
                   comp.os.os2.setup.storage        (Usenet)

                 Saturday, 25-Dec-1999 to Friday, 31-Dec-1999

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     23-Dec-99 19:29:23
  To: All                                               26-Dec-99 03:26:28
Subj: Re: SCSI spindown?

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Wed, 22 Dec 1999 21:03:06 -0600 (CST), Steve McCrystal wrote:

->On Thu, 23 Dec 1999 00:56:47 +0000 (GMT), Trevor Hemsley wrote:
->
->> You should also be aware that I have read that some SCSI
->>drives are warranteed only for a certain number of powerdown/up cycles -
->>in the case of some of the IBM 10k rpm drives this is something like 180
->>spin down/up cycles!
->
->Not that I doubt you in the least, but is this 'feature' documented
anywhere?

If it is documented then it will be on the data sheet for the drives. The
IBM web site www.storage.ibm.com is fairly comprehensive in the data it
provides so if it _is_ documented then that'll be where to find it. Maybe
this is one of those web stories...


Trevor Hemsley, Brighton, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               23-Dec-99 15:21:13
  To: All                                               26-Dec-99 03:26:28
Subj: Re: Possible?IDE/SCSI with BootMgr

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Thu, 23 Dec 1999 14:36:10 GMT, skhalsa@my-deja.com wrote:

>I am currently running Boot Manager to boot to:
>Boot Manager          Primary
>Win31                 Primary
>Win95                 Primary
>OS/2 V3Con Blue Prod  Extended/Logical
>OS/2 V3 Red Maint     Extended/Logical
>
>   all on a 8.4GB EIDE
>
>I have a SCSI adapter currently running a Zip drive only.
>
>Would it be possible to add a SCSI hard drive, add Linux, say, and add
>that to Boot Manager?  Wouldn't the computer be booting first to the
>Boot manager as usual then be directed to the SCSI?
[snip]

Yes.  Boot Manager will load the boot sector of any drive that it can see.

I haven't booted OS/2 off the primary hard drive in over five years.


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@flashcom.net                23-Dec-99 17:44:21
  To: All                                               26-Dec-99 03:26:28
Subj: Re: Possible?IDE/SCSI with BootMgr

From: yyyc186.illegaltospam@flashcom.net

In <gunaalzrvfgrelnubbpbz.fn7n7q5.pminews@netnews.worldnet.att.net>, on
12/23/99 
   at 03:21 PM, "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>
said:

>On Thu, 23 Dec 1999 14:36:10 GMT, skhalsa@my-deja.com wrote:

>>I am currently running Boot Manager to boot to:
>>Boot Manager          Primary
>>Win31                 Primary
>>Win95                 Primary
>>OS/2 V3Con Blue Prod  Extended/Logical
>>OS/2 V3 Red Maint     Extended/Logical
>>
>>   all on a 8.4GB EIDE
>>
>>I have a SCSI adapter currently running a Zip drive only.
>>
>>Would it be possible to add a SCSI hard drive, add Linux, say, and add
>>that to Boot Manager?  Wouldn't the computer be booting first to the
>>Boot manager as usual then be directed to the SCSI?
>[snip]

>Yes.  Boot Manager will load the boot sector of any drive that it can
>see.

>I haven't booted OS/2 off the primary hard drive in over five years.

If boot manager could do this it would be quite a feat.  Normally boot
device is controlled by your system BIOS.  If IDE is enabled as the boot
controller in the BIOS I don't know how boot manager would be able to
tweak the BIOS and change to the SCSI controller for booting.

Roland



-- 
-----------------------------------------------------------
yyyc186.illegaltospam@flashcom.net              To Respond delete
".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: jrop@verso.st.jyu.fi                              24-Dec-99 01:28:07
  To: All                                               26-Dec-99 03:26:29
Subj: Re: Installing NT with OS/2

From: Janne Ropponen <jrop@verso.st.jyu.fi>

Hello,

WJ Cordts <nets202c@netins.net> wrote:

> Janne Ropponen wrote:
>> "STOP: c000021a (Fatal  System Error), Session manager
>> initialisation process terminated unexpectedly with a status
>> of 0x000003a"
>> 
>> error message after NT starts it's the boot process. No matter

> primary.  Current advice leaned toward installing and configuring the NT
> "bastard child" before working with "THE REAL OPERATING SYSTEM" - OS/2. 

That was what I tried first, but without luck.

> The drive was a blank 12+ Gig WD.  NT installed OK on a FAT16 C: drive
---<stuff snipped>---
> Partition (on a sliver just past 6 Gb) would work.  I proceeded to get
> OS/2 onto the Internet and to bravely snatch service pack 6 for NT V 4

I tried service pack 6 also after I finally got NT installed, but
NT would still crash after Boot Manager was activated.

> fine.  I certainly am thankful that OS/2 is such a strong and patient
> BIG BROTHER!!

I absolutely agree. And I thought OS/2 was hard to install (I had
some FDISK problems with OS/2's install some three years ag), but
that is nothing compared to this NT roulette!

