: 4-digit year in 'dir' list??

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Tue, 31 Aug 1999 12:25:39 +0100, Martin Lafaix wrote:

->In article <geribeurzfyrlqvnycvcrkpbz.fhbajg0.pminews@news.dial.pipex.com>,
->"Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com> wrote:
->>Use DosFindFirst with FIL_QUERYEASIZE and you get FILEFINDBUF4 structs
->>back that tell you this information. The cbList field contains either 4
->>which means no EAs or a number that's twice the number of bytes of EAs
->>attached (don't ask why, I don't know but that is the way it works!).
->
->There must be another way to do this, but I don't know it.  The method
->you describe has one drawback : it fails to report the correct EA size
->if it exceeds 32767 bytes.  In fact, CMD.EXE's dir command is the only
->tool I know that returns the correct value.  Even the workplace shell
->fails (in the File page in the properties notebook) in this case.

I can't find a file with >32Kb of EAs to try it out on. The field in the
FILEFINDBUF4 is a ULONG so it should be OK. 


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            31-Aug-99 11:39:05
  To: All                                               31-Aug-99 14:56:01
Subj: Re: CAD recommendation

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On 30 Aug 1999 19:43:59 GMT, Will Rose <cwr@cts.com> wrote:
>gordon mcleod <gmcleod@idirect.com> wrote:
>: IBM Cad for OS2 was a very powerfull 2d cad system and IBMCad3x was a very
>: good light version  CadKey v7 for dos runs very well under OS2 as does
>: DataCad for Dos
>: A company in England bought Cad3x and I understand there is now a 4X but I
>: haven't any info on it and I don't think there is a web site for it
>: Acad 10, and 12 for Dos will also sun in OS2
>
>Cad 3X won't run at 1024x764 by > 256 colours - it's fine under that.
>I don't think it was ever patched or updated; I tried hard to get a
>working version for OS/2 a while back, since it's small and does all
>I want a CAD program to do.  Anyone knowing about an upgrade, please
>let me know too.


I still have it, too. Does what I want, except doesn't see long file
names, and is a bit clunky at times. But for US$ 99 it wasn't bad. (I
think I wrote a longer review somewhere.) The whole thing felt like a
16bit OS/2 recompile of a DOS program (this is not bad in itself).

Regarding the updates -- I once received a flyer announcing a couple
really nice things updated (dynamic dimensioning being the one I loved
most), but a quick phone call destroyed that hope: For the time being,
only the DOS version was updated. That was a few years back.

Cheers,
             Stefan

-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: C.J.@btsoftware.com                               31-Aug-99 15:00:23
  To: All                                               31-Aug-99 14:56:01
Subj: UPDATED   MEMOPLUS

From: "C.J." <C.J.@btsoftware.com>

MEMOPLUS      UPDATED
****************		

Memo PLUS is everything your built-in Memo Pad is and a
whole lot more!

Add drawings, start from a template, even set an alarm for a
Memo! Once you try it, you won't ever go back!

Key Features:
  - Attach a drawing or alarm to any memo.
  - Start a note or a drawing from a template.
  - Multiple fonts for Palm OS2 users.
  - Edit the memo title independent of the note contents.


Check it out and download Memo Plus for a free trial period from:
	http://www.btsoftware.com/ppilot/memoplus.htm





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: C.J. (1:109/42)

+----------------------------------------------------------------------------+

From: anders@metallurgi.kth.se                          31-Aug-99 16:15:16
  To: All                                               31-Aug-99 14:56:02
Subj: Using OS/2 as a telephone

From: Anders Jakobsson <anders@metallurgi.kth.se>

I would like to use my Thinkpad 600 running OS/2 v4 FP11 as a telephone. I
have tried with Organizer (latest Smartsuite 1.1.1) but I cannot get it to
work. If anyone has been successfull please tell me how. My internal modem
works, I use it to call internet at home. Is there any other telephone apps
that should work?
THANKS!!
Anders


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Theoretical Metallurgy (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           31-Aug-99 14:53:26
  To: All                                               31-Aug-99 14:56:02
Subj: Re: Importin PMMail messages

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Tue, 31 Aug 1999 05:59:44, Skree@stubble.jumpers wrote:

> In <7qfbmh$cos$1@news1.fast.net>, on 08/30/99 
>    at 09:38 PM, "Brian G. Ujvary" <bujvary@usa.net> said:
> 
> Q}Has anyone successfully imported PMMail messages into Outlook Express?
> 
> Why on earth would anyone want to????
> 

They have a copy of an E-Mail message with an Outlook
Virus and they want to execute it ???????

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: htravis@ibm.net                                   31-Aug-99 11:13:08
  To: All                                               31-Aug-99 14:56:02
Subj: Re: Looking for flow chart program.

From: htravis@ibm.net (Harry Travis)

In <37C711C2.81D0344D@ruhr-uni-bochum.de>, on 08/28/99 
   at 12:31 AM, Christian Hennecke
<christian.hennecke@ruhr-uni-bochum.de> said:

>Dave Critelli schrieb:
>> 
>> Hello:
>> 
>> I'm looking for an application to generate flow charts.  Suggestions
>> please.

>Have a look at StarOffice 5.1! I think it's the StarImpress part. A
>friend of mine once showed me how he made flow charts and it seemed
>very easy to do.

>Christian Hennecke

AllClear (Clear) for Win31, from SPSS.com. You write the script or
outline, it generates the flowchart from the punctuation and/or
indentation. Look for used copies.Started as dos version, which wouldnt,
of course, show script and graph at same time. -- 
-----------------------------------------------------------
htravis@ibm.net (Harry Travis)
DemostiX
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: richard@NOSPAMwebtrek.com                         31-Aug-99 15:25:20
  To: All                                               31-Aug-99 14:56:02
Subj: Re: Important News From Dan Porter of Innoval

From: richard@NOSPAMwebtrek.com (Richard R. Klemmer)

On Mon, 30 Aug 1999 23:29:16, esther@bitranch.com (Esther Schindler) 
wrote:

> Products have intelligence? You mean, someone perfected artificial 
> intelligence and *didn't tell me*?!

Absolutely.  I use that every time I fool my Boss into believing I 
actually know what I'm talking about.  :-)

-----------------------------
Richard R. Klemmer
richard@webtrek.com
http://www.webtrek.com
-----------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: WebTrek L.L.C. (1:109/42)

+----------------------------------------------------------------------------+

From: jklewis@nospam.com                                31-Aug-99 10:55:26
  To: All                                               31-Aug-99 14:56:02
Subj: Re: 4-digit year in 'dir' list??

From: Jim Lewis <jklewis@nospam.com>

Trevor Hemsley wrote:

> On Mon, 30 Aug 1999 16:24:56 -0500, Jim Lewis wrote:
>
> -> This util, named "jdir", shows all files in the directory even hidden and 
system
> ->ones. It does not have any parms, except for "-h" which is a crude help
message. I
> ->do not yet show the size of the EAs because I do not know how to do that
without
> ->opening the file (I think it will take too long to open each file just to
list a
> ->dir. The internal dir command must "cheat" somehow). I might add an option 
to do
> ->this in a later version.
>
> Use DosFindFirst with FIL_QUERYEASIZE and you get FILEFINDBUF4 structs
> back that tell you this information. The cbList field contains either 4
> which means no EAs or a number that's twice the number of bytes of EAs
> attached (don't ask why, I don't know but that is the way it works!).
>
> Trevor Hemsley, London, UK
> (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)

 Thanks Trevor, that works just fine. I'm currently running jdir in
conjunction with my
file finder to see if I have any files with EAs > 32K. I doubt I can fix that
problem
even if I do see it.

 I need to do a bit more testing and then I'll send the people who requested a 
copy
another one. As soon as we are sure the really stupid bugs are gone I'll put
it on my
web page. I need you guys to check stuff like:

jdir c:
jdir c:tmp
jdir c:\tmp d:\tmp2 e:\doesnotexist

and stuff like that. It's amazing to me that the dir command can do what it
does.

--

Jim Lewis
Not speaking for IBM.
Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Network Computing Division (1:109/42)

+----------------------------------------------------------------------------+

From: bvermo@powertech.no                               31-Aug-99 18:30:05
  To: All                                               31-Aug-99 16:34:24
Subj: Re: METAFILE CONVERTION

From: bv <bvermo@powertech.no>

Marek Wojciechowski wrote:

>
> OK but what about "OS/2 metafile" <-> "Win metafile" conversion.
> Does anybody know such a tool ?
>

An OS/2 metafile can contain almost anything, from a printer spool job
including downloadable fonts to a single OS/2 bitmap. It should be possible to
convert a Windows metafile, which is a much more limited creature, to an OS/2
metafile. The opposite is only possible in special cases.

You could get the Windows metafile into an OS/2 metafile format simply by
printing it under WinOS/2 and intercepting the spoolfile. The spoolfile is an
OS/2 metafile, but it is probably not in a format your application will be
able
to handle.

I think the best way is to convert them to a format like EPS, and exchange
that. This should work for some types of metafiles.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Norbionics (1:109/42)

+----------------------------------------------------------------------------+

From: aludwig@ErzETT.uni-potsdam.de                     31-Aug-99 18:35:03
  To: All                                               31-Aug-99 16:34:24
Subj: Re: Using OS/2 as a telephone

From: "Andreas Ludwig" <aludwig@ErzETT.uni-potsdam.de>

On 31 Aug 1999 16:15:32 +0100, Anders Jakobsson wrote:

>I would like to use my Thinkpad 600 running OS/2 v4 FP11 as a telephone. I
have tried with Organizer (latest Smartsuite 1.1.1) but I cannot get it to
work. If anyone has been successfull please tell me how. My internal modem
works, I use it to call internet at home. Is there any other telephone apps
that should work?

I don't know about your modem chipset - but for simple telephony try
VoiceDial/2 its on hobbes as

vdial*.zip

with *=321 for current version (?)

regards

Andreas



--

Andreas Ludwig
from the beautiful town of POTSDAM (Germany)
using my good old PC and OS/2 WARP 4 !

(remove the BIG letters to reply)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UNI Potsdam (1:109/42)

+----------------------------------------------------------------------------+

From: jklewis@nospam.com                                31-Aug-99 12:38:27
  To: All                                               31-Aug-99 16:34:24
Subj: Can't type in DOS box after 50 days

From: Jim Lewis <jklewis@nospam.com>

 Has anyone seen this problem? After about 50 days uptime my DOS
Windowed sessions do not allow any keys to be typed. The Num Lock and
Caps Lock lights don't even come on. This only happens in the DOS
Window, the rest of the machine is fine including DOS Full Screen
sessions. It doesn't matter if I open new DOS Windows or how I open
them. A reboot of course "fixes" this problem for another 50 days.

 This is happening on my IBM box at work and my no-name clone at home.
No fixpacks on either machine. It's annoying to have to reboot just for
this problem.

--

Jim Lewis
Not speaking for IBM.
Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Network Computing Division (1:109/42)

+----------------------------------------------------------------------------+

From: mek@compuserve.com                                31-Aug-99 12:55:23
  To: All                                               31-Aug-99 16:34:24
Subj: Print to graphic [was Re: METAFILE CONVERTION]

From: Mat Kramer <mek@compuserve.com>

A more general question: is there a printer driver that will allow
output to be saved as a file and then imported into Word 97 as a
graphic?  Word will import HPGL -- which driver should I use for that?

bv wrote:
> You could get the Windows metafile into an OS/2 metafile format simply by
> printing it under WinOS/2 and intercepting the spoolfile. The spoolfile is
an
> OS/2 metafile, but it is probably not in a format your application will be
able
> to handle.
> 
> I think the best way is to convert them to a format like EPS, and exchange
> that. This should work for some types of metafiles.

-- 
Mat Kramer [MekTek] mek@compuserve.com
VyperHelp: http://ourworld.compuserve.com/homepages/mek/vyper.htm

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MekTek (1:109/42)

+----------------------------------------------------------------------------+

From: jbrock@panix.com                                  31-Aug-99 14:21:25
  To: All                                               31-Aug-99 16:34:24
Subj: Re: Disk wipe

From: jbrock@panix.com (John Brock)

I wrote a little Rexx program which repeatedly writes a block of random
data to a single file until the disk runs out of space, then erases the
file.

This isn't a particularly sophisticated approach, and I'm kind of
curious how effective it is.  I understand it doesn't deal with the DoD
requirement of overwriting multiple times (unless you run the program
multiple times), but aside from that, can I be sure I am overwriting
*all* unallocated space when I do this?  Or is there some place where
recoverable data might "hide"?

In article <arnstein_prytzn1v831gf.fsf@jcu.edu.au>,
Arnstein Prytz  <Arnstein.Prytz@jcu.edu.au> wrote:
>Does anyone know of a program to clear the free space on a disk.
>I know of several utilities that do a `safe delete' of files,
>whereby zeros are written to replace the file contents before the
>file is deleted.  I am after a utility that does the same zero
>(or random, it doesn't matter which) writing to unallocated
>areas of the disk so that snoops cannot poke their beady eyes
>at information I have already deleted and don't want them to see.
-- 
John Brock
jbrock@panix.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Panix (1:109/42)

+----------------------------------------------------------------------------+

From: cheeser@home.com                                  31-Aug-99 18:45:01
  To: All                                               31-Aug-99 16:34:25
Subj: Re: Star Office 5.1 install

From: cheeser <cheeser@home.com>

Me too !

Michael Warsheski wrote:

> I downloaded SO51 for OS/2.  When I try to install it on a Warp 4
> machine it gives me this error message " Could not unpack file
> 'setup.zip' Program aborted. 1001"
>
> I used RAR.EXE to verify the executables contents and it reported a
> problem with the setup.pdf file.  The rest of the contents are OK.  The
> RAR program does not display a file called setup.zip within the
> executable.
>
> Any help would be appreciated.
>
> Regards,
>
> Mike Warsheski

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: weismer@erols.com                                 31-Aug-99 15:08:03
  To: All                                               31-Aug-99 16:34:25
Subj: Re: Important News From Dan Porter of Innoval

From: Murray Weismer <weismer@erols.com>

Nicely said. And I loved the BeeGees part. (G)






Buddy Donnelly wrote:
> 
> On Mon, 30 Aug 1999 15:08:43, esther@bitranch.com (Esther Schindler) a
> crit dans un message:
> 
> snippercized
> >
> > I still think it's a class act. It makes the product available to
> > those who want to use it.
> 
> Oh, I'll stop a moment and quibble on that point, thanks. (Hot out, ain't
> it?)
> 
> Well, it would have been classier ..........






-- 
___________________________________________________________
Home of DreckBak OS/2 Disk Backup Utility Suite
http://weismer.virtualave.net/DreckBak.html
_____PLEASE DO BACKUP YOUR DISKS_________________________
IBM BESTTeam - Team OS/2	
RPS.BBS  Phila. Pa (215)624-8960 Adult, Bible, and OS2 related
Hot_Asian_Food: http://www.geocities.com/Tokyo/Towers/9001
Fix your Plumbing: http://reedps.virtualave.net
MEMBER of P.A.C.S. OS/2-JAVA S.I.G.: http://www.phillyos2.org
------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RPS, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: weismer@erols.com                                 31-Aug-99 15:11:02
  To: esther@bitranch.com                               31-Aug-99 16:34:25
Subj: Re: Important News From Dan Porter of Innoval

To: Esther Schindler <esther@bitranch.com>
From: Murray Weismer <weismer@erols.com>

As OS2 users, I guess we should be gracious to all who will throw us a
bone????



Esther Schindler wrote:
> Don't look gift horses in the mouth. They could have said, "Screw you,
> we're cancelling all product support." Instead, they gave the OS/2
> community a gift.
> 
> --Esther

-- 
___________________________________________________________
Home of DreckBak OS/2 Disk Backup Utility Suite
http://weismer.virtualave.net/DreckBak.html
_____PLEASE DO BACKUP YOUR DISKS_________________________
IBM BESTTeam - Team OS/2	
RPS.BBS  Phila. Pa (215)624-8960 Adult, Bible, and OS2 related
Hot_Asian_Food: http://www.geocities.com/Tokyo/Towers/9001
Fix your Plumbing: http://reedps.virtualave.net
MEMBER of P.A.C.S. OS/2-JAVA S.I.G.: http://www.phillyos2.org
------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RPS, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       31-Aug-99 12:49:25
  To: All                                               31-Aug-99 20:08:13
Subj: Linked images in Worpro (SS 1.1)

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

Hi all,


Anybody have a problem with updating links with linked images in 
Wordpro (smartsuite rel 1.1)?

Although I have checked the linked file box when I imported
an image into a frame, whenever i go to update
links there are no links available!!

Whenever I reload the document, the images are refreshed, however
I keep altering the images as this is really a document in
progress, and it's really annoying to have to exit
then restart the doc to update them!

Any advice or comments welcome!!


Cheers
Chris





-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             30-Aug-99 20:42:01
  To: All                                               31-Aug-99 20:08:13
Subj: Re: 4-digit year in 'dir' list??

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Mon, 30 Aug 1999 16:24:56 -0500, Jim Lewis wrote:

> I
>do not yet show the size of the EAs because I do not know how to do that
without
>opening the file (I think it will take too long to open each file just to
list a
>dir. The internal dir command must "cheat" somehow). I might add an option to 
do
>this in a later version.

Jim; REXXLIB from Quercus Systems is an add on .DLL written, for OS/2
in two versions; One to interface with their own Personal Rexx and one
to interface with OS/2's native RexxSAA. It contains a function,
DOSEASIZE that will return the EA size of file. It's blindingly fast at
returning the requested EA sizes so I don't believe it's opening each
file to get the info. And REXXLIB is quite good about sticking to
published APIs whenever possible so I'd imagine there's a way to do it
withOUT opening the files. You could use REXXLIB to do it but the
drawback is, of course, each user would need to have REXXLIB.DLL
installed on their system. The upside is that I believe Quercus has
released REXXLIB for free use but I don't believe the license allows
open distribution without a fee. You can check on it at
http://www.quercus-sys.com (I _think_ that's the URL; I can't locate it
right now to be sure)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                31-Aug-99 13:10:03
  To: All                                               31-Aug-99 20:08:13
Subj: Re: Q: How to start PMMail/2 2.0 ignoring its .INI Parameters?

From: John M Price PhD <jmprice@calweb.com>

In comp.os.os2.mail-news article <19990831.7200764@ft-4015.stardiv.de> Falko
Tesch <falko.tesch@bigfoot.com> wrote:
: Hi,

: I have PMMail/2 2.0 up and running here. I use two accounts.
: The default settings for those accounts are _not_ to fetch any mail 
: when opened.
: Now I need a script/parameter that will start PMMail/2, lets it 
: automatically fetch email from the two accounts and will close the 
: program once all emails are received.
: Anyone has a REXX script or so???
: Thanks for your help.

Gee.  Does this need to be run from a chron?

I open the program, hit Alt-F2, close the program when it's done, unless
there is mail I need to deal with immediately - which does happen.

Not a lot of work.

-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

Honest folk do not wear masks when they enter a bank.
          - Unspiek, Baron Bodissey

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: rgriech@swol.de                                   31-Aug-99 21:49:21
  To: All                                               31-Aug-99 20:08:13
Subj: Re: Can't type in DOS box after 50 days

From: rgriech@swol.de (Hardy Griech)

On Tue, 31 Aug 1999 12:38:54 -0500, Jim Lewis <jklewis@nospam.com> wrote:
>  Has anyone seen this problem? After about 50 days uptime my DOS
> Windowed sessions do not allow any keys to be typed. The Num Lock and
> Caps Lock lights don't even come on. This only happens in the DOS
> Window, the rest of the machine is fine including DOS Full Screen
> sessions. It doesn't matter if I open new DOS Windows or how I open
> them. A reboot of course "fixes" this problem for another 50 days.
:

Perhaps there is an 32bit millisecond counter involved
(1000*3600*24*50=4.32e09 > 2**32).  AFAIR there is also a problem with
Win95 which is said to crash after 49(?) days uptime.  To be honest
this seems to be more a theoretical matter, because no one has ever
seen a Win95 box with that uptime...

Hardy

-- 
VSoup Homepage:                       http://home.pages.de/~vsoup/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: rgriech@swol.de                                   31-Aug-99 21:52:18
  To: All                                               31-Aug-99 20:08:13
Subj: Re: Emacs for OS/2?

From: rgriech@swol.de (Hardy Griech)

On Tue, 31 Aug 1999 10:28:04 +0100, lamikr <lamikr@cc.jyu.fi> wrote:
> > I'd like to find something under OS/2, it doesn't have to be
> > Emacs... it just needs to have C++ formatting/hilighting and
> > HTML formating/hilighting
> 
> Hi,
> 
> You should really try out MED from the following site:
>     www.utopia-planitia.de

Anyway there is an Emacs port to OS/2 by Eberhard Mattes which can be
found on the popular OS/2 ftp sites (ftp://hobbes.nmsu.edu/,
ftp://ftp.leo.org/)

Hardy

-- 
VSoup Homepage:                       http://home.pages.de/~vsoup/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             30-Aug-99 21:25:21
  To: All                                               31-Aug-99 20:08:13
Subj: Re: CAD recommendation

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Mon, 30 Aug 1999 11:52:30 -0400 (EDT), gordon mcleod wrote:

>Acad 10, and 12 for Dos will also sun in OS2

Also ACAD 12 for Win runs in OS/2. There was a big deal about getting
this to work in WinOS2 when it came out. I believe some people claim to
have managed to get ACAD 13 (which is Win only) to run in OS/2 but I
won't sware to that. The problem with the Win versions was, even when
you could get them to work in OS/2, none of the add-ons would work. So
no RenderMan or any of that is available to OS/2.

But to step back even further, AutoDesk used to make a version of ACAD
specifically for OS/2. R10 or something like that. It was written for
OS/2 v.1.2/3 but it might still work in current OS/2 -- if you could
find a copy of it.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             30-Aug-99 20:45:16
  To: All                                               31-Aug-99 20:08:13
Subj: Re: 4-digit year in 'dir' list??

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On 30 Aug 1999 08:31:52 GMT, Stefan A. Deutscher wrote:

>What I'd love to see are options like -c, -m, -a for creation,
>modification, access times, and also the flexibility to accept both the
>DOS/2ish / as well as the UNIXish - as option lead in. (I use UNIX shell
>ports most of the time in my OS/2 windows).

You might want to check 4OS2, a CMD.EXE replacement. It's does all of
the above and more - MUCH more!


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             30-Aug-99 21:13:06
  To: All                                               31-Aug-99 20:08:13
Subj: Re: CAD recommendation

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Mon, 30 Aug 1999 07:34:17 -0400, Dave Critelli wrote:

>I own BlueCAD.  It's a good package.  However I won't make it my production
CAD
>package (current Generic CAD for DOS) because BlueCAD's technical support (at
>best) _stinks_.  They take forever to respond to your e-mails (sometimes
months)
>when they decide to do so.  It's unfortunate because I think BlueCAD has the
>makings of a very good program if it were only supported and marketed
properly.

Might be that the support would be better with their REAL cad package.
(PJ/2 CAD, or something like that) Blue cad is their 'Lite' version of
the product and has only 2-D capabilities. Their full blown CAD product
supports 3-D wire frames and rendering plus a host of other features.
It's a real contender for AutoCAD - and costs like it too!

My personal favorite was (and still is) DesignCAD by American Small
Business Computers. I have both the 2-D and a 3-D DOS versions of it.
Unfortunately, ASBC sold out to VIA-Grafix -- which is really a
training seminar and video tape company. Why they wanted to get into
the CAD business I'll never know. Anyway, VG imediately proceded to
move DesignCAD to Win95 and dropped the DOS versions. I still run the
DOS versions but there's no video driver support for anything newer
than the old Trident 8900c and SVGA 1.0 so I can only run them in
640x480x16 color VGA mode now. 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: d.s.darrow@nvinet.com                             30-Aug-99 20:47:06
  To: All                                               31-Aug-99 20:08:13
Subj: Re: 4-digit year in 'dir' list??

From: "Doug Darrow" <d.s.darrow@nvinet.com>

On Mon, 30 Aug 1999 21:27:45 GMT, jpedone_no_spam@flash.net wrote:

>Ahhh - but sadly you have not gone far enough.  You need to
>add the -k option as well.  This one says - I'm not moving so get me ???
>from the kitchen :-)
>
Might '???' be the kitchen sink?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Jan.Danielsson@falun.mail.telia.com               31-Aug-99 20:37:23
  To: All                                               31-Aug-99 20:08:13
Subj: lynx and wget

From: "Jan Danielsson" <Jan.Danielsson@falun.mail.telia.com>

Hello!

I decided that sometimes it takes too long time to fire up Netscape when I
want to download a small file, so I installed Lynx.

Apart from it crashing all the time (Netscape never crashes), I have managed
to set it up so it can get the job done. However, I would like to be able to
download in the background. The lynx.cfg file contains something called
'EXTERNAL', and it uses something called wget. I downloaded wget.

But wget is never started. Is the 'EXTERNAL' keyword unsupported in the OS/2
version? (I'm using Lynx 2.8).

How do I get it to use the EXTERNAL feature?


 /j



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telia Internet (1:109/42)

+----------------------------------------------------------------------------+

From: letoured@sover.net                                31-Aug-99 15:24:14
  To: All                                               31-Aug-99 21:19:21
Subj: Re: Print to graphic [was Re: METAFILE CONVERTION]

From: letoured@sover.net

>A more general question: is there a printer driver that will allow output
>to be saved as a file and then imported into Word 97 as a graphic?  Word
>will import HPGL -- which driver should I use for that?

Setting up a plotter driver (like the HP7550) and printing to file would
probably work. I suspect that word will still not give you what you want,
because the HPGL file is going to be a vector graphic and Microsoft has
never quite figured out what that means. 



>bv wrote:
>> You could get the Windows metafile into an OS/2 metafile format simply by
>> printing it under WinOS/2 and intercepting the spoolfile. The spoolfile is
an
>> OS/2 metafile, but it is probably not in a format your application will be
able
>> to handle.
>> 
>> I think the best way is to convert them to a format like EPS, and exchange
>> that. This should work for some types of metafiles.


_____________
Ed Letourneau <letoured@sover.net>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dpeterso@halcyon.com                              31-Aug-99 14:02:05
  To: All                                               31-Aug-99 21:19:21
Subj: Re: lynx and wget

From: Dennis Peterson <dpeterso@halcyon.com>

Just run wget without lynx. It will copy the URL to your HD. It even
supports reget.

dp

Jan Danielsson wrote:
> 
> Hello!
> 
> I decided that sometimes it takes too long time to fire up Netscape when I
> want to download a small file, so I installed Lynx.
> 
> Apart from it crashing all the time (Netscape never crashes), I have managed
> to set it up so it can get the job done. However, I would like to be able to
> download in the background. The lynx.cfg file contains something called
> 'EXTERNAL', and it uses something called wget. I downloaded wget.
> 
> But wget is never started. Is the 'EXTERNAL' keyword unsupported in the OS/2
> version? (I'm using Lynx 2.8).
> 
> How do I get it to use the EXTERNAL feature?
> 
>  /j

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: I'm not organized at all (1:109/42)

+----------------------------------------------------------------------------+

From: jklewis@nospam.com                                31-Aug-99 16:21:19
  To: All                                               31-Aug-99 21:19:21
Subj: Re: 4-digit year in 'dir' list??

From: Jim Lewis <jklewis@nospam.com>

  I couldn't find anything wrong with my latest version of "jdir" so I have
put it on my
web page (see sig line). As I mentioned earlier Trevor's solution to the EA
problem seems
to have worked just fine.

 I appreciate all of the responses I have gotten so far. I will probably add
most, if not
all, of the requested features at a later time. I want to see how many people
are going to
really use it first.

 As for giving out my source code, I'm not really interested in doing that. I
enjoy
sharing my little apps with the OS/2 community, but giving out the source is
another
matter. I'm probably not interested in selling it either, unless you have a
lot of money
you want to spend.

 Sorry about the munged return address, but spam sucks. Replies should go here 
or to
jklewis at austin.ibm.com.

--

Jim Lewis
Not speaking for IBM.
Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Network Computing Division (1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  31-Aug-99 17:40:26
  To: All                                               31-Aug-99 21:19:21
Subj: Where to buy Academic Smart Suite????

From: mchasson@ibm.net

My daughter is giving up skiing for the year and starting grad school.  I
am giving her one of my old boxes and I went looking for the Lotus OS2
stuff at IB in the Academic pricing page without success.  Are these apps
no longer available for purchase at a price mere mortals can afford???

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               31-Aug-99 21:53:02
  To: All                                               31-Aug-99 21:19:21
Subj: Re: Important News From Dan Porter of Innoval

From: esther@bitranch.com (Esther Schindler)

On Tue, 31 Aug 1999 19:11:04, Murray Weismer <weismer@erols.com> 
wrote:
| As OS2 users, I guess we should be gracious to all who will throw us a
| bone????

As human beings, I think we should do our best to be gracious to 
everybody.

Murray, perhaps you've been lucky enough to succeed at everything you 
tried. Perhaps, if you failed at your goals, it was only your own life
that was affected. Some of us aren't this lucky.

At one time, my husband and I owned a computer store and consulting 
business, on an island off the coast of Maine. After several years, we
made the (ultimately wise) decision to pack up and move to Arizona. It
was a good decision for us, but we knew that our leaving town would 
affect the hundreds of customers to whom we'd sold hardware, software,
and services. While many of them essentially didn't care (we did a 
good job, and few of them needed our help), some of them were apt to 
be upset. So we did what we could to make the transition easier for 
them; we contacted our "good guy" competition and introduced him to 
the customers who were likely to be upset. That gave them the 
reassurance that there was someone "recommendable" in the area whom 
they could call.

I could have walked off and abandoned those people completely. I 
didn't do that. I could have come up with a scheme that would have 
cost me money. I didn't do that either. I treated my customers in the 
best way I could afford to do so, enabling them to keep their 
businesses running with the equipment I'd sold them.

The OS/2 community has had experience with one ISV, SPG, who actively 
abandoned the community, after making implied promises of a new 
product. Other OS/2 ISVs have quietly stopped updating their 
applications, and turned their attention to more remunerative 
platforms. Want a copy of Skyscraper? Lantastic for OS/2? the IBM OS/2
Funpak? Sorry, you're out of luck. Dan Porter had the guts to tell 
people what the company was doing, and why, even if the news wasn't 
what you wanted to hear. And he make the current versions available 
for free, with no strings attached.

Although I loved ColorWorks, I'd never again review an SPG product. 
I'd have no problem writing about an application from Innoval. They 
treated their users as well as they could, which is more than one can 
say for a majority of vendors.

--Esther

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: rsstan@ibm.net                                    31-Aug-99 18:23:17
  To: All                                               01-Sep-99 10:43:22
Subj: Re: Star Office 5.1 install

From: "Bob Stan" <rsstan@ibm.net>

On Tue, 31 Aug 1999 18:45:02 GMT, cheeser wrote:

>Me too !
>
>Michael Warsheski wrote:
>
>> I downloaded SO51 for OS/2.  When I try to install it on a Warp 4
>> machine it gives me this error message " Could not unpack file
>> 'setup.zip' Program aborted. 1001"
>>
>> I used RAR.EXE to verify the executables contents and it reported a
>> problem with the setup.pdf file.  The rest of the contents are OK.  The
>> RAR program does not display a file called setup.zip within the
>> executable.
>>
>> Any help would be appreciated.
>>
>> Regards,
>>
>> Mike Warsheski
I installed it fine with no errors. :-)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                31-Aug-99 15:58:15
  To: All                                               01-Sep-99 10:43:23
Subj: Re: Where to buy Academic Smart Suite????

From: John M Price PhD <jmprice@calweb.com>

Try the university's bookstore.


In comp.os.os2.apps article <37cc4c4f$2$zpunffba$mr2ice@news3.ibm.net>
mchasson@ibm.net wrote:
: My daughter is giving up skiing for the year and starting grad school.  I
: am giving her one of my old boxes and I went looking for the Lotus OS2
: stuff at IB in the Academic pricing page without success.  Are these apps
: no longer available for purchase at a price mere mortals can afford???

: -- 
: ----------------------------------------------------
: ------
: Monroe Chasson
: mchasson@ibm.net
: -----------------------------------------------------------
: MR2ICE reg#51 



-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

A birth superstition:
	Monday's child is fair of face,
	Tuesday's child is full of grace,
	Wednesday's child is sorry and sad,
	Thursday's child is merry and glad,
	Friday's child is loving and giving,
	And Saturday's child must work for a living,
	But the child that is born on the Sabbath Day
	Is bonny and merry and glad and gay.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: jmprice@calweb.com                                31-Aug-99 15:57:20
  To: All                                               01-Sep-99 10:43:23
Subj: Re: 4-digit year in 'dir' list??

From: John M Price PhD <jmprice@calweb.com>

In comp.os.os2.apps article <37CC4761.A947C1A1@nospam.com> Jim Lewis
<jklewis@nospam.com> wrote:
:   I couldn't find anything wrong with my latest version of "jdir" so I have
put it on my
: web page (see sig line). As I mentioned earlier Trevor's solution to the EA
problem seems
: to have worked just fine.

I get update dates that are earlier than the creation dates.  Limited
sample, of course, so it may be related to copying from the old drive, and
so forth.

E.G. :
                               created            update
PRAISE                    65  11/25/1996 10:12p  05/28/1995 11:25a   A
0

PROP.TXT                2501  11/25/1996 10:12p  01/11/1996  3:26p   A
0
prop2.txt               2446  03/05/1998 10:05a  01/11/1996  5:04p   A
0


-- 
John M. Price, PhD                                     jmprice@calweb.com
Life: Chemistry, but with feeling!      |      PGP Key on request or FTP!
  Email responses to my Usenet articles will be posted at my discretion. 
Comoderator: sci.psychology.psychotherapy.moderated          Atheist# 683
                     Syndicate Section III - Number 1

The only possible interpretation of any research whatever in the
`social sciences' is: some do, some don't.
                -- Ernest Rutherford

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: his very own desk! (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          31-Aug-99 23:00:14
  To: All                                               01-Sep-99 10:43:23
Subj: Re: Star Office 5.1 install

From: donnelly@tampabay.rr.com (Buddy Donnelly)

Just heard on the news that Sun is buying Star Division and giving Star 
Office away for free. You got to love it.


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: ekadakal@aol.com                                  31-Aug-99 23:33:00
  To: All                                               01-Sep-99 10:43:23
Subj: -<ERROR>- unable to open transport

From: ekadakal@aol.com (EKadakal)

Hi Everyone:

I get the follwing error (in tracing) when I try to access an Oracle database
from a Warp 4 client machine. Any idea?

-<ERROR>- soc -1 error - operation=3,
ntresnt[0]=530,ntresnt[1]=-3,ntresnt[2]=0
-<ERROR>- nsres: id=0, op=65, ns=12560, ns2=0; nt[0]=530, nt[1]=-3, nt[2]=0
-<ERROR>- unable to open transport

Thanks

Ercan


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AOL http://www.aol.com (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    31-Aug-99 18:45:01
  To: All                                               01-Sep-99 10:43:23
Subj: Star Office and SUN (More Info)

From: dcasey@ibm.net (Dan Casey)

This is a repost from Warpcast (for all of you out there who don't
subscribe to Warpcast).

Just to throw in my own $.02 worth, there was a series of stories the
past few days on the National Network newscasts (TV, not Web) about
the purchase of Stardivision by Sun. All of the stories had the slant
of "Anti-Microsoft". Specifically, of Sun going after Microsoft by
releasing the Star Office Suite for free, in direct competition with
Microsoft Office. As Timur stated in his post, the press still has not
mentioned OS/2, but the native OS/2 version of Staroffice is available
from Sun, and eventually so will the source code (apparantley).

From what I hear, the next version released by Sun will be Star Portal
(sometime in December of 1999) that will be 100% JAVA (written to
Sun's specification) and 100% compatible with OS/2's JAVA.

Timur is right .... this is a Significant announcement.

***********************************************************
Source: (Timur_Tabi@Dell.com)
***********************************************************

 First off, I want to impress on people the significance of
 this announcement.  StarOffice 5.1 for OS/2 is available for
 free (like it always was), but now the source code will be
 similarly available.  This means that Star Office will never
 suffer the fate of some other OS/2 products like DeScribe
 and Lotus SmartSuite.  With the source code available, OS/2
 programmers can fix bugs and add features as they see fit.
 This is a great day for OS/2.

Now for some real news.  To download the Sun version of Star
Office (it's probably the same as the Star Division
version), go to
http://www.sun.com/products/staroffice/get.html.  You can
also order a CD for $16 that contains all English or all
German versions (yes, including OS/2).  The press seems to
be ignoring the OS/2 version, but Sun isn't.

The source code is apparently not yet available.  I
personally am very interested to see what tools they use to
compile it. It's quite possible that the OS/2 version is
built on a different OS.

One thing that some people are missing is that the source
code will (most likely?) be released under the Sun Community
Source License, which is a far cry from the GPL. For an
overview of the SCSL, see
http://www.sun.com/software/communitysource/faq.html.
Basically, there are some severe restrictions on the
distribution (even internally) of modified source code.

--
Timur Tabi
Desktop BIOS Development
Dell Computer

**************************************************************

--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: Britton.W.Robbins@usa.xerox.com                   31-Aug-99 09:59:22
  To: All                                               01-Sep-99 10:43:23
Subj: Sun Microsystems purchase of StarDivision

From: Britton Robbins <Britton.W.Robbins@usa.xerox.com>

All,

Has anybody heard what the impact will be on future OS/2 versions of
StarOffice???

Britton Robbins
Field Engineer
Xerox Corporation

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: WCSIS (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    31-Aug-99 19:13:22
  To: All                                               01-Sep-99 10:43:23
Subj: DB2 (Personal Developers Edition) for FREE!

From: dcasey@ibm.net (Dan Casey)

Just got this in e-mail and thought I'd disseminate it here:

*************************************************************

Hi

I thought you all might be interested in the following:-

DOWNLOAD: Complimentary Copy of DB2 Universal
Database Version 6.1 Personal Developer's Edition

 http://www6.software.ibm.com/dl/db2pde/db2pde-p/

  Download a complimentary copy of DB2* Universal
  Database 6.1 Personal Developer's Edition for
  Windows NT**/95**/98**, OS/2*, or Linux, and start
  building robust, scalable tools and applications
  for DB2 Universal Database Personal Edition.
  Downloads are available in many spoken languages.

Eighth Annual International DB2 Users Group
European Conference, 18-21 October in Nice, France

 http://www.idug.org/

  The 8th Annual International DB2 Users Group
  (IDUG) European Conference, 18-21 October in Nice,
  France, focuses on data management knowledge. More
  than 70 technical sessions include DB2 Universal
  Database on all platforms, DBA challenges,
  application design, ERP, business intelligence,
  and heterogeneous networking. IBM will offer DB2
  UDB certification tests at no charge at the event.

InfoWorld: "IBM's DB2 Powers Up PDAs"

 http://www.infoworld.com/cgi-bin/displayTC.pl?/reviews/990823db2.htm
  (uppercase required as shown)

  InfoWorld says "Thanks to its small footprint --
  about 100KB -- and its integration with Mobile
  Connect*, DB2 Everywhere* makes possible database
  applications that extend the reach of your
  database server to the road or the warehouse".

SunWorld: "IBM Takes Lead in Database Competition"
with Leading-Edge Development Capabilities

 http://www.sunworld.com/swol-08-1999/swol-08-regex.html#2

  Sun Microsystems' SunWorld says "IBM is managing
  DB2 as a model for standards-based technology. IBM
  is the leader in turning the RDBMS business into a
  commodity market, one that it can legitimately
  dominate". Also: "July's 6.1 release of DB2 does
  plenty to make programmers' lives easier".


The full newsletter can be viewed at
http://www.ibm.com/software/news-alert/

Regards
Joao Paulo

ECI (UK)
UK Liason Officer

**************************************************************

--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: Spammers@Bite.Me                                  01-Sep-99 00:24:06
  To: All                                               01-Sep-99 10:43:24
Subj: Apache 1.3.9 and cgi scripts

From: "Jaime A. Cruz, Jr." <Spammers@Bite.Me>

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

I did some experimentation and discovered the problem was related to using
Object REXX as my default environment.  When I use SWITCHRX to switch to
Classic REXX, my cgi scripts work fine.  I relayed this information to Brian
Havard and this was his response:

  Some CGI security was tightened in this version. It appears that Object
Rexx
  requires the DPATH environment variable to exist but it's no longer
included
  in a CGI's environment by default (it used to include everything which is
  considered insecure). To make it work just add

  PassEnv DPATH

  to your httpd.conf

I just thought I'd pass this information along.
Jaime A. Cruz, Jr.

o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o
o                                                 o
o  Visit the Nassau Wings Motorcycle Club at:     o
o  http://www.nassauwings.org/                    o
o  A Charter Member of the Motorcycle Web Ring!   o
o                                                 o
o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o_o&o



-----BEGIN PGP SIGNATURE-----
Version: PGPfreeware 5.0 OS/2 for non-commercial use
Comment: PGP 5.0 for OS/2
Charset: cp850

wj8DBQE3zGQZgvzYfxgMc34RAjX0AJ9dwU2LFi+iapA8pJL7rVC8dSeIKwCg/x68
5sW7RlW8aCUteg67Ux4N/Y8=
=fItV
-----END PGP SIGNATURE-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nassau Wings Motorcycle Club (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         01-Sep-99 00:25:04
  To: All                                               01-Sep-99 10:43:24
Subj: Re: Wav to CD Audio

From: racette@cablevision.qc.ca (Martin Racette)

On Mon, 30 Aug 1999 20:35:08, Kris 
Kadela <kris@dgraph.com> wrote:

> 
> 
> Martin Racette wrote:
> > 
> > On Mon, 30 Aug 1999 18:37:01, "Hal
> > Murray" <hjmurray@home.com> wrote:
> > 
> > >  > > > Is it possible to copy some .WAV and  > > > write them on a CD-R
in Audio format  > > > i.e.: that can be read by a standard CD  > > > play in
a car or home by using RSJ 2.83  > > > ? > >  > > Just drag the Wav-files into 
CDView and burn. > >  > > Yours etc. > >   Torsten Balle Koefoed > >  > >
(Replace servername in address with: writeme<dot>com) >  > I tried it but it
won't work here the  > error message I get :The easiest I have found is to use 
CD View. By the looks of the error
> > > message you have 'attached' the writer drive before selecting your
> > > files to copy.Open CD View of your regular CD and you will see the audio 
files.
> > > Then open CD View of your writer drive. Drag the audio files to the
> > > writer drive and hit the record button. When done close the session.If
you have WAVs on you hard drive open CD View of your hard drive
> > > and go to the directory where you have the WAV files. Drag the files
> > > you want to the window of your CD View writer drive and drag them
> > > over to it and hit record.My regular old CD drive can not read audio
data tracks well, they
> > > 'skip' so I use my CD writer to copy audio tracks to my hard drive.
> > > this creats WAV files. Then using CD View I drag them back to the CD
> > > writer drive.Hal Murray Calgary, AB
> > 
> > What you do, I already now how to do it,
> > but what I want to do is to copy some
> > WAV files that I already got and were
> > not created with CDVIEW i.e.: copy a WAV
> > file into an Audio CD
> > 
> > //-------------------------
> > Thank you in advance
> > 
> > Merci a l'avance
> > 
> > Martin
> > 
> > http://205.237.57.73/
> 
> -- 
> 
> The WAVs have to be in a very specific format, 16bit PCM, 44.1(or
> sometnionh like that) kHz.
> Check them first.
> 
> 
> 
> **********************
> DigiGraph Technical
> http://www.dgraph.com
> **********************

Thank you for that information

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rsstan@ibm.net                                    31-Aug-99 20:30:19
  To: All                                               01-Sep-99 10:43:24
Subj: Re: Star Office 5.1 install

From: "Bob Stan" <rsstan@ibm.net>

On Tue, 31 Aug 1999 23:00:28 GMT, Buddy Donnelly wrote:

>Just heard on the news that Sun is buying Star Division and giving Star 
>Office away for free. You got to love it.
>
Just went to www.stardivision.com and found the site now pointed to Sun.  For
about $16 including shipping you can get a CD with SO for all platforms
included.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: hjmurray@home.com                                 01-Sep-99 00:36:20
  To: All                                               01-Sep-99 10:43:24
Subj: Re: Wav to CD Audio

From: "Hal Murray" <hjmurray@home.com>

> The WAVs have to be in a very specific format, 16bit PCM, 44.1(or
> sometnionh like that) kHz.
> Check them first.
> 
> 

Once you get them on the HD check them out by playing them in a WAV
file player.