Ok, I finally found out that it seems to be NT itself that messes
things up (surprise!). If I just set the Boot Manager partition
active, and then immediately change the NT boot partition active
again with ANY utility (including NT's own Disk Administrator), NT
won't boot the next time I turn on my computer. This happens
with two totally different computers. Weird. I'm suspecting the
MBR gets somehow corrupted (at least NT thinks so). 

I just downloaded a bunch of disk/MBR utilities from the Net 
and I'm going to try them. If those utils won't work, I'm going
to try adding OS/2 to NT's boot manager so that I don't have to
manually activate Boot MAnager at all and thus (hopefully) 
preventing NT's boot problems. I'll post of my results.

> 	I hope this account of my recent hair loss is of some use to you.

Well, at least it is comfort to know that I'm not the only 
one losing my sanity because of some M$ product. :) This whole
install circus just makes me wonder how Windows ever got so popular?


 - Janne

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Jyvaskyla, Finland (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               23-Dec-99 22:13:27
  To: All                                               26-Dec-99 03:26:29
Subj: Re: Possible?IDE/SCSI with BootMgr

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Thu, 23 Dec 1999 17:44:43 -0500, yyyc186.illegaltospam@flashcom.net
wrote:

>In <gunaalzrvfgrelnubbpbz.fn7n7q5.pminews@netnews.worldnet.att.net>, on
>12/23/99 
>   at 03:21 PM, "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>
>said:
>
>>On Thu, 23 Dec 1999 14:36:10 GMT, skhalsa@my-deja.com wrote:
>
>>>I am currently running Boot Manager to boot to:
>>>Boot Manager          Primary
>>>Win31                 Primary
>>>Win95                 Primary
>>>OS/2 V3Con Blue Prod  Extended/Logical
>>>OS/2 V3 Red Maint     Extended/Logical
>>>
>>>   all on a 8.4GB EIDE
>>>
>>>I have a SCSI adapter currently running a Zip drive only.
>>>
>>>Would it be possible to add a SCSI hard drive, add Linux, say, and add
>>>that to Boot Manager?  Wouldn't the computer be booting first to the
>>>Boot manager as usual then be directed to the SCSI?
>>[snip]
>
>>Yes.  Boot Manager will load the boot sector of any drive that it can
>>see.
>
>>I haven't booted OS/2 off the primary hard drive in over five years.
>
>If boot manager could do this it would be quite a feat.  Normally boot
>device is controlled by your system BIOS.  If IDE is enabled as the boot
>controller in the BIOS I don't know how boot manager would be able to
>tweak the BIOS and change to the SCSI controller for booting.

You're confused.

The BIOS boots the Boot Manager partition.  Boot Manager then loads the
boot sector code from whatever partition you choose from the list.  It
doesn't care what kind of partition it is, or which drive it's on. 


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     24-Dec-99 01:21:10
  To: All                                               26-Dec-99 03:26:29
Subj: Re: Possible?IDE/SCSI with BootMgr

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Thu, 23 Dec 1999 15:21:26 -0500 (EST), Mike Ruskai wrote:

->>Would it be possible to add a SCSI hard drive, add Linux, say, and add
->>that to Boot Manager?  Wouldn't the computer be booting first to the
->>Boot manager as usual then be directed to the SCSI?
->[snip]
->
->Yes.  Boot Manager will load the boot sector of any drive that it can see.

Booting off a SCSI attached hard disk requires that the controller have a
BIOS that loads and that you motherboard BIOS recognises that it exists
and supports INT 13 access to it. 

I suspect that it would _probably_ work but the proof is only to be found
by trying it out (boot from SCSI attached drive even with IDE in the
system when BM is on the IDE drive).


Trevor Hemsley, Brighton, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: Ted@see.my.sig                                    24-Dec-99 02:47:05
  To: All                                               26-Dec-99 03:26:29
Subj: CHKDSK "minor system error"

From: Ted@see.my.sig (No spam, please)

I just ran CHKDSK on my main Warp 3 partition. It said it had  "found
and corrected a minor system error," and then it "corrected a file
allocation error." I have run this about a dozen times and received
the same messages. Everything otherwise seems to be running correctly.
What could this be?
-----------------------------------------------------------
Non-Spam E-Mail: redbeard{AT}earthling{DOT}net
 Visit my Virtual Light Table: http://tmvlt.cjb.net
  Travel and Scenic Photography, Commentary, and more
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Ted@see.my.sig                                    23-Dec-99 18:53:07
  To: All                                               26-Dec-99 03:26:29
Subj: CHKDSK and "minor file system error"

From: Ted@see.my.sig

I just ran CHKDSK on my main Warp 3 bootable partition (from a 
maintenance partition). It displayed a message that it had "found and 
corrected a minor system error" and, later, that it had "corrected a 
file allocation error". I ran CHKDSK /F about a dozen times and 
received these messages each time. Everything else seems to be 
working. What could this be?