Hal Murray
Calgary, AB

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: wsonna@ibm.net                                    01-Sep-99 00:45:00
  To: All                                               01-Sep-99 10:43:24
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: wsonna@ibm.net (William Sonna)

On Wed, 1 Sep 1999 00:13:45, dcasey@ibm.net (Dan Casey) wrote:

> Just got this in e-mail and thought I'd disseminate it here:
> 
> *************************************************************
> 
> Hi
> 
> I thought you all might be interested in the following:-
> 
> DOWNLOAD: Complimentary Copy of DB2 Universal
> Database Version 6.1 Personal Developer's Edition
> 
>  http://www6.software.ibm.com/dl/db2pde/db2pde-p/
> 
>   Download a complimentary copy of DB2* Universal
>   Database 6.1 Personal Developer's Edition for
>   Windows NT**/95**/98**, OS/2*, or Linux, and start
>   building robust, scalable tools and applications
>   for DB2 Universal Database Personal Edition.
>   Downloads are available in many spoken languages.
> 
> Eighth Annual International DB2 Users Group
> European Conference, 18-21 October in Nice, France
> 
>  http://www.idug.org/
> 
>   The 8th Annual International DB2 Users Group
>   (IDUG) European Conference, 18-21 October in Nice,
>   France, focuses on data management knowledge. More
>   than 70 technical sessions include DB2 Universal
>   Database on all platforms, DBA challenges,
>   application design, ERP, business intelligence,
>   and heterogeneous networking. IBM will offer DB2
>   UDB certification tests at no charge at the event.
> 
> InfoWorld: "IBM's DB2 Powers Up PDAs"
> 
>  http://www.infoworld.com/cgi-bin/displayTC.pl?/reviews/990823db2.htm
>   (uppercase required as shown)
> 
>   InfoWorld says "Thanks to its small footprint --
>   about 100KB -- and its integration with Mobile
>   Connect*, DB2 Everywhere* makes possible database
>   applications that extend the reach of your
>   database server to the road or the warehouse".
> 
> SunWorld: "IBM Takes Lead in Database Competition"
> with Leading-Edge Development Capabilities
> 
>  http://www.sunworld.com/swol-08-1999/swol-08-regex.html#2
> 
>   Sun Microsystems' SunWorld says "IBM is managing
>   DB2 as a model for standards-based technology. IBM
>   is the leader in turning the RDBMS business into a
>   commodity market, one that it can legitimately
>   dominate". Also: "July's 6.1 release of DB2 does
>   plenty to make programmers' lives easier".
> 
> 
> The full newsletter can be viewed at
> http://www.ibm.com/software/news-alert/
> 
> Regards
> Joao Paulo
> 
> ECI (UK)
> UK Liason Officer
> 
> **************************************************************
> 
> --
> **************************************************************
> *  Dan Casey                                                 *
> *  President                                                 *
> *  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
> *  http://www.os2voice.org                                   *
> *  Abraxas on IRC                                            *
> *  http://members.iquest.net/~dcasey                         *
> *  Charter Associate member, Team SETI                       *
> *  Warpstock 99 in Atlanta  http://www.warpstock.org         *
> **************************************************************
> *  E-Mail (subject: Req. PGP Key) for Public Key             *
> **************************************************************

Great News.  Now if I only had a browser that could actually download 
the 30-40 megabyte files without locking up or crashing.

Oh well, I can dream, can' I?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jpedone_no_spam@flash.net                         01-Sep-99 00:52:24
  To: All                                               01-Sep-99 10:43:24
Subj: Re: 4-digit year in 'dir' list??

From: jpedone_no_spam@flash.net

In <37CC4761.A947C1A1@nospam.com>, Jim Lewis <jklewis@nospam.com>
writes:  
>I couldn't find anything wrong with my latest version of "jdir"
>so I have put it on my web page (see sig line).  As I mentioned earlier
>Trevor's solution to the EA problem seems to have worked just fine.

I just downloaded it and took it for a spin drive.  I couldn't find any 
problems except the columns get skewed with *real* long file names. 
Nice work - thanks.

 
J. Pedone
jpedone@flash.net
http://www.flash.net/~jpedone
 
You're throwing it all out the Windows!
But I forgot all about the Amnesia Conference!!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: jpedone_no_spam@flash.net                         01-Sep-99 00:52:24
  To: All                                               01-Sep-99 10:43:24
Subj: Swap file

From: jpedone_no_spam@flash.net

Hi all - hopefully someone here can give me some advice....

  I recently picked up a memory monitor program written by Jim Lewis and 
was just playing with it (Good prog BTW) and noticed that my swap was 
getting around 70MB when staroffice and NS were running.  Under normal
load the machine seems to maintain about a 32MB swap and this program is
indicated between 524K and 1MB free ram.  I initially had the swap set
for 20MB but have since changed it to 61865K to keep it from growing.
  Now granted, these two programs are memory hogs but does a swap of
around 70MB seem excessive?  What are the performance ramifications of 
this large of a swap?


 
J. Pedone
jpedone@flash.net
http://www.flash.net/~jpedone
 
Windows: The Gates of hell.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: alexylee@geocities.com                            01-Sep-99 02:30:28
  To: All                                               01-Sep-99 10:43:24
Subj: Re: Sun Microsystems purchase of StarDivision

From: "alexylee@geocities.com" <alexylee@geocities.com>


Britton Robbins gDG

> All,
>
> Has anybody heard what the impact will be on future OS/2 versions of
> StarOffice???
>
> Britton Robbins
> Field Engineer
> Xerox Corporation



--
 No, I only heard that there will be a Java vision.

{Quick hand}

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SEEDNet News Service (1:109/42)

+----------------------------------------------------------------------------+

From: htravis@ibm.net                                   31-Aug-99 22:50:22
  To: All                                               01-Sep-99 14:27:05
Subj: Re: Star Office and SUN (More Info)

From: htravis@ibm.net (Harry Travis)

In <+jGz3kDg6xvV090yn@ibm.net>, on 08/31/99 
   at 06:45 PM, dcasey@ibm.net (Dan Casey) said:

>This is a repost from Warpcast (for all of you out there who don't
>subscribe to Warpcast).

>Just to throw in my own $.02 worth, there was a series of stories the
>past few days on the National Network newscasts (TV, not Web) about the
>purchase of Stardivision by Sun. All of the stories had the slant of
>"Anti-Microsoft". Specifically, of Sun going after Microsoft by
>releasing the Star Office Suite for free, in direct competition with
>Microsoft Office. As Timur stated in his post, the press still has not
>mentioned OS/2, but the native OS/2 version of Staroffice is available
>from Sun, and eventually so will the source code (apparantley).

>From what I hear, the next version released by Sun will be Star Portal
>(sometime in December of 1999) that will be 100% JAVA (written to Sun's
>specification) and 100% compatible with OS/2's JAVA.

>Timur is right .... this is a Significant announcement.

>*********************************************************** Source:
>(Timur_Tabi@Dell.com)
>***********************************************************

> First off, I want to impress on people the significance of
> this announcement.  StarOffice 5.1 for OS/2 is available for
> free (like it always was), but now the source code will be
> similarly available.  This means that Star Office will never
> suffer the fate of some other OS/2 products like DeScribe
> and Lotus SmartSuite.  With the source code available, OS/2
> programmers can fix bugs and add features as they see fit.
> This is a great day for OS/2.

>Now for some real news.  To download the Sun version of Star Office
>(it's probably the same as the Star Division
>version), go to
>http://www.sun.com/products/staroffice/get.html.  You can
>also order a CD for $16 that contains all English or all
>German versions (yes, including OS/2).  The press seems to be ignoring
>the OS/2 version, but Sun isn't.

>The source code is apparently not yet available.  I
>personally am very interested to see what tools they use to compile it.
>It's quite possible that the OS/2 version is
>built on a different OS.

>One thing that some people are missing is that the source
>code will (most likely?) be released under the Sun Community Source
>License, which is a far cry from the GPL. For an overview of the SCSL,
>see
>http://www.sun.com/software/communitysource/faq.html.
>Basically, there are some severe restrictions on the
>distribution (even internally) of modified source code.


Sometimes a mind experiment is worh doing. What if IBM/Lotus "fixed"
SmartSuite and gave it away, or nearly so, with a Mac, Unix and Linux
versions as well. On Y2K.  All cross compatible. 

But MS ports their Office as well. How many of you think you'll be able
to satisfy more than 5 contracs in 100 in 2002 with
documents/graphs/charts/tablessubmitted in a format other than MS's? 

I don't think so, either. The current DOJ MS browser case isn't the
right one. The one that mattered was the "free" bundled MS Office of the
early to mid '90s.

Sun bought Stardivision because it is good enough and cheap enough and
European market. At twice the price -- still pocket change in today's MA
world,-- there might not have been a deal.


- 
-----------------------------------------------------------
htravis@ibm.net (Harry Travis)
DemostiX
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: murdoctor@ausNOSPAMtin.rr.com                     01-Sep-99 03:38:18
  To: All                                               01-Sep-99 14:27:05
Subj: Re: Swap file

From: "Jeffrey S. Kobal" <murdoctor@ausNOSPAMtin.rr.com>

jpedone_no_spam@flash.net wrote:

>   Now granted, these two programs are memory hogs but does a swap of
> around 70MB seem excessive?  What are the performance ramifications of
> this large of a swap?

The only thing you'd be losing is the free space on your drive.
Setting the minimum swapfile to a large size has no performance
impact; what it does save you is the time it takes to "grow" and
"shrink" the swapfile.  It's a good idea to set the size to something
that will accomodate the "normal" working set of your usage of
the machine.

Of course, your best bet for performance would be a memory
upgrade.  It is also suggested that you put the swapfile on the
most-used partition of your least-used hard drive, to minimize
the seek-time required to read and write the swapfile.

Jeffrey S. Kobal
IBM Corporation


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: lesben@ptcom.net                                  01-Sep-99 00:02:00
  To: generous@phonesexings.com                         01-Sep-99 14:27:06
Subj: Re: EXTREMELY CHEAP erotic phone chat 18103

To: generous@phonesexings.com
From: Les Benn <lesben@ptcom.net>

nope don't want to talk. I would be interested in exchanging shoe laces or
crystallized
caterpillar hair.

heavens896@aol.com wrote:

> Want to talk with 100% FAKE horny girls?
>
> The women on the line are paid alot they are over 70 and in their prime.
> They call for free phone calls with guys like YOU - it's almost Free for
them!
>
> Only $1,000,000,000 per minute or less
>
> =====================>1-888-335-HOLD (toll-free)
>
> =====================>1-888-302-ORGE (toll-free) - phonebill billing
available here
>
> ----------------------------------------------------------------
>
> For gay talk call:1-888-800-MENS (toll-free)
>
> 8 and over only please!
>
> `zAd,"iFVW

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tech Group 2000 (1:109/42)

+----------------------------------------------------------------------------+

From: aboritz@cybernex.net                              31-Aug-99 22:14:23
  To: All                                               01-Sep-99 14:27:06
Subj: Re: Q: How to start PMMail/2 2.0 ignoring its .INI Parameters?

From: aboritz@cybernex.net (Alan Boritz)

In article <37cc369e@calwebnnrp>, John M Price PhD <jmprice@calweb.com> wrote:
>In comp.os.os2.mail-news article <19990831.7200764@ft-4015.stardiv.de> Falko
Tesch <falko.tesch@bigfoot.com> wrote:
>: Hi,
>
>: I have PMMail/2 2.0 up and running here. I use two accounts.
>: The default settings for those accounts are _not_ to fetch any mail
>: when opened.
>: Now I need a script/parameter that will start PMMail/2, lets it
>: automatically fetch email from the two accounts and will close the
>: program once all emails are received.
>: Anyone has a REXX script or so???
>: Thanks for your help.
>
>Gee.  Does this need to be run from a chron?
>
>I open the program, hit Alt-F2, close the program when it's done, unless
>there is mail I need to deal with immediately - which does happen.
>
>Not a lot of work.

Well, yes, it could be, if there's a lot of mail to pick up and you don't want
to pick it up just then.  I used to run Postroad Mailer that way with a
command line argument to pick up mail unattended for two accounts and then
exit to a batch file that ran the poll event.  When I changed to Pmmail, I
lost that ability, since there is no equivalent command line argument (one of
the few times that Southside answered tech support email).

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Dyslexics UNTIE (1:109/42)

+----------------------------------------------------------------------------+

From: moschleg@erols.com                                01-Sep-99 00:58:21
  To: All                                               01-Sep-99 17:47:18
Subj: Re: lynx and wget

From: Mark Schlegel <moschleg@erols.com>

He still needs lynx or some web browser to find out
what the URL is in the first place, then yes you are right,
he can use wget by itself.

mark

Dennis Peterson wrote:
> 
> Just run wget without lynx. It will copy the URL to your HD. It even
> supports reget.
> 
> dp
> 
> Jan Danielsson wrote:
> >
> > Hello!
> >
> > I decided that sometimes it takes too long time to fire up Netscape when I
> > want to download a small file, so I installed Lynx.
> >
> > Apart from it crashing all the time (Netscape never crashes), I have
managed
> > to set it up so it can get the job done. However, I would like to be able
to
> > download in the background. The lynx.cfg file contains something called
> > 'EXTERNAL', and it uses something called wget. I downloaded wget.
> >
> > But wget is never started. Is the 'EXTERNAL' keyword unsupported in the
OS/2
> > version? (I'm using Lynx 2.8).
> >
> > How do I get it to use the EXTERNAL feature?
> >
> >  /j

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          01-Sep-99 05:44:15
  To: All                                               01-Sep-99 17:47:18
Subj: Re: Swap file

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Wed, 1 Sep 1999 03:38:36, "Jeffrey S. Kobal" 
<murdoctor@ausNOSPAMtin.rr.com> a crit dans un message:

> 
> jpedone_no_spam@flash.net wrote:
> 
> >   Now granted, these two programs are memory hogs but does a swap of
> > around 70MB seem excessive?  What are the performance ramifications of
> > this large of a swap?
> 
> The only thing you'd be losing is the free space on your drive.
> Setting the minimum swapfile to a large size has no performance
> impact; what it does save you is the time it takes to "grow" and
> "shrink" the swapfile.  It's a good idea to set the size to something
> that will accomodate the "normal" working set of your usage of
> the machine.
> 
> Of course, your best bet for performance would be a memory
> upgrade.  It is also suggested that you put the swapfile on the
> most-used partition of your least-used hard drive, to minimize
> the seek-time required to read and write the swapfile.

I've got 128MB and it would be nice if running the new NS would quit 
driving my swapfile to 32MB and up, without it shrinking back upon closing 
NS.

Or am I the only one who's noticed this?

Or am I missing something earlier that I should be aware of?


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: rsteiner@visi.com                                 31-Aug-99 23:48:08
  To: All                                               01-Sep-99 17:47:18
Subj: Re: Star Office 5.1 install

From: rsteiner@visi.com (Richard Steiner)

Here in comp.os.os2.apps, "Bob Stan" <rsstan@ibm.net>
spake unto us, saying:

>Just went to www.stardivision.com and found the site now pointed to Sun.
>For about $16 including shipping you can get a CD with SO for all
>platforms included.

Yup.  I just got one.  :-)

-- 
   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
                 An expert is someone from out of town.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: rsteiner@visi.com                                 31-Aug-99 23:50:21
  To: All                                               01-Sep-99 17:47:18
Subj: Re: Where to buy Academic Smart Suite????

From: rsteiner@visi.com (Richard Steiner)

Here in comp.os.os2.apps, mchasson@ibm.net spake unto us, saying:

>My daughter is giving up skiing for the year and starting grad school.  I
>am giving her one of my old boxes and I went looking for the Lotus OS2
>stuff at IB in the Academic pricing page without success.  Are these apps
>no longer available for purchase at a price mere mortals can afford???

Out of curiosity: Would StarOffice be a suitable replacement?

-- 
   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
          Alimony: The screwing you get for the screwing you got

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: sachmo@horn.net                                   01-Sep-99 05:47:10
  To: All                                               01-Sep-99 17:47:18
Subj: Re: Disk wipe

From: sachmo@horn.net

> In article <arnstein_prytzn1v831gf.fsf@jcu.edu.au>,
> Arnstein Prytz  <Arnstein.Prytz@jcu.edu.au> wrote:
> >Does anyone know of a program to clear the free space on a disk.

> John Brock
> jbrock@panix.com

There's GammaTech Utilities (wipefree) [commercial] which does a 
decent job.
	http://www.gt-online

Gene
---------------
pequod@gate.net

The minstrel boy to the war is gone
In the ranks of death you'll find him;
One sword, at least, thy rights shall guard;
Words shall never sound in slavery!
            --Thomas Moore (1779-1852)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CyberGate, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: your.user.name@your.host.name                     01-Sep-99 06:01:28
  To: All                                               01-Sep-99 17:47:18
Subj: Re: Swap file

From: your.user.name@your.host.name ()

In article <c1.2b5.2S1rFm$08q@geocities.com>, jpedone_no_spam@flash.net wrote:
>Hi all - hopefully someone here can give me some advice....
>
>  I recently picked up a memory monitor program written by Jim Lewis and 
>was just playing with it (Good prog BTW) and noticed that my swap was 
>getting around 70MB when staroffice and NS were running.  Under normal
>load the machine seems to maintain about a 32MB swap and this program is
>indicated between 524K and 1MB free ram.  I initially had the swap set
>for 20MB but have since changed it to 61865K to keep it from growing.

I used to have essentially the same problem(s).  Put in 128mb of RAM.  I Set
the swapfile for 8mb.  Works great, and the swapfile rarely shows more than
50% 'occupancy'

>  Now granted, these two programs are memory hogs but does a swap of
>around 70MB seem excessive?  What are the performance ramifications of 
>this large of a swap?

When I had it get that big, things got really slo-o-o-w.

Wm. D. "Bill" Loughman
Berkeley, CA, USA
wdlkhl@ibm.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: your.user.name@your.host.name                     01-Sep-99 06:01:29
  To: All                                               01-Sep-99 17:47:18
Subj: Re: Any experience with "TAME"?

From: your.user.name@your.host.name ()

I use it to run an irreplacable 'legacy' DOS program, that OS/2 VDM can't
handle at all.  Works _very_ well, and is _very_ reliable.

WD "Bill" Loughman
Berkeley, CA, USA
wdlkhl@ibm.net

---------------------
In article <c1.2c.2Rps2m$064@bozo.pro-ns.net>, jspringf@xxxpro-ns.net wrote:
>In <37b54098.8507193@news-s01.ny.us.ibm.net>, jiclbch@ibm.net (Juan I. Cahis) 
writes:
>>Dear Friends:
>>
>>Does someone of you have any experience with "TAME"?
>>
>>It is a utility to enhance the multitasking capabilities of MsDos (and
>>Win-OS/2) VDM's, enhancing the overall performance of the system. You
>>can get it at Hobbes (TAME133.ZIP). It seems a very interesting
>>utility.
>>
>>Any hint?
>>
>>
>>Thanks
>>Juan I. Cahis
>
>Yes, I am using it to control a very difficult DOS comm program which
>must run all the time--either in the foreground or in the background.
>
>It is very good for this, because OS/2 can control the program OK, but
>it still eats up too many CPU cycles.  TAME cuts down on the CPU
>cycles a lot--so that pulse stays on the bottom.
>
>If you register TAME, you will get a very nice printed manual to
>go with it. 
>
>-----------------------------------------------------------
>Fred Springfield                       for e-mail remove 'xxx'
>Plymouth, MN
>-----------------------------------------------------------
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: Skree@stubble.jumpers                             01-Sep-99 00:25:10
  To: All                                               01-Sep-99 17:47:19
Subj: Re: Importin PMMail messages

From: Skree@stubble.jumpers

In <qpkdVVNoMoTk-pn2-w9Xt6zHy3b2P@userMd018.videon.wave.ca>, on 08/31/99 
   at 02:53 PM, lsunley@mb.sympatico.ca (Lorne Sunley) said:

Q}On Tue, 31 Aug 1999 05:59:44, Skree@stubble.jumpers wrote:

Q}> In <7qfbmh$cos$1@news1.fast.net>, on 08/30/99 
Q}>    at 09:38 PM, "Brian G. Ujvary" <bujvary@usa.net> said:
Q}> 
Q}> Q}Has anyone successfully imported PMMail messages into Outlook Express?
Q}> 
Q}> Why on earth would anyone want to????
Q}> 

Q}They have a copy of an E-Mail message with an Outlook
Q}Virus and they want to execute it ???????

Q}Lorne Sunley

Damn I hate it when big bro points out the obvious.


-- 
-----------------------------------------------------------
Kenn Sunley
MR/2 ICE ver 1.60 reg'd
Date: 1999.09.01
Time: 00:25:21 - -0600

Warp 4
233Mhz PII
ATI Xpert@work
Gradd Rocks - thank you IBM
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dtander@agts.net                                  01-Sep-99 06:30:28
  To: All                                               01-Sep-99 17:47:19
Subj: Re: Swap file

From: dtander@agts.net (David T. Anderson)

On Wed, 1 Sep 1999 05:44:30, donnelly@tampabay.rr.com (Buddy Donnelly)
wrote:
> 
> I've got 128MB and it would be nice if running the new NS would quit 
> driving my swapfile to 32MB and up, without it shrinking back upon closing 
> NS.
> 
> Or am I the only one who's noticed this?
> 
> Or am I missing something earlier that I should be aware of?

Hi Buddy -- When I ran 64 Megs of RAM, I had a lot of swapfile growth,
and frequently it never shrank back to it's default size(40 Megs).   
The main culprit seemed to be the use of Java apps...Java IRC from 
Alphaworks and Java ICQ, and the appearance of java applets within 
Netscape.

When I went to 128 Megs, this behavior stopped...my default swapfile 
size is 20 Megs and the unused portion seldom drops below 15 megs, and
this happens only after I do a LOT of websurfing and heavy graphics 
usage, usually at the same time.  The latest Netscape barely touches 
it at all under ordinary use.

I don't know why, but upping the RAM really made a difference for me 
vis-avis swapfile growth.

Warp 4, FP 11, latest Java.  Other details on request if you want 
them...

David T. Anderson
Calgary, Alberta
http://www.agt.net/public/dtander/

Using ProNews/2 for OS/2 Warp

**NOSPAM**  To email me, remove the 's' from my address...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: engs0011@sable.ox.ac.uk                           01-Sep-99 07:47:07
  To: All                                               01-Sep-99 17:47:19
Subj: RSJ CD writer from Hobbes

From: engs0011@sable.ox.ac.uk (Ian Johnston)

I have downloaded and installed the RSJ CD-writer from Hobbes and it 
seems to work just fine except...

1) I can find nothing to say what I have. Shareware? Demo? Time limited?
   There is no documentation at all.

2) I can no longer use my CD writer as a normal drive, unless a disk has
   been locked in it.

And comments or help much appreciated.

Ian

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Oxford University, England (1:109/42)

+----------------------------------------------------------------------------+

From: stefand@lcam.u-psud.fr                            01-Sep-99 08:18:05
  To: All                                               01-Sep-99 17:47:19
Subj: Re: 4-digit year in 'dir' list??

From: stefand@lcam.u-psud.fr (Stefan A. Deutscher)

On Mon, 30 Aug 1999 20:45:33 -0700 (PDT), Doug Darrow
<d.s.darrow@nvinet.com> wrote:
>On 30 Aug 1999 08:31:52 GMT, Stefan A. Deutscher wrote:
>>What I'd love to see are options like -c, -m, -a for creation,
>>modification, access times, and also the flexibility to accept both
>>the DOS/2ish / as well as the UNIXish - as option lead in. (I use UNIX
>>shell ports most of the time in my OS/2 windows).
>
>You might want to check 4OS2, a CMD.EXE replacement. It's does all of
>the above and more - MUCH more!

As do ports of UNIX utils like 'ls' and 'tcsh', but a util that works
with cmd.exe just like jdir.exe does is a neat addition -- until IBM
bless us with a built-in switch to their dir command. (Jim, could you
push for that?)

 Cheers,
            Stefan


-- 
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  sad@utk.edu 
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: evzen@netbrno.cz                                  01-Sep-99 10:52:16
  To: All                                               01-Sep-99 17:47:19
Subj: Re: RSJ CD writer from Hobbes

From: "Evzen Polenka" <evzen@netbrno.cz>

"Ian Johnston" <engs0011@sable.ox.ac.uk> wrote:

> And comments or help much appreciated.

Why not to look at their homepage at www.rsj.de?

    Bye, Evzen



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Cesnet (1:109/42)

+----------------------------------------------------------------------------+

From: pandpATibm.net                                    01-Sep-99 13:08:21
  To: All                                               01-Sep-99 17:47:19
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: "Philip Nelson" <pandpATibm.net>

If it fails use WGET with the -c option to restart the download.

This is what I did.

Phil Nelson
(pandp@ibm.net)

On 1 Sep 1999 00:45:00 GMT, William Sonna wrote:

>On Wed, 1 Sep 1999 00:13:45, dcasey@ibm.net (Dan Casey) wrote:
>
>> Just got this in e-mail and thought I'd disseminate it here:
>> 
>> *************************************************************
>> 
>> Hi
>> 
>> I thought you all might be interested in the following:-
>> 
>> DOWNLOAD: Complimentary Copy of DB2 Universal
>> Database Version 6.1 Personal Developer's Edition
>> 
>>  http://www6.software.ibm.com/dl/db2pde/db2pde-p/
>> 
>>   Download a complimentary copy of DB2* Universal
>>   Database 6.1 Personal Developer's Edition for
>>   Windows NT**/95**/98**, OS/2*, or Linux, and start
>>   building robust, scalable tools and applications
>>   for DB2 Universal Database Personal Edition.
>>   Downloads are available in many spoken languages.
>> 
>> Eighth Annual International DB2 Users Group
>> European Conference, 18-21 October in Nice, France
>> 
>>  http://www.idug.org/
>> 
>>   The 8th Annual International DB2 Users Group
>>   (IDUG) European Conference, 18-21 October in Nice,
>>   France, focuses on data management knowledge. More
>>   than 70 technical sessions include DB2 Universal
>>   Database on all platforms, DBA challenges,
>>   application design, ERP, business intelligence,
>>   and heterogeneous networking. IBM will offer DB2
>>   UDB certification tests at no charge at the event.
>> 
>> InfoWorld: "IBM's DB2 Powers Up PDAs"
>> 
>>  http://www.infoworld.com/cgi-bin/displayTC.pl?/reviews/990823db2.htm
>>   (uppercase required as shown)
>> 
>>   InfoWorld says "Thanks to its small footprint --
>>   about 100KB -- and its integration with Mobile
>>   Connect*, DB2 Everywhere* makes possible database
>>   applications that extend the reach of your
>>   database server to the road or the warehouse".
>> 
>> SunWorld: "IBM Takes Lead in Database Competition"
>> with Leading-Edge Development Capabilities
>> 
>>  http://www.sunworld.com/swol-08-1999/swol-08-regex.html#2
>> 
>>   Sun Microsystems' SunWorld says "IBM is managing
>>   DB2 as a model for standards-based technology. IBM
>>   is the leader in turning the RDBMS business into a
>>   commodity market, one that it can legitimately
>>   dominate". Also: "July's 6.1 release of DB2 does
>>   plenty to make programmers' lives easier".
>> 
>> 
>> The full newsletter can be viewed at
>> http://www.ibm.com/software/news-alert/
>> 
>> Regards
>> Joao Paulo
>> 
>> ECI (UK)
>> UK Liason Officer
>> 
>> **************************************************************
>> 
>> --
>> **************************************************************
>> *  Dan Casey                                                 *
>> *  President                                                 *
>> *  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
>> *  http://www.os2voice.org                                   *
>> *  Abraxas on IRC                                            *
>> *  http://members.iquest.net/~dcasey                         *
>> *  Charter Associate member, Team SETI                       *
>> *  Warpstock 99 in Atlanta  http://www.warpstock.org         *
>> **************************************************************
>> *  E-Mail (subject: Req. PGP Key) for Public Key             *
>> **************************************************************
>
>Great News.  Now if I only had a browser that could actually download 
>the 30-40 megabyte files without locking up or crashing.
>
>Oh well, I can dream, can' I?



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: tiemannj@gmx.de                                   01-Sep-99 13:31:02
  To: All                                               01-Sep-99 17:47:19
Subj: Re: Can't type in DOS box after 50 days

From: Joerg Tiemann <tiemannj@gmx.de>

On Tue, 31 Aug 1999 12:38:54 -0500, Jim Lewis <jklewis@nospam.com> wrote:
>  Has anyone seen this problem? After about 50 days uptime my DOS
> Windowed sessions do not allow any keys to be typed. The Num Lock and
> Caps Lock lights don't even come on. This only happens in the DOS
> Window, the rest of the machine is fine including DOS Full Screen
> sessions. It doesn't matter if I open new DOS Windows or how I open
> them. A reboot of course "fixes" this problem for another 50 days.

  I have OS/2 2.1 installed on an old 386sx notebook. Current uptime is
123 days, no problem with DOS windows here. As for OS/2 Warp - well, 
never tried that 'protectonly=no' thingy! ;-)

-- 
tiemannj@gmx.de

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Heinrich Heine Universitaet Duesseldorf (1:109/42)

+----------------------------------------------------------------------------+

From: bmoore@awod.com                                   01-Sep-99 15:37:22
  To: All                                               01-Sep-99 17:47:20
Subj: HPFS386 File System

From: "Bert Moore" <bmoore@awod.com>

Can anyone tell what site has file hpfs386.zip dated 6/11/99?
-- 
Bert Moore
bmoore@awod.com
To the boys of Kessler Hollow, keep the faith

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CompuServe Interactive Services (1:109/42)

+----------------------------------------------------------------------------+

From: brth@firstclass.net                               01-Sep-99 11:41:12
  To: All                                               01-Sep-99 17:47:20
Subj: Re: Important News From Dan Porter of Innoval

From: "Burt Hemingway" <brth@firstclass.net>

Esther Schindler <esther@bitranch.com> wrote in message
news:LoEFmgJJ9ecw-pn2-QNdFdp6yQsdx@agave.bitranch.com...

> Products have intelligence? You mean, someone perfected artificial
> intelligence and *didn't tell me*?!

X-----------------snip----------------------X

You are egoistic, isn't it?






--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Ameritech.Net www.ameritech.net  Complaints: abus
(1:109/42)

+----------------------------------------------------------------------------+

From: runkle@hfs.washington.edu                         01-Sep-99 09:42:16
  To: All                                               01-Sep-99 17:47:20
Subj: Re: Fixpack

From: "Dave Runkle" <runkle@hfs.washington.edu>

You *did* click on the product in the window, to select it, didn't you?
Dave

paul_belsack@my-deja.com wrote in message <7qdurs$k4l$1@nnrp1.deja.com>...
>Problem with IBM fixpack 40 for os/2 v 3
>[snip]
>The fixpack ends after I want to apply the first disk and I get a
>message
>CSF257 : No product has been selected
>
>And It seems that I am not able to start the csf?
>Does anyone have any suggestions?



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Washington (1:109/42)

+----------------------------------------------------------------------------+

From: milindr@bellsouth.net                             01-Sep-99 17:40:12
  To: All                                               01-Sep-99 17:47:20
Subj: Re: Important News From Dan Porter of Innoval

From: milindr@bellsouth.net (Milind Rao)

> Although I loved ColorWorks, I'd never again review an SPG product. 
> I'd have no problem writing about an application from Innoval. They 
> treated their users as well as they could, which is more than one can 
> say for a majority of vendors.

I'll second all of the above.  PRM was a good product.  Whatever it 
id, it did well.  I used it for many years before moving to PMMail 
last year.  Can't complain.  I certainly got my money's worth.  Can't 
say the same at all about SPG.

Regards
Milind

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           01-Sep-99 17:42:24
  To: All                                               01-Sep-99 17:47:20
Subj: Re: Swap file

From: doug.bissett"at"ibm.net (Doug Bissett)

On Wed, 1 Sep 1999 00:52:49, jpedone_no_spam@flash.net wrote:

> Hi all - hopefully someone here can give me some advice....
> 
>   I recently picked up a memory monitor program written by Jim Lewis and 
> was just playing with it (Good prog BTW) and noticed that my swap was 
> getting around 70MB when staroffice and NS were running.  Under normal
> load the machine seems to maintain about a 32MB swap and this program is
> indicated between 524K and 1MB free ram.  I initially had the swap set
> for 20MB but have since changed it to 61865K to keep it from growing.
>   Now granted, these two programs are memory hogs but does a swap of
> around 70MB seem excessive?  What are the performance ramifications of 
> this large of a swap?
> 
> 
>  
> J. Pedone
> jpedone@flash.net
> http://www.flash.net/~jpedone
>  
> Windows: The Gates of hell.
> 

Yes, Netscape, and StarOffice are real memory hogs (imagine the amount
of real memory you would need, if memory swapping didn't exist). 

I have 64 meg, of memory, and I use a 70 meg swap file. I started with
a 60 meg swap file, but found that it would grow sometimes (more often
than I liked). The 70 meg swap seems to handle almost everything. 

The performance ramifications are that if your swap file is too small,
you will use excessive time managing the growth, and shrinkage (if it 
will shrink). You are far better off to have a swap file that is too 
large, than to have one that is too small. 

The trick is to figure out an optimum size for your specific system. 
From what you have said (above), I would set the swap file to 70 meg. 
Of course, that would depend a lot on how much disk space you have.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           01-Sep-99 17:42:25
  To: All                                               01-Sep-99 17:47:20
Subj: Re: Swap file

From: doug.bissett"at"ibm.net (Doug Bissett)

On Wed, 1 Sep 1999 03:38:36, "Jeffrey S. Kobal" 
<murdoctor@ausNOSPAMtin.rr.com> wrote:

> It is also suggested that you put the swapfile on the
> most-used partition of your least-used hard drive,

This, of course, means PHYSICAL hard drive, It doesn't make much 
difference if all of your "logical" drives are on the same physical 
drive. It may help to put the swap file on a partition that is close 
to the middle of the physical drive.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: eric.brien@cgi.ca                                 01-Sep-99 13:46:25
  To: All                                               01-Sep-99 17:47:20
Subj: Backup Exec for OS2

From: "Brien, Eric" <eric.brien@cgi.ca>

Does anyone have a link where I can get a test/Full version of Backup
exec for OS2?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Gestion de =?iso-8859-1?Q?Syst=E8mes=20R=E9partis
(1:109/42)

+----------------------------------------------------------------------------+

From: sdenbes1@san.rr.com                               01-Sep-99 11:28:11
  To: All                                               01-Sep-99 19:58:09
Subj: Re: Important News From Dan Porter of Innoval

From: sdenbes1@san.rr.com (Steven C. Den Beste)

On Wed, 1 Sep 1999 11:41:25 -0400, Burt Hemingway recycled some holes into
the following pattern:

>
>Esther Schindler <esther@bitranch.com> wrote in message
>news:LoEFmgJJ9ecw-pn2-QNdFdp6yQsdx@agave.bitranch.com...
>
>> Products have intelligence? You mean, someone perfected artificial
>> intelligence and *didn't tell me*?!
>
>X-----------------snip----------------------X
>
>You are egoistic, isn't it?

Whoosh! RIGHT over your head.

Go turn up your "joke" detector sensitivity a few notches.

--------
Steven C. Den Beste    sdenbes1@san.rr.com
Home page: http://home.san.rr.com/denbeste

"We're just ordinary earthlings, not weirdos from another planet!"
              -- Calvin

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Time Warner Cable of San Diego, CA (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         01-Sep-99 18:57:18
  To: All                                               01-Sep-99 19:58:09
Subj: Re: RSJ CD writer from Hobbes

From: racette@cablevision.qc.ca (Martin Racette)

On Wed, 1 Sep 1999 07:47:15, 
engs0011@sable.ox.ac.uk (Ian Johnston) 
wrote:

> I have downloaded and installed the RSJ CD-writer from Hobbes and it 
> seems to work just fine except...
> 
> 1) I can find nothing to say what I have. Shareware? Demo? Time limited?
>    There is no documentation at all.
> 
The is a file in the CDWFS directory 
that has a .KEY extension look it up in 
a text editor, it will tell you when the
license expire

> 2) I can no longer use my CD writer as a normal drive, unless a disk has
>    been locked in it.
> 
That is normal, if you look when the 
system boot, the RSJ drivers change your
CD-R or CD-RW drive into a WORM 
(Write-once Read-Many) drive, and those 
drive must be lock in order to work, 
that is why you ust use the command 
ATTACH or CDATTACH


//-------------------------
Good Luck

Bonne Chance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jiclbch@ibm.net                                   01-Sep-99 15:03:03
  To: All                                               01-Sep-99 19:58:09
Subj: BOOTOS2 doesn't work for me!!!!! Help!!!!!

From: Juan I. Cahis <jiclbch@ibm.net>

Dear Friends:

I tried to generate a two diskette, bootable, minimum OS/2, using
BOOTOS2. The problem is that the product insists to include, in the
first diskette, a lot of drivers that are included in my main
CONFIG.SYS, that I don't need in an emergency diskette based OS/2.
Among them are my sound card drivers, PCMCIA drivers, etc. So, BOOTOS2
collapses when the first diskette becomes full.

What can I do?


Thanks
Juan I. Cahis
Santiago de Chile (South America)
Email: jiclbch@ibm.net.nospam jiclbch@reuna.cl.nospam
To send me Email, please remove ".nospam" from my Email address
Note: Please forgive me for my bad English, I am trying to improve it!

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: dink@dont.spam.me                                 01-Sep-99 14:56:19
  To: All                                               01-Sep-99 19:58:09
Subj: Re: RSJ CD writer from Hobbes

From: "dinkmeister" <dink@dont.spam.me>

On 1 Sep 1999 07:47:15 GMT, Ian Johnston wrote:

:2) I can no longer use my CD writer as a normal drive, unless a disk has
:   been locked in it.

REM out the lockcdr.flt line in your config.sys, then add /ALL to
the OS2ASPI.DMD driver, then you can use it as a normal drive
again & everything else will work fine.  


- dink ( http://dink.org )




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     01-Sep-99 20:14:06
  To: All                                               01-Sep-99 19:58:09
Subj: Re: Swap file

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Wed, 01 Sep 1999 00:52:49 GMT, jpedone_no_spam@flash.net wrote:

->  Now granted, these two programs are memory hogs but does a swap of
->around 70MB seem excessive?

Unanswerable question - you didn't asy how much RAM you have. On an 8MB
system a 70MB swapfile would not seem unreasonable given these two apps
;-) On a 1GB system, likewise but for the opposite reason (70Mb in 1024Mb
is tiny!).

 
Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    01-Sep-99 10:25:02
  To: All                                               01-Sep-99 21:47:10
Subj: Re: Important News From Dan Porter of Innoval

From: "seth berk" <snberk@ibm.net>

On 31 Aug 1999 21:53:05 GMT, Esther Schindler wrote:

>On Tue, 31 Aug 1999 19:11:04, Murray Weismer <weismer@erols.com> 
>wrote:
>| As OS2 users, I guess we should be gracious to all who will throw us a
>| bone????
>
>As human beings, I think we should do our best to be gracious to 
>everybody.

Hear Hear

[snip snip snip]





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    01-Sep-99 10:19:26
  To: All                                               01-Sep-99 21:47:10
Subj: Was: Star Office 5.1 install - Canadian Source?

From: "seth berk" <snberk@ibm.net>

Anyone in Canada want to sell me a copy of their StarOffice CD?  I
would love to save the shipping and handling costs.  (To our US
friends, Canada Customs will assess a 7% GST (a sales tax) on the $16
( a little over a dollar) and *then* add a $5.00 handling fee to
cover the cost of collecting the $1.12!!!! [smiley thing with the
tongue sticking out])

So... if any fellow citizen of the great white north wants to contact
me ... I'm in Vancouver, where we are having a terrific sale on
passenger ships from overseas, only used once!

seth
snberk@ibm.net 






On Tue, 31 Aug 1999 23:48:16 -0500, Richard Steiner wrote:

>Here in comp.os.os2.apps, "Bob Stan" <rsstan@ibm.net>
>spake unto us, saying:
>
>>Just went to www.stardivision.com and found the site now pointed to Sun.
>>For about $16 including shipping you can get a CD with SO for all
>>platforms included.
>
>Yup.  I just got one.  :-)
>
>-- 
>   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
>     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
>      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
>                 An expert is someone from out of town.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              01-Sep-99 12:58:19
  To: All                                               01-Sep-99 21:47:10
Subj: Re: Process Commander and DOS box.

From: "J. R. Fox" <jr_fox@earthlink.net>

Will Rose wrote:
> 
> I've been hunting down problems with Process Commander, and have found
> an odd one; the full-screen version seems to prevent a DOS box running
> more than once.  That is, you can start a windowed DOS session just fine,
> but if that window is closed and you try to re-open it you get an error
> message "Cannot run" or words to that effect.  I've been trying to find
> this problem's source for some time; at a guess it appeared with FP 22.
> However, I've confirmed its appearance and disappearance with Process
> Command 1.02 and FP 40.
> 
> Anyone seen anything similar?  I very much like Process Commander - it's
> not the essential that it used to be, but I still miss it a lot.
> 
> Will
> cwr@crash.cts.com

No, not that one, but PC's replacement of some key system files
can cause problems elsewhere, with things like UniMaint's Desk-
top Reset feature (replaces the WarpCenter with garbage, dtop
does not repopulate, may screw up you video; you just have to
try to shutdown and Reset).  There are some backup issues -- 
can't recall everything right now.  Anyway, these problems were
supposedly corrected for Object Desktop, fairly recently, but
AFAIK have not been addressed yet with PC.

Your msg. implies a later fixpack for PC, though.  I applied 
their first CSD quite some time ago, bringing the product up
to 1.01.  Is there in fact a later CSD ?

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: benbowc@tui.lincoln.ac.nz                         02-Sep-99 08:03:01
  To: All                                               01-Sep-99 21:47:10
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: Craig Benbow <benbowc@tui.lincoln.ac.nz>

This is a multi-part message in MIME format.
--------------5DDBDFA97043BEEBEC7FC601
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit

That would be fine but the damn thing is passworded to the ftp server!
I have had to bitch about this to support before but as usual no action.
You would think that if we are logged in to the devcon that we could be
trusted with an ftp password!

Craig

Philip Nelson wrote:

> If it fails use WGET with the -c option to restart the download.
>
> This is what I did.
>
> Phil Nelson
> (pandp@ibm.net)
>
> On 1 Sep 1999 00:45:00 GMT, William Sonna wrote:
>
> >On Wed, 1 Sep 1999 00:13:45, dcasey@ibm.net (Dan Casey) wrote:
> >
> >> Just got this in e-mail and thought I'd disseminate it here:
> >>
> >> *************************************************************
> >>
> >> Hi
> >>
> >> I thought you all might be interested in the following:-
> >>
> >> DOWNLOAD: Complimentary Copy of DB2 Universal
> >> Database Version 6.1 Personal Developer's Edition
> >>
> >>  http://www6.software.ibm.com/dl/db2pde/db2pde-p/
> >>
> >>   Download a complimentary copy of DB2* Universal
> >>   Database 6.1 Personal Developer's Edition for
> >>   Windows NT**/95**/98**, OS/2*, or Linux, and start
> >>   building robust, scalable tools and applications
> >>   for DB2 Universal Database Personal Edition.
> >>   Downloads are available in many spoken languages.
> >>
> >> Eighth Annual International DB2 Users Group
> >> European Conference, 18-21 October in Nice, France
> >>
> >>  http://www.idug.org/
> >>
> >>   The 8th Annual International DB2 Users Group
> >>   (IDUG) European Conference, 18-21 October in Nice,
> >>   France, focuses on data management knowledge. More
> >>   than 70 technical sessions include DB2 Universal
> >>   Database on all platforms, DBA challenges,
> >>   application design, ERP, business intelligence,
> >>   and heterogeneous networking. IBM will offer DB2
> >>   UDB certification tests at no charge at the event.
> >>
> >> InfoWorld: "IBM's DB2 Powers Up PDAs"
> >>
> >>  http://www.infoworld.com/cgi-bin/displayTC.pl?/reviews/990823db2.htm
> >>   (uppercase required as shown)
> >>
> >>   InfoWorld says "Thanks to its small footprint --
> >>   about 100KB -- and its integration with Mobile
> >>   Connect*, DB2 Everywhere* makes possible database
> >>   applications that extend the reach of your
> >>   database server to the road or the warehouse".
> >>
> >> SunWorld: "IBM Takes Lead in Database Competition"
> >> with Leading-Edge Development Capabilities
> >>
> >>  http://www.sunworld.com/swol-08-1999/swol-08-regex.html#2
> >>
> >>   Sun Microsystems' SunWorld says "IBM is managing
> >>   DB2 as a model for standards-based technology. IBM
> >>   is the leader in turning the RDBMS business into a
> >>   commodity market, one that it can legitimately
> >>   dominate". Also: "July's 6.1 release of DB2 does
> >>   plenty to make programmers' lives easier".
> >>
> >>
> >> The full newsletter can be viewed at
> >> http://www.ibm.com/software/news-alert/
> >>
> >> Regards
> >> Joao Paulo
> >>
> >> ECI (UK)
> >> UK Liason Officer
> >>
> >> **************************************************************
> >>
> >> --
> >> **************************************************************
> >> *  Dan Casey                                                 *
> >> *  President                                                 *
> >> *  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
> >> *  http://www.os2voice.org                                   *
> >> *  Abraxas on IRC                                            *
> >> *  http://members.iquest.net/~dcasey                         *
> >> *  Charter Associate member, Team SETI                       *
> >> *  Warpstock 99 in Atlanta  http://www.warpstock.org         *
> >> **************************************************************
> >> *  E-Mail (subject: Req. PGP Key) for Public Key             *
> >> **************************************************************
> >
> >Great News.  Now if I only had a browser that could actually download
> >the 30-40 megabyte files without locking up or crashing.
> >
> >Oh well, I can dream, can' I?

--------------5DDBDFA97043BEEBEC7FC601
Content-Type: text/x-vcard; charset=us-ascii;
 name="benbowc.vcf"
Content-Transfer-Encoding: 7bit
Content-Description: Card for Craig Benbow
Content-Disposition: attachment;
 filename="benbowc.vcf"

begin:vcard 
n:Benbow;Craig
tel;cell:64 21 625 287
tel;fax:64 3 325 3839
tel;home:64 3 324 4009
tel;work:64 3 325 2811 x8362
x-mozilla-html:FALSE
url:http://www.lincoln.ac.nz
org:Lincoln University;Management Systems Research Unit, Applied Management
and Computing
version:2.1
email;internet:benbowc@tui.lincoln.ac.nz
title:Mr
adr;quoted-printable:;;P.O. Box 84=0D=0ALincoln
University;;Canterbury;8021;New Zealand
x-mozilla-cpt:;28992
fn:Craig Benbow
end:vcard

--------------5DDBDFA97043BEEBEC7FC601--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Lincoln University (1:109/42)

+----------------------------------------------------------------------------+

From: jklewis@nospam.com                                01-Sep-99 14:59:25
  To: All                                               01-Sep-99 21:47:10
Subj: Re: 4-digit year in 'dir' list??

From: Jim Lewis <jklewis@nospam.com>

Stefan A. Deutscher wrote:

> On Mon, 30 Aug 1999 20:45:33 -0700 (PDT), Doug Darrow
> <d.s.darrow@nvinet.com> wrote:
> >On 30 Aug 1999 08:31:52 GMT, Stefan A. Deutscher wrote:
> >>What I'd love to see are options like -c, -m, -a for creation,
> >>modification, access times, and also the flexibility to accept both
> >>the DOS/2ish / as well as the UNIXish - as option lead in. (I use UNIX
> >>shell ports most of the time in my OS/2 windows).
> >
> >You might want to check 4OS2, a CMD.EXE replacement. It's does all of
> >the above and more - MUCH more!
>
> As do ports of UNIX utils like 'ls' and 'tcsh', but a util that works
> with cmd.exe just like jdir.exe does is a neat addition -- until IBM
> bless us with a built-in switch to their dir command. (Jim, could you
> push for that?)
>
>  Cheers,
>             Stefan
>
>

 No, I can't push for anything because I don't work in OS/2 development, I'm
into Network Stations now. Even if I were still in it they never listened to
us tech people anyway.

 A user has mentioned to me that my Drives program has a problem reporting
the proper file system sizes on large drives, and jdir has this problem too
so I'll be fixing both of them very soon. My web page will have a date later
than 8/31/1999 on it when I'm done, and the file containing all my "toys"
will be named warp10.

 Fixing the code is easy, going thru the gyrations to get in onto my web
page is the hard part.

--

Jim Lewis
Not speaking for IBM.
Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Network Computing Division (1:109/42)

+----------------------------------------------------------------------------+

From: jr_fox@earthlink.net                              01-Sep-99 13:07:18
  To: All                                               01-Sep-99 21:47:10
Subj: Re: Swap file

From: "J. R. Fox" <jr_fox@earthlink.net>

Trevor Hemsley wrote:
> 
> On Wed, 01 Sep 1999 00:52:49 GMT, jpedone_no_spam@flash.net wrote:
> 
> ->  Now granted, these two programs are memory hogs but does a swap of
> ->around 70MB seem excessive?
> 
> Unanswerable question - you didn't asy how much RAM you have. On an 8MB
> system a 70MB swapfile would not seem unreasonable given these two apps
> ;-) On a 1GB system, likewise but for the opposite reason (70Mb in 1024Mb
> is tiny!).
> 
> 
> Trevor Hemsley, London, UK
> (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)

Hi Trevor,

I'm sure I must have asked you this before, but either lost 
track or just didn't quite get it.  I have 256M Ram, but never
changed my swapfile from its default, which I think is around
2M.  Would I gain anything by bumping that up to say 10 or 20M?
I do hear disk writes periodically, when nothing is really 
going on that might account for them.  Presumably this is swap-
file activity.  (But things seem acceptable, the way they are.)

TIA.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: mike@lionsgate.com                                01-Sep-99 20:52:21
  To: All                                               01-Sep-99 21:47:11
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: mike@lionsgate.com (Mike Stephen)

In message <5+Gz3kDg65cA090yn@ibm.net> - dcasey@ibm.net (Dan Casey)
writes:
>
:>Just got this in e-mail and thought I'd disseminate it here:
:>
:>*************************************************************
:>
:>Hi
:>
:>I thought you all might be interested in the following:-
:>
:>DOWNLOAD: Complimentary Copy of DB2 Universal
:>Database Version 6.1 Personal Developer's Edition
:>
:> http://www6.software.ibm.com/dl/db2pde/db2pde-p/
:>
:>  Download a complimentary copy of DB2* Universal
:>  Database 6.1 Personal Developer's Edition for
:>  Windows NT**/95**/98**, OS/2*, or Linux, and start
:>  building robust, scalable tools and applications
:>  for DB2 Universal Database Personal Edition.
:>  Downloads are available in many spoken languages.



So here I ma on the IBM site, ready to download..... WHAT!?

Typically ibm, is the web page that tells us nothing.  I know I
shouldn;t complain, because IBM is giving it away , but coudn't they
at least tell me why I might want a certain version?  Whats the
diiferance between a common and an english version?  Whats the
differance between the personal version and the Connect Personal
version?

What are the extenders?

Even when IBM could make out like the great company it can be, they
really tend to screw up.....

I have a ADSL modem, so I will download them all to see what each of
them offers.  Do any of you out there know about these differances?

--------
  DB2 Personal Developer's Edition V6.1

 OS2 Personal Edition
 Common

                       pecmn.zip (40 MB)

 English

                       peen.zip (32.8 MB)

 OS2 Connect Personal Edition
 Common

                       cpecmn.zip (32.1 MB)

 English

                       cpeen.zip (33.4 MB)

 OS2 DB2 ExtendersExtenders
 Common

                       x61os2ic.zip (50.7 MB)

 OS2 DB2 Extenders - Language
 Specific (all languages)

                       x61os2il.zip (66.1 MB)

 Intel DB2 Extenders Readme and
 Postscript documentation

                       x61intd.zip (24.1 MB

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: M Stephen Contracting (1:109/42)

+----------------------------------------------------------------------------+

From: gmcleod@idirect.com                               01-Sep-99 17:15:20
  To: All                                               01-Sep-99 21:47:11
Subj: BootManager Gone

From: "gordon mcleod" <gmcleod@idirect.com>

I had to install win95 on my laptop that had bootmanager with dos/os2
win95 deleted the bootmanager can it be re activated easily



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: via Internet Direct - http://www.mydirect.com/ (1:109/42)

+----------------------------------------------------------------------------+

From: abeagley@datatone.com                             01-Sep-99 17:19:29
  To: All                                               01-Sep-99 21:47:11
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: Alan Beagley <abeagley@datatone.com>


Mike Stephen asked about the common version vs. the English version.

I "happened to" read the installation instructions and found that it is
necessary to download both the common version and the language-specific
version. IOW, you need both "english" and "common."

Alan

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: ekadakal@aol.com                                  01-Sep-99 21:21:12
  To: All                                               01-Sep-99 21:47:11
Subj: What is IBMNULL print driver is for?

From: ekadakal@aol.com (EKadakal)

Hello Everyone:

The problem is:

I have removed all printers from Warp4 printer folder. However when I do Print
Screen from FULL SCREEN applications (DOS or OS/2), it still prints through
the
LPT1 if there is a printer attached. However if no printer is attached, then
it
completely locks up when presses PrintScreen on a DELL Gn Optiplex machine. 

I am suspicious that the printing is done via IBMNULL, but why is that it
would
lock up if there is no printer attached

Does anyone have any idea?

Regards

John

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AOL http://www.aol.com (1:109/42)

+----------------------------------------------------------------------------+

From: smariga@gte.net                                   02-Sep-99 02:19:11
  To: All                                               01-Sep-99 21:47:11
Subj: Re: BootManager Gone

From: Alex Smariga <smariga@gte.net>

On Wed, 01 Sep 1999 17:15:41 -0400 (EDT), gordon mcleod wrote:

>I had to install win95 on my laptop that had bootmanager with dos/os2
>win95 deleted the bootmanager can it be re activated easily
>
>

If in Win95 you start up FDISK, you will see that the "active" partition
is the Win95 partition.  Make the boot manager partition the active one,
and you will be back in business.  Also, while you are there, add the 
Win95 partition to the boot manager, and you can swap back and forth.

Alex


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: weismer@erols.com                                 01-Sep-99 17:35:13
  To: All                                               01-Sep-99 21:47:11
Subj: Re: Important News From Dan Porter of Innoval

From: Murray Weismer <weismer@erols.com>

<weismer@erols.com>
> wrote:
> | As OS2 users, I guess we should be gracious to all who will throw us a
> | bone????
> 
> As human beings, I think we should do our best to be gracious to
> everybody.
> 

I agree 100%



> Murray, perhaps you've been lucky enough to succeed at everything you
> tried. Perhaps, if you failed at your goals, it was only your own life
> that was affected. Some of us aren't this lucky.
> The OS/2 community has had experience with one ISV, SPG, who actively
> abandoned the community, after making implied promises of a new
> product. Other OS/2 ISVs have quietly stopped updating their
> applications, and turned their attention to more remunerative
> platforms. Want a copy of Skyscraper? Lantastic for OS/2? the IBM OS/2
> Funpak? Sorry, you're out of luck. 


Non of the above products asked for money up front for an undeveloped
product. While I admire Dan for many of the positions that he has taken
in the past, I have had a bit of difficulty with his LONG lack of
response to the List that he sponsored. It almost seems like this "gift"
(I think $40, if I recall correctly) was an attempt to repair the PR
damage to himself and Innoval. 

I do appreciate this recent break in silence, and his offering to the
OS2 community, and perhaps he should be applauded for it. As you have
said in different words, he could have done what the author of CuSeeMe
did.

It just seems that collectively, we OS2 users are accepting a second
class status, too often accepting the scraps cast off from the Microsoft
world, instead of demanding quality product and service, and rewarding
those who still do provide it.

Dan Porter had the guts to tell
> people what the company was doing, and why, even if the news wasn't
> what you wanted to hear. And he make the current versions available
> for free, with no strings attached.
-- 
___________________________________________________________
Home of DreckBak OS/2 Disk Backup Utility Suite
http://weismer.virtualave.net/DreckBak.html
_____PLEASE DO BACKUP YOUR DISKS_________________________
IBM BESTTeam - Team OS/2	
RPS.BBS  Phila. Pa (215)624-8960 Adult, Bible, and OS2 related
Hot_Asian_Food: http://www.geocities.com/Tokyo/Towers/9001
Fix your Plumbing: http://reedps.virtualave.net
MEMBER of P.A.C.S. OS/2-JAVA S.I.G.: http://www.phillyos2.org
------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RPS, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: tim.timmins@bcs.org.uk                            01-Sep-99 22:47:29
  To: All                                               01-Sep-99 21:47:11
Subj: Re: BootManager Gone

From: Tim Timmins <tim.timmins@bcs.org.uk>

It didn't delete it, it made the Win partition active.
Use FDISK to make the Boot Manager partition active.

gordon mcleod wrote:

> I had to install win95 on my laptop that had bootmanager with dos/os2
> win95 deleted the bootmanager can it be re activated easily

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   01-Sep-99 16:17:21
  To: All                                               02-Sep-99 04:17:19
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: Kris Kadela <kris@dgraph.com>


seth berk wrote:
> 
> Anyone in Canada want to sell me a copy of their StarOffice CD?  I
> would love to save the shipping and handling costs.  (To our US
> friends, Canada Customs will assess a 7% GST (a sales tax) on the $16
> ( a little over a dollar) and *then* add a $5.00 handling fee to
> cover the cost of collecting the $1.12!!!! [smiley thing with the
> tongue sticking out])

Don't forget the GST on the handling fee as well. Just a week ago I
bought a motherboard from US.

The board was $100 US ($149CAD) plus $30CAD shipping ($170CAD) plus
Money Order charge $4CAD.
Guess what the duty charge was ..... $48CAD!!!! and then they charged
GST on the duty ($3.50CAD) plus $8 brekerage fee plus GST on the
brokerage fee = Total almost $250 CAD!! with $70 of that in taxes.
Thank you Jean.

Isn't this funny in a weird kind of way? We are being skinned alive
here.

:)))

> 
> So... if any fellow citizen of the great white north wants to contact
> me ... I'm in Vancouver, where we are having a terrific sale on
> passenger ships from overseas, only used once!
> 
> seth
> snberk@ibm.net
> 
> On Tue, 31 Aug 1999 23:48:16 -0500, Richard Steiner wrote:
> 
> >Here in comp.os.os2.apps, "Bob Stan" <rsstan@ibm.net>
> >spake unto us, saying:
> >
> >>Just went to www.stardivision.com and found the site now pointed to Sun.
> >>For about $16 including shipping you can get a CD with SO for all
> >>platforms included.
> >
> >Yup.  I just got one.  :-)
> >
> >--
> >   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
> >     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
> >      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
> >                 An expert is someone from out of town.

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: bvermo@powertech.no                               01-Sep-99 11:40:12
  To: All                                               02-Sep-99 04:17:19
Subj: Re: Print to graphic [was Re: METAFILE CONVERTION]

From: bv <bvermo@powertech.no>

Mat Kramer wrote:

> A more general question: is there a printer driver that will allow
> output to be saved as a file and then imported into Word 97 as a
> graphic?  Word will import HPGL -- which driver should I use for that?

If you use a HP printer with the HPGL-level Word works with and use only
printer
fonts (so the output will not contained downloaded fonts to the printer),
setting it
to print to file ought to work. I do not have Word to test with (and do not
feel it
as a loss).
The resulting filr is of type "Printer specific", and has 7 lines of spool
control
before the HPGL reset command (ESC-E). This ought not to bother a properly
made HPGL
import filter.

It may be useful to toggle "Fast system fonts".




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Norbionics (1:109/42)

+----------------------------------------------------------------------------+

From: tim.timmins@bcs.org.uk                            02-Sep-99 00:24:12
  To: All                                               02-Sep-99 06:34:29
Subj: Re: Important News From Dan Porter of Innoval

From: Tim Timmins <tim.timmins@bcs.org.uk>

Get Netscape.

Baden Kudrenecky wrote:

> In <37C8BBE3.90229050@WarpCity.com>, Tim Martin <OS2Guy@WarpCity.com>
writes:
> >Baden Kudrenecky wrote:
>
> >the second message from Dan Porter regarding the  "J Street Mailer
> >Initiative".  Warp City has been running exclusive JSM information, files
> >and upgrades offered by Samatra Software (Paul vanKeep and now
> >Mike Bowler) to Warp City members, many of whom use JSM.  Dan
> >may have submitted it to us (Warp City) because he feels confident
> >we will report his feelings, public statements and support of the
> >the newly created JSM Initiative.  InnoVal has every right on earth
> >to be proud as punch of JSM.  It is the finest 100% Java emailer
> >program on the market today.  Emerald Mail, MailPuccini and the
> >other entries have yet to equal the quality and features of JSM.
> >
> >Paul vanKeep and Mike Bowler have stepped forward to devote
> >their personal time and extraordinary Java programming skills
> >to ensure J Street Mailer stays 'out front' in the Java Emailer
> >category.  They have released a flurry of upgrades over the
> >last few weeks and are improving JSM with each release.  Another
> >release is expected any day now (PVK8).  A long list of new features
> >and bug fixes have been released.  Paul and Mike intend on improving
> >the quality of JSM beyond its current high quality state.  Their time,
> >efforts and exemplary work have all been offered for free because of
> >their admiration for the fine J Street Mailer.  JSM runs on Linux,
> >Windows95/98/NT, Mac and especially well on OS/2.   One program
> >that runs under all operating systems.  It is an amazing piece of
> >work created by InnoVal.
>
>    Where can obtain the JStreet updates, as there was not on
> Innoval's site, even before they ditched everything?
>
>    I am currently looking for a new mail program to replace
> UltiMail, and I am testing PMMail, JStreet, and now Post Road,
> and the only program that even comes close to my acceptability,
> is JStreet, however, it's memory footprint is huge, and that may
> preclude me from using it, and besides, I would like to actually
> support native OS/2 software.
>
> baden
>
> baden@unixg.ubc.ca
> http://baden.nu/
> OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     01-Sep-99 23:22:29
  To: All                                               02-Sep-99 06:34:29
Subj: Re: Swap file

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Wed, 01 Sep 1999 13:07:36 -0400, J. R. Fox wrote:

->I have 256M Ram, but never
->changed my swapfile from its default, which I think is around
->2M.  Would I gain anything by bumping that up to say 10 or 20M?

Check the size of swapper.dat in the directory pointed to by swappath= in
config.sys. If it's larger than the default then make the default as large
(at least) as the file is.

->I do hear disk writes periodically, when nothing is really 
->going on that might account for them.  Presumably this is swap-
->file activity.  (But things seem acceptable, the way they are.)

More likely to be INI files being rewritten on a timed basis.


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     02-Sep-99 00:32:06
  To: All                                               02-Sep-99 06:34:29
Subj: Re: 4-digit year in 'dir' list??

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Wed, 01 Sep 1999 23:37:16 +0100, Martin Lafaix wrote:

->In article <geribeurzfyrlqvnycvcrkpbz.fhc6x31.pminews@news.dial.pipex.com>,
->"Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com> wrote:
->>[On EA size and FIL_QUERYEASIZE]
->>
->>I can't find a file with >32Kb of EAs to try it out on. The field in the
->>FILEFINDBUF4 is a ULONG so it should be OK.
->
->You can either look for a big REXX script (cronrgf is an example
->available on Hobbes), once the tokenized REXX form is saved, or you
->can attach a big icon on a file or folder.
->
->The problem is that the field's value max out at 65535 if the EA size
->exceeds 32767.
->
->I guess it's just iceing on the cake.  I mean, 4 for no EAs, n/2 if n
->< 65535, and who know what when n = 65535...  "Broken as designed"
->comes to mind :-)

if (TempBuffer->cbList == 0xffff)
   {
   rc = DosEnumAttribute(...);
   }

The buffer returned contains a list of EA names plus their size. Each
entry in the buffer has an offset to the next entry. The first four bytes
that follow this contain 1,1,2 bytes and the 2 byet field contains the
length of the data in the EA that this entry refers to. The API call
returns the number of EAs attached and for each one you have to add 22
bytes to the final result obtained by adding the lengths of each EA. If
you want the data in the EA you have to make another call using another
API.

Yuck ;-)


Trevor Hemsley, London, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: tobell@my-deja.com                                02-Sep-99 00:48:10
  To: All                                               02-Sep-99 06:35:00
Subj: TVFS crashing

From: tobell@my-deja.com

Hi,

I'm looking for some guidance regarding the toronto virtual file system
(TVFS).  I have it running on Warp server, where 4 drives are mapped as
a single virtual drive.  This worked well, I was even able to share
this virtual drive across a network using an alias.  However, when I
added some additional non-local network drives to the mix, TVFS started
to crash once every 30 hours or so.  The local drives are 10 gigs each,
and the one network drive is 13 gigs.  Is there a limitation on the
maximum number of files one can map to a virtual drive? Are there some
parameters that need to be tweeked for better performance across the
network.

Any help would be appreciated!


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  01-Sep-99 20:58:29
  To: All                                               02-Sep-99 06:35:00
Subj: Re: Backup Exec for OS2

From: mchasson@ibm.net

In <37CD668A.6CA3B3CD@cgi.ca>, on 09/01/99 at 01:46 PM,
   "Brien, Eric" <eric.brien@cgi.ca> said:

>Does anyone have a link where I can get a test/Full version of Backup
>exec for OS2?

I might sell my copy, but you should understand that the software is no
longer supported by the owner although it is still offered for sale.  It
is a good program with some limitations.


-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: mchasson@ibm.net                                  01-Sep-99 21:02:07
  To: All                                               02-Sep-99 06:35:00
Subj: Re: Where to buy Academic Smart Suite????

From: mchasson@ibm.net

In <iCLz3oHpv6EC092yn@visi.com>, on 08/31/99 at 11:50 PM,
   rsteiner@visi.com (Richard Steiner) said:

>Here in comp.os.os2.apps, mchasson@ibm.net spake unto us, saying:

>>My daughter is giving up skiing for the year and starting grad school.  I
>>am giving her one of my old boxes and I went looking for the Lotus OS2
>>stuff at IB in the Academic pricing page without success.  Are these apps
>>no longer available for purchase at a price mere mortals can afford???

>Out of curiosity: Would StarOffice be a suitable replacement?

A matter of taste.  I'd prefer the Lotus.

-- 
----------------------------------------------------
------
Monroe Chasson
mchasson@ibm.net
-----------------------------------------------------------
MR2ICE reg#51 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: rolf@together.net                                 01-Sep-99 21:21:24
  To: All                                               02-Sep-99 06:35:00
Subj: New RenamePics - need beta testers!

From: "Rolf Lochb?hler" <rolf@together.net>

RenamePics is a program that extracts exposure information from
digital photos. The original code of RenamePics was written by
Denise Hallmark and is available from Hobbes
<http://hobbes.nmsu.edu/>.

Brian Morrison and I have been working on a new version of
RenamePics that can also handle the EXIF format used by newer
Olympus digital cameras. The older RenamePics code is included in
this new version, but had to be modified a bit.

So, we're looking for people who use the older version and would
like to run a few tests to verify that this new version still works
like the old one. 

In case you'd like to help, please send me a note and I'll send you
a copy of the new executable.

Thanks.


rl



--
Rolf Lochbhler
rolf@together.net



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Together Networks - Burlington, VT. (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           02-Sep-99 02:07:18
  To: All                                               02-Sep-99 06:35:00
Subj: Re: What is IBMNULL print driver is for?

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Wed, 1 Sep 1999 21:21:25, ekadakal@aol.com (EKadakal) wrote:

> Hello Everyone:
> 
> The problem is:
> 
> I have removed all printers from Warp4 printer folder. However when I do
Print
> Screen from FULL SCREEN applications (DOS or OS/2), it still prints through
the
> LPT1 if there is a printer attached. However if no printer is attached, then 
it
> completely locks up when presses PrintScreen on a DELL Gn Optiplex machine. 
> 
> I am suspicious that the printing is done via IBMNULL, but why is that it
would
> lock up if there is no printer attached
> 
> Does anyone have any idea?
> 

It might be done some kind of program that just write to
the port at the hardware level (and it isn't smart enough to
quit if the printer isn't present).

At one point in time I was under the impression that the
BIOS had some code that did this (although the way my
memory has been failing recently I'm probably wrong)

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jdholt@ibm.net                                    02-Sep-99 02:14:18
  To: All                                               02-Sep-99 06:35:00
Subj: EPM TeX question

From: jdholt@ibm.net (John Holt)


I am using EPM TeX and am trying to use the "User" menu items to add
GhostView.  Unfortunately, the macros have a slight error and can not
recognize the existance of file with a two character file extension. 
Has anyone already fixed this??


Thanks in advance,

//---------------------------------------------------------//
//  John Holt                                              //
//---------------------------------------------------------//

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: mamodeo@stny.rr.com                               02-Sep-99 00:00:07
  To: All                                               02-Sep-99 06:35:00
Subj: New release of MAME for OS/2 available

From: Marty <mamodeo@stny.rr.com>

A new release of MAME (Multiple Arcade Machine Emulator) for OS/2 is
available.  MAME run over 1200 classic and some not so classic arcade games
from the comfort of your OS/2 desktop.

The current OS/2 version is .35 beta 11 (final).  This replaces the
previous "prerelease" version and fixes just about every bug I knew about
(and hopefully many I didn't know about).

For more information and to download the latest version, visit
http://emuos2.davesvgc.com.  There is a Pentium optimized as well as a 486
optimized version available.

Enjoy!

- Marty

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Time Warner Road Runner - Binghamton NY (1:109/42)

+----------------------------------------------------------------------------+

From: jvarela@mind-spring.com                           02-Sep-99 00:23:04
  To: All                                               02-Sep-99 10:42:05
Subj: Re: BOOTOS2 doesn't work for me!!!!! Help!!!!!

From: jvarela@mind-spring.com (John Varela)

On Wed, 1 Sep 1999 19:03:06, Juan I. Cahis <jiclbch@ibm.net> wrote:

> Dear Friends:
> 
> I tried to generate a two diskette, bootable, minimum OS/2, using
> BOOTOS2. The problem is that the product insists to include, in the
> first diskette, a lot of drivers that are included in my main
> CONFIG.SYS, that I don't need in an emergency diskette based OS/2.
> Among them are my sound card drivers, PCMCIA drivers, etc. So, BOOTOS2
> collapses when the first diskette becomes full.
> 
> What can I do?

Save a copy of your CONFIG.SYS to CONFIG.BAK, edit the drivers you 
don't want out of CONFIG.SYS, run BOOTOS2, then use the backup to 
restore your original CONFIG.SYS.

--
John Varela
to e-mail, remove - between mind and spring

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: bill.m@no.spam.net                                02-Sep-99 09:55:28
  To: All                                               02-Sep-99 10:42:05
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: bill.m@no.spam.net

In <37CDA606.8DA94EE3@dgraph.com>, on 09/01/99 
   at 04:17 PM, Kris Kadela <kris@dgraph.com> said:


>Don't forget the GST on the handling fee as well. Just a
>week ago I bought a motherboard from US.

>The board was $100 US ($149CAD) plus $30CAD shipping
>($170CAD) plus Money Order charge $4CAD.
>Guess what the duty charge was ..... $48CAD!!!! and then
>they charged GST on the duty ($3.50CAD) plus $8 brekerage
>fee plus GST on the brokerage fee = Total almost $250 CAD!!
>with $70 of that in taxes.

Is this the Canadian Governments definition of "Free Trade"
between Canada, US, and Mexico? or does that only apply to
corporate level and individuals still have a (Gov.) hand in
their pockets?

Have a good one!

wmmorrow (at) flash (dot) net 
 All opinion expressed are my own - no one else believes
them.


Bill M.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: pasnak@delete.cableregina.com                     02-Sep-99 06:01:28
  To: All                                               02-Sep-99 15:03:08
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: pasnak@delete.cableregina.com (J.P. Pasnak)

On Wed, 1 Sep 1999 17:19:52, "seth berk" <snberk@ibm.net> woke up with
a head full of whiskey and wrote:

> Anyone in Canada want to sell me a copy of their StarOffice CD?  I
> would love to save the shipping and handling costs.  (To our US
> friends, Canada Customs will assess a 7% GST (a sales tax) on the $16
> ( a little over a dollar) and *then* add a $5.00 handling fee to
> cover the cost of collecting the $1.12!!!! [smiley thing with the
> tongue sticking out])
> 
> So... if any fellow citizen of the great white north wants to contact
> me ... I'm in Vancouver, where we are having a terrific sale on
> passenger ships from overseas, only used once!
> 
> seth
> snberk@ibm.net 
> 
> 

I thought there might be a way around this, but it seems Sun Canada is
temporarily offline. (see below).  I wonder what the total cost would 
be if I ordered 10 CDs from the states?  GST is something we have to 
live with, but I wonder what other 'import' taxes Customs would add?

J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

from Sun Shop (Canada Style)

                 August 16, 1999
                 Sun Microsystems of Canada
                 Electronic Store Customers and Visitors

                 Re: SunStore Notification

                 In preparation for the opening of a new enhanced 
Web/Internet
                 Electronic Store, we will temporarily suspend 
activities on the current
                 site beginning late August, 1999. 

                 A specific launch date for re-opening has not yet 
been identified
                 however we anticipate services will commence within a
reasonable
                 timeframe.

                 Sun Canada's objective is to increase our level of 
service to customers
                 and we apologize for any inconvenience this may 
cause. 

                 This letter will also be e-mailed to recent SunStore 
Site Customers
                 and Visitors.

                 Until further notice please contact Sun Online at 
800-786-0404. 

                 Michael Walsh,
                 Director of Marketing,
                 Sun Microsystems of Canada Inc.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       02-Sep-99 12:34:19
  To: All                                               02-Sep-99 15:03:08
Subj: Re: CAD recommendation

From: Will Rose <cwr@cts.com>

Stefan A. Deutscher <stefand@lcam.u-psud.fr> wrote:
: On 30 Aug 1999 19:43:59 GMT, Will Rose <cwr@cts.com> wrote:
:>gordon mcleod <gmcleod@idirect.com> wrote:
:>: IBM Cad for OS2 was a very powerfull 2d cad system and IBMCad3x was a very
:>: good light version  CadKey v7 for dos runs very well under OS2 as does
:>: DataCad for Dos
:>: A company in England bought Cad3x and I understand there is now a 4X but I
:>: haven't any info on it and I don't think there is a web site for it
:>: Acad 10, and 12 for Dos will also sun in OS2
:>
:>Cad 3X won't run at 1024x764 by > 256 colours - it's fine under that.
:>I don't think it was ever patched or updated; I tried hard to get a
:>working version for OS/2 a while back, since it's small and does all
:>I want a CAD program to do.  Anyone knowing about an upgrade, please
:>let me know too.

: I still have it, too. Does what I want, except doesn't see long file
: names, and is a bit clunky at times. But for US$ 99 it wasn't bad. (I
: think I wrote a longer review somewhere.) The whole thing felt like a
: 16bit OS/2 recompile of a DOS program (this is not bad in itself).

: Regarding the updates -- I once received a flyer announcing a couple
: really nice things updated (dynamic dimensioning being the one I loved
: most), but a quick phone call destroyed that hope: For the time being,
: only the DOS version was updated. That was a few years back.


Yeah, I got a flyer too. I actually started ordering the thing before I
found it was Win95 only.  There was nothing anywhere on the flyer to
say it wasn't OS/2...


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: cwr@cts.com                                       02-Sep-99 12:40:08
  To: All                                               02-Sep-99 15:03:08
Subj: Re: Process Commander and DOS box.

From: Will Rose <cwr@cts.com>

J. R. Fox <jr_fox@earthlink.net> wrote:
: Will Rose wrote:
:> 
:> I've been hunting down problems with Process Commander, and have found
:> an odd one; the full-screen version seems to prevent a DOS box running
:> more than once.  That is, you can start a windowed DOS session just fine,
:> but if that window is closed and you try to re-open it you get an error
:> message "Cannot run" or words to that effect.  I've been trying to find
:> this problem's source for some time; at a guess it appeared with FP 22.
:> However, I've confirmed its appearance and disappearance with Process
:> Command 1.02 and FP 40.
:> 
:> Anyone seen anything similar?  I very much like Process Commander - it's
:> not the essential that it used to be, but I still miss it a lot.
:> 
:> Will
:> cwr@crash.cts.com

: No, not that one, but PC's replacement of some key system files
: can cause problems elsewhere, with things like UniMaint's Desk-
: top Reset feature (replaces the WarpCenter with garbage, dtop
: does not repopulate, may screw up you video; you just have to
: try to shutdown and Reset).  There are some backup issues -- 
: can't recall everything right now.  Anyway, these problems were
: supposedly corrected for Object Desktop, fairly recently, but
: AFAIK have not been addressed yet with PC.

I've never had any problems with Unimaint, which I've used as long
as I've used Process Commander (but this is under Warp 3.0) nor any
backup issues.  I don't use Object Desktop (or any desktop enhancer).
AFAIK the only files changed are DOSCALL1.DLL (patched), KBDBASE.SYS
(replaced) and PMSHELL.EXE (the PROTSHELL in CONFIG.SYS).

Now that I know where to look, I'll start with a base 3.0 system and
add a few fixpacks and see what happens.

: Your msg. implies a later fixpack for PC, though.  I applied 
: their first CSD quite some time ago, bringing the product up
: to 1.01.  Is there in fact a later CSD ?

No, I goofed; I'm using 1.01.


Will
cwr@crash.cts.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CTS Network Services (1:109/42)

+----------------------------------------------------------------------------+

From: bnc@webone.com.au                                 02-Sep-99 22:43:04
  To: All                                               02-Sep-99 15:03:08
Subj: Re: Using OS/2 as a telephone

From: bnc@webone.com.au

I can assure you that Voicedial works. It has a minor problem in that the DTMF 
tones
do not work from the keyboard sometimes. They always work using the mouse.
However, you must have a speakerphone modem.
The speakerphone modem has two codecs in it to manage the sound in and out.

Brian

In <nyhqjvtemhavcbgfqnzqr.fhcpej0.pminews@news.rz.uni-potsdam.de>, "Andreas
Ludwig" <aludwig@ErzETT.uni-potsdam.de> writes:
>On 31 Aug 1999 16:15:32 +0100, Anders Jakobsson wrote:
>
>>I would like to use my Thinkpad 600 running OS/2 v4 FP11 as a telephone. I
have tried with Organizer (latest Smartsuite 1.1.1) but I cannot get it to
work. If anyone has been successfull please tell me how. My internal modem
works, I use it to call internet at home. Is there any other telephone apps
that should work?
>
>I don't know about your modem chipset - but for simple telephony try
>VoiceDial/2 its on hobbes as
>
>vdial*.zip
>
>with *=321 for current version (?)
>
>regards
>
>Andreas
>
>
>
>--
>
>Andreas Ludwig
>from the beautiful town of POTSDAM (Germany)
>using my good old PC and OS/2 WARP 4 !
>
>(remove the BIG letters to reply)
>
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Web One Internet http://webone.com.au (1:109/42)

+----------------------------------------------------------------------------+

From: bnc@webone.com.au                                 02-Sep-99 22:55:14
  To: All                                               02-Sep-99 15:03:08
Subj: Re: lynx and wget

From: bnc@webone.com.au

Download AWGET and give it a go.  If you do, you need to put the config file
in MPTN\ETC.

Here is a sample config that works, change to suite.

download = F:\AWGET\DOWNLOAD
maximum_downloads_simultaneously = 4
messages = 1
log_file = F:\awget\ToDo\Info\awget.log
error_log = F:\awget\ToDo\Info\awget_error.log
wget_parameters = -c -t 0 -w 30 -v
scan_interval = 30
check_connection = 0
use_desktop = 1
keep_failed_url = 1
keep_done_url = 0



However, I am using lynx here as well. Runs like a bought one. FTP/HTTP no
problem. 
Lynx has quite a few parameters you can set. It pays to go through them.


In <37CC18A2.E5207E4A@halcyon.com>, Dennis Peterson <dpeterso@halcyon.com>
writes:
>Just run wget without lynx. It will copy the URL to your HD. It even
>supports reget.
>
>dp
>
>Jan Danielsson wrote:
>> 
>> Hello!
>> 
>> I decided that sometimes it takes too long time to fire up Netscape when I
>> want to download a small file, so I installed Lynx.
>> 
>> Apart from it crashing all the time (Netscape never crashes), I have
managed
>> to set it up so it can get the job done. However, I would like to be able
to
>> download in the background. The lynx.cfg file contains something called
>> 'EXTERNAL', and it uses something called wget. I downloaded wget.
>> 
>> But wget is never started. Is the 'EXTERNAL' keyword unsupported in the
OS/2
>> version? (I'm using Lynx 2.8).
>> 
>> How do I get it to use the EXTERNAL feature?
>> 
>>  /j

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Web One Internet http://webone.com.au (1:109/42)

+----------------------------------------------------------------------------+

From: esther@bitranch.com                               02-Sep-99 13:07:16
  To: All                                               02-Sep-99 15:03:08
Subj: Re: Important News From Dan Porter of Innoval

From: esther@bitranch.com (Esther Schindler)

On Wed, 1 Sep 1999 21:35:27, Murray Weismer <weismer@erols.com> wrote:

| It just seems that collectively, we OS2 users are accepting a second
| class status, too often accepting the scraps cast off from the Microsoft
| world, instead of demanding quality product and service, and rewarding
| those who still do provide it.

Depending on the context, there are times I could agree with you. (You
may recall that I'm married to a developer of shrinkwrap OS/2 
software. <smile>) I'm _all_ for rewarding the publishers of quality 
OS/2 applications.

However, if Dan has the same attitude -- and I wouldn't speak for him 
-- then perhaps that's one of the reasons he *didn't* make the source 
code available? MR/2 ICE is still out there, after all; why take money
from its author's pocket?

 --Esther

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: bnc@webone.com.au                                 02-Sep-99 23:03:27
  To: All                                               02-Sep-99 15:03:08
Subj: Re: Swap file

From: bnc@webone.com.au

I have 128Mb too and for various reasons I do not want to use my swapfile.
So I use Lynx to keep the bytes down.
However, when I use NS I edit the preferences to set the Memory and Diskcache
to 0. I would like
to know if you still have the swapper problem then.

One of the reasons I can set the cache to 0 is that I run SCACHE. Pretty
simple to set up. JAVA programme.
Never given me any bother. 

And I agree about the memory upgrade

Brian


In <Z8vLRdP7nz3N-pn2-sYlPVBE6yPkg@yourmachine.yourlocaldomain.yourisp>,
donnelly@tampabay.rr.com (Buddy Donnelly) writes:
>On Wed, 1 Sep 1999 03:38:36, "Jeffrey S. Kobal" 
><murdoctor@ausNOSPAMtin.rr.com> a crit dans un message:
>
>
>I've got 128MB and it would be nice if running the new NS would quit 
>driving my swapfile to 32MB and up, without it shrinking back upon closing 
>NS.
>
>Or am I the only one who's noticed this?
>
>Or am I missing something earlier that I should be aware of?
>
>
>Good luck,
>
>Buddy
>
>Buddy Donnelly
>donnelly@tampabay.rr.com
>
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Web One Internet http://webone.com.au (1:109/42)

+----------------------------------------------------------------------------+

From: lifedata@xxvol.com                                02-Sep-99 10:36:09
  To: All                                               02-Sep-99 15:03:09
Subj: Re: Using OS/2 as a telephone

From: lifedata@xxvol.com

bnc@webone.com.au said:

>I can assure you that Voicedial works. 

That apparently depends on your chipset.  I've never gotten mine to
work.  As soon as the connect is made it turns it off again.

Jim L
Remove XX from address to Email
More gun laws will cure the nations ills - just like drug laws do.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: milindr@bellsouth.net                             02-Sep-99 15:09:15
  To: All                                               02-Sep-99 15:03:09
Subj: Re: BootManager Gone

From: milindr@bellsouth.net (Milind Rao)

On Thu, 2 Sep 1999 10:19:22, Alex Smariga <smariga@gte.net> wrote:

> On Wed, 01 Sep 1999 17:15:41 -0400 (EDT), gordon mcleod wrote:
> 
> >I had to install win95 on my laptop that had bootmanager with dos/os2
> >win95 deleted the bootmanager can it be re activated easily
> >
> If in Win95 you start up FDISK, you will see that the "active" partition
> is the Win95 partition.  Make the boot manager partition the active one,
> and you will be back in business.  Also, while you are there, add the 
> Win95 partition to the boot manager, and you can swap back and forth.

Can you add a bootmanager menu from Window's FDISK?

Regards
Milind

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: pandpATibm.net                                    02-Sep-99 16:09:02
  To: All                                               02-Sep-99 15:03:09
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: "Philip Nelson" <pandpATibm.net>

Yep, 

I know - I went into using Netscape, started the download again (to a
different directory) and read off the user ID and password from the download
dialog box.

Then switched to command line and started wget with the -c option and the
user ID and password included on the command as well.

Worked a treat for me.

I know its a bit silly requiring you to go through this rigmarole, but you
can't complain if you get it for nothing !!!



On Thu, 02 Sep 1999 08:03:02 +1200, Craig Benbow wrote:

>That would be fine but the damn thing is passworded to the ftp server!
>I have had to bitch about this to support before but as usual no action.
>You would think that if we are logged in to the devcon that we could be
>trusted with an ftp password!
>
>Craig
>
>Philip Nelson wrote:
>
>> If it fails use WGET with the -c option to restart the download.
>>
>> This is what I did.
>>
>> Phil Nelson
>> (pandp@ibm.net)
>>
>> On 1 Sep 1999 00:45:00 GMT, William Sonna wrote:
>>
>> >On Wed, 1 Sep 1999 00:13:45, dcasey@ibm.net (Dan Casey) wrote:
>> >
>> >> Just got this in e-mail and thought I'd disseminate it here:
>> >>
>> >> *************************************************************
>> >>
>> >> Hi
>> >>
>> >> I thought you all might be interested in the following:-
>> >>
>> >> DOWNLOAD: Complimentary Copy of DB2 Universal
>> >> Database Version 6.1 Personal Developer's Edition
>> >>
>> >>  http://www6.software.ibm.com/dl/db2pde/db2pde-p/
>> >>
>> >>   Download a complimentary copy of DB2* Universal
>> >>   Database 6.1 Personal Developer's Edition for
>> >>   Windows NT**/95**/98**, OS/2*, or Linux, and start
>> >>   building robust, scalable tools and applications
>> >>   for DB2 Universal Database Personal Edition.
>> >>   Downloads are available in many spoken languages.
>> >>
>> >> Eighth Annual International DB2 Users Group
>> >> European Conference, 18-21 October in Nice, France
>> >>
>> >>  http://www.idug.org/
>> >>
>> >>   The 8th Annual International DB2 Users Group
>> >>   (IDUG) European Conference, 18-21 October in Nice,
>> >>   France, focuses on data management knowledge. More
>> >>   than 70 technical sessions include DB2 Universal
>> >>   Database on all platforms, DBA challenges,
>> >>   application design, ERP, business intelligence,
>> >>   and heterogeneous networking. IBM will offer DB2
>> >>   UDB certification tests at no charge at the event.
>> >>
>> >> InfoWorld: "IBM's DB2 Powers Up PDAs"
>> >>
>> >>  http://www.infoworld.com/cgi-bin/displayTC.pl?/reviews/990823db2.htm
>> >>   (uppercase required as shown)
>> >>
>> >>   InfoWorld says "Thanks to its small footprint --
>> >>   about 100KB -- and its integration with Mobile
>> >>   Connect*, DB2 Everywhere* makes possible database
>> >>   applications that extend the reach of your
>> >>   database server to the road or the warehouse".
>> >>
>> >> SunWorld: "IBM Takes Lead in Database Competition"
>> >> with Leading-Edge Development Capabilities
>> >>
>> >>  http://www.sunworld.com/swol-08-1999/swol-08-regex.html#2
>> >>
>> >>   Sun Microsystems' SunWorld says "IBM is managing
>> >>   DB2 as a model for standards-based technology. IBM
>> >>   is the leader in turning the RDBMS business into a
>> >>   commodity market, one that it can legitimately
>> >>   dominate". Also: "July's 6.1 release of DB2 does
>> >>   plenty to make programmers' lives easier".
>> >>
>> >>
>> >> The full newsletter can be viewed at
>> >> http://www.ibm.com/software/news-alert/
>> >>
>> >> Regards
>> >> Joao Paulo
>> >>
>> >> ECI (UK)
>> >> UK Liason Officer
>> >>
>> >> **************************************************************
>> >>
>> >> --
>> >> **************************************************************
>> >> *  Dan Casey                                                 *
>> >> *  President                                                 *
>> >> *  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
>> >> *  http://www.os2voice.org                                   *
>> >> *  Abraxas on IRC                                            *
>> >> *  http://members.iquest.net/~dcasey                         *
>> >> *  Charter Associate member, Team SETI                       *
>> >> *  Warpstock 99 in Atlanta  http://www.warpstock.org         *
>> >> **************************************************************
>> >> *  E-Mail (subject: Req. PGP Key) for Public Key             *
>> >> **************************************************************
>> >
>> >Great News.  Now if I only had a browser that could actually download
>> >the 30-40 megabyte files without locking up or crashing.
>> >
>> >Oh well, I can dream, can' I?
>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          02-Sep-99 15:15:10
  To: All                                               02-Sep-99 15:03:09
Subj: Re: Swap file

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Thu, 2 Sep 1999 13:03:55, bnc@webone.com.au a crit dans un message:

> I have 128Mb too and for various reasons I do not want to use my swapfile.
> So I use Lynx to keep the bytes down.
> However, when I use NS I edit the preferences to set the Memory and
Diskcache to 0. I would like
> to know if you still have the swapper problem then.
> 
> One of the reasons I can set the cache to 0 is that I run SCACHE. Pretty
simple to set up. JAVA programme.

NS is set to 0 disk and 0 ram, plus SCACHE is running. Swap goes up, and 
doesn't come down, but it *does* seem to be happening more often when Java 
applets are included. (They're all over the place these days, of course.)


Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: zayne@omen.com.au                                 02-Sep-99 14:56:26
  To: All                                               02-Sep-99 15:03:09
Subj: Re: Backup Exec for OS2

From: "Moo" <zayne@omen.com.au>

Don't bother.  Its not y2k compliant, has not been supported for ages and
didnt work all that well even when it was.

Also has problems with drives > 4GB.

Try something that works, is supported and easy to use like PC-Bax from
cristie.

Cheers,
Craig

Brien, Eric <eric.brien@cgi.ca> wrote in article
<37CD668A.6CA3B3CD@cgi.ca>...
> Does anyone have a link where I can get a test/Full version of Backup
> exec for OS2?
> 
> 
> 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Omen Internet in Perth, Western Australia (1:109/42)

+----------------------------------------------------------------------------+

From: aludwig@ErzETT.uni-potsdam.de                     02-Sep-99 09:54:11
  To: All                                               02-Sep-99 16:41:12
Subj: Deutsche Version der StarOffice-CD auch aus deutschen Landen?

From: "Andreas Ludwig" <aludwig@ErzETT.uni-potsdam.de>

Hallo!
Ich wei zwar noch nicht, ob die bernahme von StarDivision durch Sun so eine
gute Sache ist, vor allem fr die nicht-Unix-nicht-Windows-Versionen (also
OS/2 und Mac), aber man kann ja Hoffnung habe...
Die Frage ist: Woher bekomme ich die CD, ohne da zu den Kosten fr die CD
($9.90) noch ber 25 $ Versandkosten kommen? Gibt es irgendwo in Deutschland
die Mglichkeit, die CD zu beziehen? Waren die 9.90 nicht eigentlich fr den
Versand der freien Software? Auerdem drfte das Verpacken und Verschicken
einer CD (Handbcher gibt es diesmal nicht - aber ich habe eh noch das von
der 5.0) nicht 25 $ kosten...

Kann mich irgendjemand aufklren? Ich htte gern die CD mit allen Versionen -
dann knnte ich auch endlich Freunden mit Windows-Rechnern die Vorzge von
StarOffice vorfhren.

Tschau! 

Andreas



--

Andreas Ludwig
gesendet mit meinem guten alten PC und OS/2 WARP 4 !
aus der schnen Stadt POTSDAM (Brandenburg)

(remove the BIG letters to reply)




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UNI Potsdam (1:109/42)

+----------------------------------------------------------------------------+

From: OS2Guy@WarpCity.com                               02-Sep-99 09:05:10
  To: All                                               02-Sep-99 16:41:12
Subj: JDIR - New Jim Lewis OS/2 Utility

From: Tim Martin <OS2Guy@WarpCity.com>

A request in these newsgroups for an enhanced 'dir'
OS/2 utility that would show the creation and last
update information, file attritubtes, EAs and more
has been fulfilled by Jim Lewis.  It is free and now
available for download from Jim's OS/2 Web Site
(http://chauvet.com/jim.lewis).

Jim offers a host of great stuff on his site, all for
free download:

Command Line Utils

config - Checks your CONFIG.SYS file for accuracy. You
can save many reboots with this.

crc - Calculate the 16 bit CRC of file(s).

crc32 - Calculate the 32 bit CRC of file(s).

drives - Shows all drive partitions in system, including LAN
and CD ROM. Shows file type  (FAT, HPFS, etc.) and space
remaining on each. Supports large drives.

elephant - Removes forever that annoying "elephant" from Warp 4.

f - Finds any and all files on the system. Can search by date, size,
 etc. A CRC function is  built in. Can show if a file has EAs, run a
command on each found file, and much more. Y2K  compliant.

findcom - Searches the PATH for the command (or file) you name.
 You can omit the extension, and this util will find the correct .COM,
 .EXE, or .CMD file.

grep - Searches files (text or binary) for simple strings. Will properly

 span directories.

jdir - An enhanced "dir" which shows creation and last update info,
 file attributes, EAs,  and more.

rdl - Removes all directories and files under and including dir given
 as a parameter, even read-only files. Does not prompt first, making
 it very useful in batch files.

reptab - Replaces tabs in file with the correct number of spaces.

screen - Ever have something on the screen you want saved? This
 util will save the current  screen contents to a file you name.

split - Splits big files into smaller size files. You control the size.
Also
 includes reminder on how to reassemble the file using the copy command.

strip - Strips the binary chars from a file leaving just the ASCII so
that it
 can be read.

touch - Changes date and time of files. Y2K compliant.

wave - Plays .WAV and .MID files. Wildcards work, too.

                       Presentation Manager Utils and Games

 Memory Status - An app that shows the current time, date, memory and
swap file usage,
 updated every 2 seconds. When requested, also shows location of swap
file, space left on
 swap drive, total ram in machine, sizes of OS2.INI and OS2SYS.INI,
location of boot drive,
 CD rom drive, OS/2 version and revision, and time since IPL. Has a
simple Alarm Clock
 function, and warns the user if space is below 2M on the swap drive. On
system shutdown,
 checks the A: drive (and optionally the CD) and warns you if a disk is
still in the drive.

 Targ for PM - A video game (requires 1024x768 or better screen
resolution).

 You can download all of the above in one file called:  warp10.zip.

                                         Java Games

 Targ for Java - Shoot the Targs before they ram your ship. The Targs
get
smarter on every level.

 Lunar Lander - Land on the red landing pads while dodging asteroids.

To miss this opportunity for some of the best OS/2 utilities
and Java games out there today.

Tim Martin
The OS/2 Guy
Warp City
http://warpcity.com
"E-ride the wild surf to Warp City!"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    01-Sep-99 16:35:17
  To: All                                               02-Sep-99 16:41:12
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: "seth berk" <snberk@ibm.net>

I know, believe me ... I just wanted to keep it simple.  I also get
to pay the 7% PST now ( I least I think so, the local paper mentioned
both Oct 1 and Sept 1st (what a rag of a paper)) because the province
has made a new deal with Rev Can to collect PST at the border.  

Anyway... have you got a copy of the CD??

Seth
snberk@ibm.net




On Wed, 01 Sep 1999 16:17:42 -0600, Kris Kadela wrote:

>
>
>seth berk wrote:
>> 
>> Anyone in Canada want to sell me a copy of their StarOffice CD?  I
>> would love to save the shipping and handling costs.  (To our US
>> friends, Canada Customs will assess a 7% GST (a sales tax) on the $16
>> ( a little over a dollar) and *then* add a $5.00 handling fee to
>> cover the cost of collecting the $1.12!!!! [smiley thing with the
>> tongue sticking out])
>
>Don't forget the GST on the handling fee as well. Just a week ago I
>bought a motherboard from US.
>
>The board was $100 US ($149CAD) plus $30CAD shipping ($170CAD) plus
>Money Order charge $4CAD.
>Guess what the duty charge was ..... $48CAD!!!! and then they charged
>GST on the duty ($3.50CAD) plus $8 brekerage fee plus GST on the
>brokerage fee = Total almost $250 CAD!! with $70 of that in taxes.
>Thank you Jean.
>
>Isn't this funny in a weird kind of way? We are being skinned alive
>here.
>
>:)))
>
>> 
>> So... if any fellow citizen of the great white north wants to contact
>> me ... I'm in Vancouver, where we are having a terrific sale on
>> passenger ships from overseas, only used once!
>> 
>> seth
>> snberk@ibm.net
>> 
>> On Tue, 31 Aug 1999 23:48:16 -0500, Richard Steiner wrote:
>> 
>> >Here in comp.os.os2.apps, "Bob Stan" <rsstan@ibm.net>
>> >spake unto us, saying:
>> >
>> >>Just went to www.stardivision.com and found the site now pointed to Sun.
>> >>For about $16 including shipping you can get a CD with SO for all
>> >>platforms included.
>> >
>> >Yup.  I just got one.  :-)
>> >
>> >--
>> >   -Rich Steiner  >>>--->  rsteiner@visi.com  >>>---> Bloomington, MN
>> >     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
>> >      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
>> >                 An expert is someone from out of town.
>
>-- 
>
>**********************
>DigiGraph Technical
>http://www.dgraph.com
>**********************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: andrie@ibm.net                                    01-Sep-99 19:16:13
  To: Britton.W.Robbins@usa.xerox.com                   02-Sep-99 16:41:13
Subj: Re: Sun Microsystems purchase of StarDivision

To: Britton Robbins <Britton.W.Robbins@usa.xerox.com>
From: "Hans Andrieen" <andrie@ibm.net>

Britton Robbins schrieb:
> 
> All,
> 
> Has anybody heard what the impact will be on future OS/2 versions of
> StarOffice???

If you View that
SUN is no frind of M$ and has no liason with M$
what implication will be?

Think, we have a new friend...

> Britton Robbins
> Field Engineer
> Xerox Corporation

Hans Andrieen
Technician of EMC/RFI Testing
(www.vde.com)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         02-Sep-99 16:41:06
  To: All                                               02-Sep-99 16:41:13
Subj: How to ...

From: racette@cablevision.qc.ca (Martin Racette)

Hi guys,

I would like to know How to copy the 
content of an Audio cassette (music), to
a CD-R while using RSJ 

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         02-Sep-99 16:42:29
  To: All                                               02-Sep-99 16:41:13
Subj: How to ...

From: racette@cablevision.qc.ca (Martin Racette)

Hi guys,
 
I would like to know How to copy the 
content of an Audio cassette (music), to
a CD-R while using RSJ 
 
//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    02-Sep-99 09:38:25
  To: All                                               02-Sep-99 16:41:13
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: "seth berk" <snberk@ibm.net>

As a guide... I recently ordered the WarpUp! CD from Indelible Blue
(which worked fabulously!)   I paid US$19 for the CD, and US$15 for
the shipping.  GST was CDN$1.99 (on the after-exchange US$19) and
CDN$5 handling to collect the GST.  **BUT** no customs duty.  I
believe that software maybe covered under NAFTA and therefore tarriff
free.  Shipping 10 CDs would certainly spead the shipping and
"handling" fee out, but why can't we just make some copies here?  I
admit I don't have the licence agreement here (if I did I wouldn't
need the CD), but they are *giving*  the thing away.  I would
register and get the key though the Sun/Star Division web site as if
I had downloaded it.  

Some one in Vancouver has offered to lend me their CD (to which I say
Thank You) but neither of us has a CD burner, and I would like to
have a copy to archive.

Thanks


On 2 Sep 1999 06:01:56 -0800, J.P. Pasnak wrote:

>On Wed, 1 Sep 1999 17:19:52, "seth berk" <snberk@ibm.net> woke up with
>a head full of whiskey and wrote:
>
>> Anyone in Canada want to sell me a copy of their StarOffice CD?  I
>> would love to save the shipping and handling costs.  (To our US
>> friends, Canada Customs will assess a 7% GST (a sales tax) on the $16
>> ( a little over a dollar) and *then* add a $5.00 handling fee to
>> cover the cost of collecting the $1.12!!!! [smiley thing with the
>> tongue sticking out])
>> 
>> So... if any fellow citizen of the great white north wants to contact
>> me ... I'm in Vancouver, where we are having a terrific sale on
>> passenger ships from overseas, only used once!
>> 
>> seth
>> snberk@ibm.net 
>> 
>> 
>
>I thought there might be a way around this, but it seems Sun Canada is
>temporarily offline. (see below).  I wonder what the total cost would 
>be if I ordered 10 CDs from the states?  GST is something we have to 
>live with, but I wonder what other 'import' taxes Customs would add?
>
>J.P. Pasnak
>Warped Systems
>******************
>http://members.xoom.com/Warped/every/everything.html
>http://members.xoom.com/Warped/every/dirmap.html
>http://clubs.yahoo.com/clubs/warpedusers
>*******************
>
>from Sun Shop (Canada Style)
>
>                 August 16, 1999
>                 Sun Microsystems of Canada
>                 Electronic Store Customers and Visitors
>
>                 Re: SunStore Notification
>
>                 In preparation for the opening of a new enhanced 
>Web/Internet
>                 Electronic Store, we will temporarily suspend 
>activities on the current
>                 site beginning late August, 1999. 
>
>                 A specific launch date for re-opening has not yet 
>been identified
>                 however we anticipate services will commence within a
>reasonable
>                 timeframe.
>
>                 Sun Canada's objective is to increase our level of 
>service to customers
>                 and we apologize for any inconvenience this may 
>cause. 
>
>                 This letter will also be e-mailed to recent SunStore 
>Site Customers
>                 and Visitors.
>
>                 Until further notice please contact Sun Online at 
>800-786-0404. 
>
>                 Michael Walsh,
>                 Director of Marketing,
>                 Sun Microsystems of Canada Inc.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    02-Sep-99 09:49:06
  To: All                                               02-Sep-99 16:41:13
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: "seth berk" <snberk@ibm.net>

On Thu, 02 Sep 1999 09:55:57 GMT, bill.m@no.spam.net wrote:

>In <37CDA606.8DA94EE3@dgraph.com>, on 09/01/99 
>   at 04:17 PM, Kris Kadela <kris@dgraph.com> said:
>
>
>>Don't forget the GST on the handling fee as well. Just a
>>week ago I bought a motherboard from US.
>
>>The board was $100 US ($149CAD) plus $30CAD shipping
>>($170CAD) plus Money Order charge $4CAD.
>>Guess what the duty charge was ..... $48CAD!!!! and then
>>they charged GST on the duty ($3.50CAD) plus $8 brekerage
>>fee plus GST on the brokerage fee = Total almost $250 CAD!!
>>with $70 of that in taxes.
>
>Is this the Canadian Governments definition of "Free Trade"
>between Canada, US, and Mexico? or does that only apply to
>corporate level and individuals still have a (Gov.) hand in
>their pockets?

Oh, these rules apply equally to individuals and corporations.  Its
just that corporations are "more equal".    I can't speak about the
Mexican gov't, but the US have their own (but different) rules that
take the "free" out of "free trade".  

>Have a good one!
>
I will!

Seth


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: aludwig@ErzETT.uni-potsdam.de                     02-Sep-99 21:24:29
  To: All                                               03-Sep-99 06:09:27
Subj: Re: Deutsche Version der StarOffice-CD auch aus deutschen Landen?

From: "Andreas Ludwig" <aludwig@ErzETT.uni-potsdam.de>

On Thu, 02 Sep 1999 09:54:22 +0100 (MEZ), Andreas Ludwig wrote:

>Hallo

[...cut...]

Sorry, wrong group. (supposed to go to de.comp...apps)

Andreas



--

Andreas Ludwig
from the beautiful town of POTSDAM (Germany)
using my good old PC and OS/2 WARP 4 !

(remove the BIG letters to reply)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UNI Potsdam (1:109/42)

+----------------------------------------------------------------------------+

From: racette@cablevision.qc.ca                         02-Sep-99 19:35:07
  To: All                                               03-Sep-99 06:09:27
Subj: Re: How to ...

From: racette@cablevision.qc.ca (Martin Racette)

On Thu, 2 Sep 1999 17:52:09, 
jdc0014@InfoNET.st-johns.nf.ca (John 
Hong) wrote:

> Martin Racette (racette@cablevision.qc.ca) wrote:
> 
> : I would like to know How to copy the 
> : content of an Audio cassette (music), to
> : a CD-R while using RSJ 
> 
> 	I don't think there is a way to do that directly onto a CDR 
> program.  Basically it would be a two-step process, get Digital Audio in 
> your Multimedia directory to store the song in .WAV file format first.  
> I've yet to try this, but you should be able to play the song on your 
> stereo and have it hooked up to your soundcard in the in-line plug and to 
> record with Digital Audio with the source being in-line.
> 
> 

So basicly I hvae to do it on a song per
song ! :-/

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: snberk@ibm.net                                    02-Sep-99 09:56:02
  To: All                                               03-Sep-99 06:09:27
Subj: Re: Swap file

From: "seth berk" <snberk@ibm.net>

On Wed, 01 Sep 1999 23:22:58 +0100 (BST), Trevor Hemsley wrote:

>On Wed, 01 Sep 1999 13:07:36 -0400, J. R. Fox wrote:
>
>->I have 256M Ram, but never
>->changed my swapfile from its default, which I think is around
>->2M.  Would I gain anything by bumping that up to say 10 or 20M?
>
>Check the size of swapper.dat in the directory pointed to by swappath= in
>config.sys. If it's larger than the default then make the default as large
>(at least) as the file is.

Also....  If you have more than one partition, check around for other
SWAPPER.DAT files.  I have put my Swap File on a non-boot partition,
but I find if I have booted to a command prompt (alt-F1 at boot blob)
it creates a new swap file.  At least I think that is the cause, I
haven't really tried to pin it down.  Anyways, I wasted some time
once trying to figure out why my Swap File was smaller than it should
have been, not realizing that I wasn't looking at the active
swapper.dat.

Seth




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: andrie@ibm.net                                    02-Sep-99 17:31:12
  To: aludwig@rz.uni-potsdam.de                         03-Sep-99 06:09:28
Subj: Re: Deutsche Version der StarOffice-CD auch aus deutschen Landen?

To: Andreas Ludwig <aludwig@rz.uni-potsdam.de>
From: "Hans Andrieen" <andrie@ibm.net>

Andreas Ludwig schrieb:
> 
> Hallo!
> Ich wei zwar noch nicht, ob die bernahme von StarDivision durch Sun so
eine
> gute Sache ist, vor allem fr die nicht-Unix-nicht-Windows-Versionen (also
> OS/2 und Mac), aber man kann ja Hoffnung habe...
> Die Frage ist: Woher bekomme ich die CD, ohne da zu den Kosten fr die CD
> ($9.90) noch ber 25 $ Versandkosten kommen? Gibt es irgendwo in Deutschland
> die Mglichkeit, die CD zu beziehen? Waren die 9.90 nicht eigentlich fr den
> Versand der freien Software? Auerdem drfte das Verpacken und Verschicken
> einer CD (Handbcher gibt es diesmal nicht - aber ich habe eh noch das von
> der 5.0) nicht 25 $ kosten...
> 
> Kann mich irgendjemand aufklren? Ich htte gern die CD mit allen Versionen
-
> dann knnte ich auch endlich Freunden mit Windows-Rechnern die Vorzge von
> StarOffice vorfhren.

Hast du dich schon mal direkt an Stardivision in Hamburg gewandt?
www.stardivision.de

Die verkaufen es nach wie vor mit Buch.

Tschau/2
Hans

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: mipri@gmx.net                                     02-Sep-99 21:40:24
  To: All                                               03-Sep-99 06:09:28
Subj: Re: RSJ CD writer from Hobbes

From: "Michael Prinzing" <mipri@gmx.net>

On Wed, 01 Sep 1999 18:57:37 GMT, Martin Racette wrote:

>> 2) I can no longer use my CD writer as a normal drive, unless a disk has
>>    been locked in it.
>> 
>That is normal, if you look when the 
>system boot, the RSJ drivers change your
>CD-R or CD-RW drive into a WORM 
>(Write-once Read-Many) drive, and those 
>drive must be lock in order to work, 
>that is why you ust use the command 
>ATTACH or CDATTACH

This is right, but nevertheless it is possible to use the writer as a
"normal" CD-ROM:

In your CONFIG.SYS, add the option /ALL to OS2ASPI.DMD and REM out the
line loading LOCKCDR.FLT. Now a normal CD-ROM drive letter is assigned
to the drive *and* it can be mounted by RSJ assigning a second drive
letter. But be warned: do not access the CD-ROM drive letter while RSJ
has mounted the drive or while you are writing a CD!


Michael



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Local Host (1:109/42)

+----------------------------------------------------------------------------+

From: benbowc@tui.lincoln.ac.nz                         03-Sep-99 12:06:22
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Swap file

From: Craig Benbow <benbowc@tui.lincoln.ac.nz>

This is a multi-part message in MIME format.
--------------455E3AF32830058D9E319587
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit

I'm intrigued!  How the heck do you get away with that?  In my experience you
need a pretty decent sized swapfile if you run many programs.  Especially apps
like NS & VAJ.

A note to those using NT (YUK!) don't attempt to set your swapfile smaller
than
1.5*Physical mem size!
IT WILL DIE AN AGONISINGLY SLOW DEATH!!!!!

Craig

"J. R. Fox" wrote:

> Trevor Hemsley wrote:
> >
> > On Wed, 01 Sep 1999 00:52:49 GMT, jpedone_no_spam@flash.net wrote:
> >
> > ->  Now granted, these two programs are memory hogs but does a swap of
> > ->around 70MB seem excessive?
> >
> > Unanswerable question - you didn't asy how much RAM you have. On an 8MB
> > system a 70MB swapfile would not seem unreasonable given these two apps
> > ;-) On a 1GB system, likewise but for the opposite reason (70Mb in 1024Mb
> > is tiny!).
> >
> >
> > Trevor Hemsley, London, UK
> > (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)
>
> Hi Trevor,
>
> I'm sure I must have asked you this before, but either lost
> track or just didn't quite get it.  I have 256M Ram, but never
> changed my swapfile from its default, which I think is around
> 2M.  Would I gain anything by bumping that up to say 10 or 20M?
> I do hear disk writes periodically, when nothing is really
> going on that might account for them.  Presumably this is swap-
> file activity.  (But things seem acceptable, the way they are.)
>
> TIA.
>
> <jf>

--------------455E3AF32830058D9E319587
Content-Type: text/x-vcard; charset=us-ascii;
 name="benbowc.vcf"
Content-Transfer-Encoding: 7bit
Content-Description: Card for Craig Benbow
Content-Disposition: attachment;
 filename="benbowc.vcf"

begin:vcard 
n:Benbow;Craig
tel;cell:64 21 625 287
tel;fax:64 3 325 3839
tel;home:64 3 324 4009
tel;work:64 3 325 2811 x8362
x-mozilla-html:FALSE
url:http://www.lincoln.ac.nz
org:Lincoln University;Management Systems Research Unit, Applied Management
and Computing
version:2.1
email;internet:benbowc@tui.lincoln.ac.nz
title:Mr
adr;quoted-printable:;;P.O. Box 84=0D=0ALincoln
University;;Canterbury;8021;New Zealand
x-mozilla-cpt:;28992
fn:Craig Benbow
end:vcard

--------------455E3AF32830058D9E319587--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Lincoln University (1:109/42)

+----------------------------------------------------------------------------+

From: donnelly@tampabay.rr.com                          02-Sep-99 23:47:09
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Swap file

From: donnelly@tampabay.rr.com (Buddy Donnelly)

On Thu, 2 Sep 1999 16:56:04, "seth berk" <snberk@ibm.net> a crit dans un 
message:

> On Wed, 01 Sep 1999 23:22:58 +0100 (BST), Trevor Hemsley wrote:
> 
> >On Wed, 01 Sep 1999 13:07:36 -0400, J. R. Fox wrote:
> >
> >->I have 256M Ram, but never
> >->changed my swapfile from its default, which I think is around
> >->2M.  Would I gain anything by bumping that up to say 10 or 20M?
> >
> >Check the size of swapper.dat in the directory pointed to by swappath= in
> >config.sys. If it's larger than the default then make the default as large
> >(at least) as the file is.
> 
> Also....  If you have more than one partition, check around for other
> SWAPPER.DAT files.  I have put my Swap File on a non-boot partition,
> but I find if I have booted to a command prompt (alt-F1 at boot blob)
> it creates a new swap file.  At least I think that is the cause, I
> haven't really tried to pin it down.  Anyways, I wasted some time
> once trying to figure out why my Swap File was smaller than it should
> have been, not realizing that I wasn't looking at the active
> swapper.dat.

When you boot to a command line (Alt-F1 I'm assuming) OS/2 will be creating
the SWAPPER.DAT that you are telling it to in the SWAPPATH statement in 
\OS2\BOOT\CONFIG.X.

When you boot to a Maintenance Desktop OS/2 will be creating the 
SWAPPER.DAT that you are telling it to in the SWAPPATH statement in 
\OS2\BOOT\CONFIG.M.

These CONFIGs are usually in a -r Readonly state, so remember to disengage 
the attribute before editing to make changes.

Good luck,

Buddy

Buddy Donnelly
donnelly@tampabay.rr.com


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@savebandwidth.invalid                      03-Sep-99 00:38:00
  To: All                                               03-Sep-99 06:09:28
Subj: Re: BootManager Gone

From: nospam@savebandwidth.invalid      (John Thompson)

In <yNUQIMEW4Brk-pn2-VdDvb2P8cj3u@h31059k1>, milindr@bellsouth.net (Milind
Rao) writes:

>Can you add a bootmanager menu from Window's FDISK?

No.  You need to boot OS/2 (from floppies, if necessary) and run 
OS/2 fdisk to modify the Boot Manager menu.  Or use Partition 
Magic, which can modify the Boot Manager menu from DOS or 
Windows without booting OS/2.

-John (John.Thompson@ibm.net)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: postmaster@127.0.0.1                              02-Sep-99 21:43:19
  To: All                                               03-Sep-99 06:09:28
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: <postmaster@127.0.0.1>

In <5+Gz3kDg65cA090yn@ibm.net>, dcasey@ibm.net (Dan Casey) said:

>Just got this in e-mail and thought I'd disseminate it here:

>*************************************************************

>Hi

>I thought you all might be interested in the following:-

>DOWNLOAD: Complimentary Copy of DB2 Universal
>Database Version 6.1 Personal Developer's Edition

> http://www6.software.ibm.com/dl/db2pde/db2pde-p/
>>>SNIP<<<

I saw this on IBM's site a couple weeks ago.  What I couldn't disseminate
was whether this was a useful tool or not.  It stated this version could
only be used for development of database applications.  I interpret that
as meaning you can't use it as a database.  And if you can't use it as a
database, it's worthless unless you already have DB2 running.

If anyone can clarify this I'd like to hear it.

David (d dot forrai at ieee dot org)
(The FROM: address is for spammers only)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: David's Internet Access (1:109/42)

+----------------------------------------------------------------------------+

From: "operagost"@e-mail.com (remove t...               03-Sep-99 01:55:23
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Important News From Dan Porter of Innoval

Message sender: "operagost"@e-mail.com (remove the - )

From: Stephen Eickhoff <"operagost"@e-mail.com (remove the - )>


Baden Kudrenecky wrote:

> In <P_ly3.343$cM2.81390@typhoon1.gnilink.net>, Stephen Eickhoff
<"operagost"@e-mail.com (remove the - )> writes:
>
>    Who the hell are you?  You sure aren't an OS/2 user, or you

Since 1994.

>
> would know about Innoval and their products.  You sure aren't a
> positive person, or you would not have posted this crap.  I have
> nothing but praise for Innoval's products, and I am only sorry
> that there was not enough revenue to help keep Dan supporting
> his discontinued products.
>

I liked Web WIlly and J Street. I said so about Web WIlly in my response. If I 
thought they made
lousy products, I would have shrugged and moved on.

But hey, I won't take it personally. My response was pretty much flame bait
and I expected someone
to bite.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dmckenn@ibm.net                                   02-Sep-99 22:07:24
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Warp Server and HPFS386

From: "David McKenna" <dmckenn@ibm.net>

On 30 Aug 1999 21:20:41 GMT, Carsten Frank wrote:

>On my small server I'm going to try out the hpfs386 filesystem. 
>After installing, if I would have trouble Can I deinstall it?
>
>Would this be a performance improvement?
>
>
    There *is* a (write) performance improvement - but be careful! If you 
are serving a LAN and you define some access control limits (ACL's) then you
may not be able to access directories that have been set for sharing when you
switch back to regular HPFS (I learned this the hard way).

   Also - if you go with HPFS386 you need boot disks that use it. Get BOOTOS2
from Hobbes and create the disks: it detects HPFS386 and puts it on your boot
disks - critical if you share directories on a LAN.

Dave McKenna


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: dagroe-nospam@messagehost.net                     03-Sep-99 02:15:13
  To: All                                               03-Sep-99 06:09:28
Subj: Re: AOL Instant Messenger for OS/2 ????

From: dagroe-nospam@messagehost.net (Dean Groe)

On Sat, 28 Aug 1999 00:10:48, donm@ftel.net (Don Morse) wrote:

 
> is there a new Java version????  I'm running the olderclient here as
detailed
> below, but I'd love to try a newer version
> 
Does this mean that you have AIM for Java running with 1.1.7? I have 
been trying like crazy to make it fly, but no luck. I was hoping that 
I would not have to download the 1.1.8 that is currently available. I 
think that it is only the full JDK right now. All I need is a JVM. 

Every time I try to launch AIM Java, I get a tiny window that says log
(login maybe?) that cannot be adjusted and in the Java screen is see 
errors about invalid functions, or something like that. I do not have 
it on this computer and do not have the messages written down. I just 
assumed it was a lack of functionallity on the part of OS/2 Java 1.1.7
 I do have other Java apps running OK. 

Dean

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: kris@dgraph.com                                   02-Sep-99 20:40:20
  To: All                                               03-Sep-99 06:09:28
Subj: Re: Sun Microsystems purchase of StarDivision

From: Kris Kadela <kris@dgraph.com>


"Hans Andrieen" wrote:
> 
> Britton Robbins schrieb:
> >
> > All,
> >
> > Has anybody heard what the impact will be on future OS/2 versions of
> > StarOffice???
> 
> If you View that
> SUN is no frind of M$ and has no liason with M$
> what implication will be?
> 
> Think, we have a new friend...

Unless they ditch the native fat client and will only develop the java
version.

> 
> > Britton Robbins
> > Field Engineer
> > Xerox Corporation
> 
> Hans Andrieen
> Technician of EMC/RFI Testing
> (www.vde.com)

-- 

**********************
DigiGraph Technical
http://www.dgraph.com
**********************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DigiGraph Technical (1:109/42)

+----------------------------------------------------------------------------+

From: smariga@gte.net                                   02-Sep-99 23:54:12
  To: All                                               03-Sep-99 06:09:29
Subj: Re: BootManager Gone

From: Alex Smariga <smariga@gte.net>

On Thu, 02 Sep 1999 15:09:30 GMT, Milind Rao wrote:

>On Thu, 2 Sep 1999 10:19:22, Alex Smariga <smariga@gte.net> wrote:
>
>> On Wed, 01 Sep 1999 17:15:41 -0400 (EDT), gordon mcleod wrote:
>> 
>> >I had to install win95 on my laptop that had bootmanager with dos/os2
>> >win95 deleted the bootmanager can it be re activated easily
>> >
>> If in Win95 you start up FDISK, you will see that the "active" partition
>> is the Win95 partition.  Make the boot manager partition the active one,
>> and you will be back in business.  Also, while you are there, add the 
>> Win95 partition to the boot manager, and you can swap back and forth.
>
>Can you add a bootmanager menu from Window's FDISK?
>
Good point.  You'll have to reboot to OS/2, and then using the OS2 
FDisk, add the Win95 partition to the boot manager.  Then you will be in
good shape.




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jdc0014@InfoNET.st-johns.nf.ca                    02-Sep-99 17:52:04
  To: All                                               03-Sep-99 06:09:29
Subj: Re: How to ...

From: jdc0014@InfoNET.st-johns.nf.ca (John Hong)

Martin Racette (racette@cablevision.qc.ca) wrote:

: I would like to know How to copy the 
: content of an Audio cassette (music), to
: a CD-R while using RSJ 

	I don't think there is a way to do that directly onto a CDR 
program.  Basically it would be a two-step process, get Digital Audio in 
your Multimedia directory to store the song in .WAV file format first.  
I've yet to try this, but you should be able to play the song on your 
stereo and have it hooked up to your soundcard in the in-line plug and to 
record with Digital Audio with the source being in-line.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: jbrock@panix.com                                  02-Sep-99 23:27:28
  To: All                                               03-Sep-99 10:34:21
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: jbrock@panix.com (John Brock)

In article <37cf2892$1$q.sbeenv$mr2ice@news.dma.org>,
 <postmaster@127.0.0.1> wrote:

>In <5+Gz3kDg65cA090yn@ibm.net>, dcasey@ibm.net (Dan Casey) said:

>>Just got this in e-mail and thought I'd disseminate it here:
>
>>*************************************************************
>
>>Hi
>
>>I thought you all might be interested in the following:-
>
>>DOWNLOAD: Complimentary Copy of DB2 Universal
>>Database Version 6.1 Personal Developer's Edition
>
>> http://www6.software.ibm.com/dl/db2pde/db2pde-p/

>I saw this on IBM's site a couple weeks ago.  What I couldn't disseminate
>was whether this was a useful tool or not.  It stated this version could
>only be used for development of database applications.  I interpret that
>as meaning you can't use it as a database.  And if you can't use it as a
>database, it's worthless unless you already have DB2 running.
>
>If anyone can clarify this I'd like to hear it.

It's useful.  The Personal Developer's Edition contains the full
database (which obviously it would have to if you expect to actually
develop anything).  The restriction is on the license.  I actually
bought the previous Personal Developer's Edition (for DB2 UDB 5.0),
which was expensive (although less expensive than the plain vanilla
Personal Edition), and had the same license restriction.  I guess IBM
decided that giving developers easy access to DB2 was more important
than trying to make serious money off of developers.  Good for them!

Incidentally, you can buy DB2 6.1 Personal Developer's Edition for $39
at Indelible Blue and get CDs for *all* supported platforms (OS/2,
Win9x/NT, and Linux).  IMO this makes more sense than trying to
download a free copy.
-- 
John Brock
jbrock@panix.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Panix (1:109/42)

+----------------------------------------------------------------------------+

From: Skree@stubble.jumpers                             03-Sep-99 01:14:22
  To: All                                               03-Sep-99 11:24:27
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: Skree@stubble.jumpers

In <37ce49a5$1$jzzbeebj$mr2ice@news.flash.net>, on 09/02/99 
   at 09:55 AM, bill.m@no.spam.net said:


Q}Is this the Canadian Governments definition of "Free Trade" between
Q}Canada, US, and Mexico? or does that only apply to corporate level and
Q}individuals still have a (Gov.) hand in their pockets?

Is there such a thing as a govt that doesn't have its hand it the
citizen's pockets.


NOOOOOOOO


-- 
-----------------------------------------------------------
Kenn Sunley
MR/2 ICE ver 1.60 reg'd
Date: 1999.09.03
Time: 01:14:44 - -0600

Warp 4
233Mhz PII
ATI Xpert@work
Gradd Rocks - thank you IBM
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: pandpATibm.net                                    03-Sep-99 08:56:15
  To: All                                               03-Sep-99 11:24:28
Subj: Re: DB2 (Personal Developers Edition) for FREE!

From: "Philip Nelson" <pandpATibm.net>

You can use it as a database (standalone) but not as a server (with remote
clients).

The purpose (I guess) is to encourage more people to develop DB2 applications
and / or gain DB2 skills, which should in turn lead to more sales of DB2
Workgroup and Enterprise Editions (i.e. the servers).

And even then, IBM's pricing structure is VERY favourable as compared to (for
example) the O word.

I love it - it lets me continue to run DB2 at home without any more expense
(I already had V5 PDE boxed set given me as a gift - it was certainly better
than the usual socks and handkerchiefs !!!).

Phil Nelson
(pandp@ibm.net)

On Thu, 02 Sep 1999 21:43:39 -0400, postmaster@127.0.0.1 wrote:

>In <5+Gz3kDg65cA090yn@ibm.net>, dcasey@ibm.net (Dan Casey) said:
>
>>Just got this in e-mail and thought I'd disseminate it here:
>
>>*************************************************************
>
>>Hi
>
>>I thought you all might be interested in the following:-
>
>>DOWNLOAD: Complimentary Copy of DB2 Universal
>>Database Version 6.1 Personal Developer's Edition
>
>> http://www6.software.ibm.com/dl/db2pde/db2pde-p/
>>>>SNIP<<<
>
>I saw this on IBM's site a couple weeks ago.  What I couldn't disseminate
>was whether this was a useful tool or not.  It stated this version could
>only be used for development of database applications.  I interpret that
>as meaning you can't use it as a database.  And if you can't use it as a
>database, it's worthless unless you already have DB2 running.
>
>If anyone can clarify this I'd like to hear it.
>
>David (d dot forrai at ieee dot org)
>(The FROM: address is for spammers only)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: cm@stardivision.de                                03-Sep-99 08:04:21
  To: All                                               03-Sep-99 11:24:28
Subj: Re: Deutsche Version der StarOffice-CD auch aus deutschen Landen?

From: Carsten =?ISO-8859-1?Q?Mller?= <cm@stardivision.de>

Hallo Andreas,

in Deinem Posting geht ein bichen was drunter und drber, ich will 
gerne versuchen, Aufklrung zu verschaffen:

> Die Frage ist: Woher bekomme ich die CD, ohne da zu den Kosten fr 
die CD
> ($9.90) noch ber 25 $ Versandkosten kommen? Gibt es irgendwo in 
Deutschland
> die Mglichkeit, die CD zu beziehen? Waren die 9.90 nicht eigentlich 
fr den
> Versand der freien Software? Auerdem drfte das Verpacken und 
Verschicken
> einer CD (Handbcher gibt es diesmal nicht - aber ich habe eh noch das 
von
> der 5.0) nicht 25 $ kosten...

Punkt 1: Woher in Deutschland beziehen? Die Antwort: 
http://www.stardivision.de oder http://www.sun.de. Bitte aber noch ein 
wenig gedulden, das wird gerade alles vorbereitet.

Punkt 2: ?Handbcher gibt es diesmal nicht?. Das ist nicht richtig. Es 
gibt StarOffice in drei Varianten: 1. Als kostenlose Download-Version, 
2. Auf CD-ROM fr 9,95 US$, 3. Auf CD-ROM inkl. gedrucktem Handbuch 
und zustzlichen Fonts und Cliparts zum Preis von 39,95 US$. Du 
sprichst von der zweiten Variante, es gibt aber auch die Variante 
inklusive Handbuch und diese kannst Du auch bereits jetzt schon ber 
www.stardivision.de bestellen.

Herzliche Gre

Carsten Mller




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Star Division GmbH, Hamburg, Germany (1:109/42)

+----------------------------------------------------------------------------+

From: marion@friko.onet.pl                              03-Sep-99 11:47:03
  To: All                                               03-Sep-99 11:24:28
Subj: OS2 app in text mode

From: "mario" <marion@friko.onet.pl>

HI!
I nedd an os2 text mode application to run one on windows NT. Please email
me: marion@friko.onet.pl
thanks
mario


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rolf@itea.ntnu.no                                 03-Sep-99 11:49:26
  To: All                                               03-Sep-99 11:24:28
Subj: commandline webmail

From: rolf@itea.ntnu.no

Hello

I  would like to check  my hotmail aaccounts which is web based from the
commandline.  Do anybody know about a practical way to do this (rexx??) or
if there exist  programs which do  it.

Rolf@itea.ntnu.no

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Norwegian university of science and technology (1:109/42)

+----------------------------------------------------------------------------+

From: jpedone_no_spam@flash.net                         03-Sep-99 11:15:08
  To: All                                               03-Sep-99 17:08:13
Subj: Re: Deutsche Version der StarOffice-CD auch aus deutschen Landen?

From: jpedone_no_spam@flash.net

In <37CEECAD.21F1CA54@ibm.net>, "Hans Andrieen" <andrie@ibm.net> writes:
>Andreas Ludwig schrieb:
>> 
>> Hallo!

>
>Hast du dich schon mal direkt an Stardivision in Hamburg gewandt?
>www.stardivision.de
>
>Die verkaufen es nach wie vor mit Buch.
>

No more - you get it from
http://www.sun.com/products/staroffice/get.html now.  The CD includes
all platforms for English and German.  You can download the other 
languages.

Kein weiteren- ihr bekommt es von
http://www.sun.com/products/staroffice/get.html jetzt.  Die CD schliet ein
alle Plattformen fr englische und deutsche.  Ihr knnt nachladen die ander 
Sprachen.


 
J. Pedone
jpedone@flash.net
http://www.flash.net/~jpedone
 
If you want it done right, forget Microsoft.
A)bort, R)etry or S)elf-destruct?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42)

+----------------------------------------------------------------------------+

From: isxios@dnaco.net                                  03-Sep-99 13:25:20
  To: All                                               03-Sep-99 17:08:13
Subj: Re: AOL Instant Messenger for OS/2 ????

From: isxios@dnaco.net (Isxios)

AOL IM for Java runs just fine here on Java 1.1.8 and ran just fine on
Java 1.1.7.

Isxios


On Fri, 3 Sep 1999 02:15:27, dagroe-nospam@messagehost.net (Dean Groe)
wrote:

> On Sat, 28 Aug 1999 00:10:48, donm@ftel.net (Don Morse) wrote:
> 
>  
> > is there a new Java version????  I'm running the olderclient here as
detailed
> > below, but I'd love to try a newer version
> > 
> Does this mean that you have AIM for Java running with 1.1.7? I have 
> been trying like crazy to make it fly, but no luck. I was hoping that 
> I would not have to download the 1.1.8 that is currently available. I 
> think that it is only the full JDK right now. All I need is a JVM. 
> 
> Every time I try to launch AIM Java, I get a tiny window that says log
> (login maybe?) that cannot be adjusted and in the Java screen is see 
> errors about invalid functions, or something like that. I do not have 
> it on this computer and do not have the messages written down. I just 
> assumed it was a lack of functionallity on the part of OS/2 Java 1.1.7
>  I do have other Java apps running OK. 
> 
> Dean
> 

Isxios

______________________________________________________________________
______________________________________
Athena grant you the strength to fight for what you believe in, and 
the wisdom to know when you are beaten.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: rdegenna@utk.edu                                  03-Sep-99 15:43:20
  To: All                                               03-Sep-99 19:57:18
Subj: Word Pro page numbers shouldn't be this hard!

From: rdegenna@utk.edu

I admit it.  I'm stumped by another easy one.  I want the first page of a 
document to have no page number, and the second page to be numbered 1.  I've 
tried page layouts, sections, etc but can't get it to work.  I either get a
number 
on the first page (which I don't want), or the second page is numbered 2
rather 
than 1, or I get no page numbers at all.  I'm using WordPro 1.1.

This can't be that hard ...

Ray

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Tennessee (1:109/42)

+----------------------------------------------------------------------------+

From: gregop@cstone.net                                 03-Sep-99 16:05:22
  To: All                                               03-Sep-99 19:57:18
Subj: Re: BOOTOS2 doesn't work for me!!!!! Help!!!!!

From: gregop@cstone.net

In message <NXbNN=xIM70fVlmpi39WO8tPebfz@4ax.com> - Juan I. Cahis
<jiclbch@ibm.net> writes:
:>
:>Dear Friends:
:>
:>I tried to generate a two diskette, bootable, minimum OS/2, using
:>BOOTOS2. The problem is that the product insists to include, in the
:>first diskette, a lot of drivers that are included in my main
:>CONFIG.SYS, that I don't need in an emergency diskette based OS/2.
:>Among them are my sound card drivers, PCMCIA drivers, etc. So, BOOTOS2
:>collapses when the first diskette becomes full.
:>
:>What can I do?
:>
:>
:>Thanks
:>Juan I. Cahis
:>Santiago de Chile (South America)
:>Email: jiclbch@ibm.net.nospam jiclbch@reuna.cl.nospam
:>To send me Email, please remove ".nospam" from my Email address
:>Note: Please forgive me for my bad English, I am trying to improve it!

If you note in the bootos2.doc, it tells you if you need to make a 2 diskette
version to add a parameter to the command line.  I had to do that and it works
fine.  I forgot the specific thing (since I've been doing a lot of
reinstalling and have had to do a lot), but the information is in the doc
file.  Took me a long time to finally rtfm (or at least rtfd) too.  :-)

Gregory    Team OS/2

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Cornerstone Networks - Pure Internet! (1:109/42)

+----------------------------------------------------------------------------+

From: jklewis@nospam.com                                03-Sep-99 10:56:14
  To: All                                               03-Sep-99 19:57:18
Subj: Re: Can't type in DOS box after 50 days

From: Jim Lewis <jklewis@nospam.com>

Joerg Tiemann wrote:

> On Tue, 31 Aug 1999 12:38:54 -0500, Jim Lewis <jklewis@nospam.com> wrote:
> >  Has anyone seen this problem? After about 50 days uptime my DOS
> > Windowed sessions do not allow any keys to be typed. The Num Lock and
> > Caps Lock lights don't even come on. This only happens in the DOS
> > Window, the rest of the machine is fine including DOS Full Screen
> > sessions. It doesn't matter if I open new DOS Windows or how I open
> > them. A reboot of course "fixes" this problem for another 50 days.
>
>   I have OS/2 2.1 installed on an old 386sx notebook. Current uptime is
> 123 days, no problem with DOS windows here. As for OS/2 Warp - well,
> never tried that 'protectonly=no' thingy! ;-)
>
> --
> tiemannj@gmx.de


  I must be doing something strange on both machines for this to be
happening only to me. My Memory Status app does have a kludge in it to get
around the uptime-at-49-days-wraparound bug but I can't imagine how that
could effect a DOS box. Too weird.

 You say your 2.1 box shows an uptime of 123 days? What program are you
using to get that info? Does 2.1 not have the uptime wrap bug?


--

Jim Lewis
Not speaking for IBM.
Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Network Computing Division (1:109/42)

+----------------------------------------------------------------------------+

From: jklewis@nospam.com                                03-Sep-99 11:11:01
  To: All                                               03-Sep-99 21:18:29
Subj: Re: Swap file

From: Jim Lewis <jklewis@nospam.com>

 I'm jumping into this discussion a bit late but I wanted to mention a
few things. First, on the early versions of Warp 3 and 4, when the
swapper started to grow it would grow forever due to some weird bug.
This may have been corrected in a fixpack, I am not sure. Most people
just set up a large swapper.dat as mentioned in other posts.

 I believe it really doesn't matter where you put the swap file on a
single drive system. Once OS/2 opens it it keeps it open, so you are not
going to gain anything based on where it is placed. On a multi-drive
system then the most used partition of the least used drive does hold
true.

 Of course, the most obvious solution to swap problems is to add more
ram, but even then you have to be careful. Some motherboards actually
run slower with more ram, so be sure to watch this. I haven't seen this
on any of my hardware but it has been reported in the Seti group several
times.


--

Jim Lewis
Not speaking for IBM.
Free OS/2 utilities and Java games - http://www.chauvet.com/jim.lewis



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Network Computing Division (1:109/42)

+----------------------------------------------------------------------------+

From: newbury@io.org                                    03-Sep-99 16:17:21
  To: All                                               03-Sep-99 21:18:29
Subj: Re: Was: Star Office 5.1 install - Canadian Source?

From: newbury@io.org (R. G. Newbury)

It very quickly reaches the point where getting a US P.O Box makes 
sense. And the USPost is open about 363 days a year (AFAIR, only July 
4 and Dec 25 closed, unlike CanPost).

Declare your purchase as your groceries......

P.S. I think that the feds collecting PST (or the provinciales 
collecting PST) at the border is unconstitutional. No 'sale' takes 
place within the province. And if the assertion is that it's because 
it is imported, customs is a federal regime (and the BNA act (sorry 
Constitution Act) has a specific proscription against 'customs' duties
between provinces.

Of course, arguing with a customs agent about not collecting money is 
kinda like arguing with city hall.......

Geoff 



On Thu, 2 Sep 1999 14:01:56, pasnak@delete.cableregina.com (J.P. 
Pasnak) wrote:

>
 
> 
> I thought there might be a way around this, but it seems Sun Canada is
> temporarily offline. (see below).  I wonder what the total cost would 
> be if I ordered 10 CDs from the states?  GST is something we have to 
> live with, but I wonder what other 'import' taxes Customs would add?
> 
Disclaimer: Unless explicitly mentioned otherwise, I speak for and 
have always spoken for the company I work for. I am the fool company I
work for.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ICAN.Net Customer (1:109/42)

+----------------------------------------------------------------------------+

+============================================================================+