--
-----------------------------------------------------------
Ted's E-mail: redbeard{AT}earthling{DOT}net
Visit my Virtual Light Table--
       Scenic and travel photography: http://tmvlt.cjb.net
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: bobg.REMOVEME.@pics.com                           24-Dec-99 02:02:20
  To: All                                               26-Dec-99 03:26:29
Subj: Re: CHKDSK "minor system error"

From: Bob Germer <bobg.REMOVEME.@pics.com>

On <3862de11.729678@news.access1.net>, on 12/24/99 at 02:47 AM,
   Ted@see.my.sig (No spam, please) said:

> I just ran CHKDSK on my main Warp 3 partition. It said it had  "found
> and corrected a minor system error," and then it "corrected a file
> allocation error." I have run this about a dozen times and received the
> same messages. Everything otherwise seems to be running correctly. What
> could this be?
> -----------------------------------------------------------
> Non-Spam E-Mail: redbeard{AT}earthling{DOT}net
>  Visit my Virtual Light Table: http://tmvlt.cjb.net
>   Travel and Scenic Photography, Commentary, and more
> -----------------------------------------------------------

I assume you ran CHKDSK from either a Warp 4 partition or Warp 4
installation disks. This was a known bug discovered the day of release and
a replacement UPHFS.DLL was made available by IBM for download
immediately. It is a harmless error caused by a last minute change in the
drivers for ADP SCSI RAID controllers. --
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com
Proudly running OS/2 Warp 4.0 w/ FixPack 12
MR/2 Ice 2.01 Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    24-Dec-99 12:09:05
  To: All                                               26-Dec-99 03:26:29
Subj: Re: Possible?IDE/SCSI with BootMgr

From: dcasey@ibm.net (Dan Casey)

In article <gunaalzrvfgrelnubbpbz.fn86b60.pminews@netnews.worldnet.att.net>,
"Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net> wrote:
>>
>>If boot manager could do this it would be quite a feat.  Normally boot
>>device is controlled by your system BIOS.  If IDE is enabled as the boot
>>controller in the BIOS I don't know how boot manager would be able to
>>tweak the BIOS and change to the SCSI controller for booting.
>
>You're confused.
>
>The BIOS boots the Boot Manager partition.  Boot Manager then loads the
>boot sector code from whatever partition you choose from the list.  It
>doesn't care what kind of partition it is, or which drive it's on.

I think the mitigating factor here is that in order for Boot Manager
to start, the drive that it resides on must be handled by the system
BIOS. System BIOS boots to the IDE drive, and Boot Manager comes up.

In order to boot to the SCSI drive, the Onboard BIOS on the SCSI card
must be active (enabled).

If the System BIOS has SCSI as a Boot Option, it *might* be possible
to set the boot sequence, in the System BIOS to C:, SCSI, A:.

In theory, the system should then boot to Drive C: (IDE drive with
Boot Manager) even though the BIOS on the SCSI adapter is enabled to
allow booting from the SCSI drive.

Choosing the SCSI drive from Boot Manager should then, in theory)
allow you to boot Linux from the SCSI drive.

But I've never tried booting a system with both the IDE drives defined
in BIOS (necessary to boot from IDE) and the SCSI BIOS enabled to
allow boot from SCSI. It works the other way around (booting  OS/2
from a SCSI drive and *accessing* the IDE drive from OS/2 because OS/2
doesn't need the system BIOS to operate the IDE hard drive. Of course,
OS/2 needs to be fully booted in order to do this ... the IDE driver
(IBM1S506.ADD) needs to be installed to access the IDE drive.


--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               24-Dec-99 07:36:25
  To: All                                               26-Dec-99 03:26:29
Subj: Re: Possible?IDE/SCSI with BootMgr

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Fri, 24 Dec 1999 01:21:21 +0000 (GMT), Trevor Hemsley wrote:

>On Thu, 23 Dec 1999 15:21:26 -0500 (EST), Mike Ruskai wrote:
>
>->>Would it be possible to add a SCSI hard drive, add Linux, say, and add
>->>that to Boot Manager?  Wouldn't the computer be booting first to the
>->>Boot manager as usual then be directed to the SCSI?
>->[snip]
>->
>->Yes.  Boot Manager will load the boot sector of any drive that it can see.
>
>Booting off a SCSI attached hard disk requires that the controller have a
>BIOS that loads and that you motherboard BIOS recognises that it exists
>and supports INT 13 access to it. 

Which is another way of saying, "Boot Manager must be able to see it."

>I suspect that it would _probably_ work but the proof is only to be found
>by trying it out (boot from SCSI attached drive even with IDE in the
>system when BM is on the IDE drive).

There's no mystery here.  All worries about the BIOS being able to boot
from a SCSI drive are irrelevant.  If the SCSI controller has a BIOS, and
the Boot Manager partition is itself bootable from the system BIOS,
booting from the SCSI drive will present no problems.  The BIOS
restrictions still apply, of course, but FDISK won't let you add the
partition to the BM menu in the first place, if it violated those
restrictions.


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: play@thebeach                                     24-Dec-99 16:49:12
  To: All                                               26-Dec-99 03:27:00
Subj: Can't format Drive, beyond cylindar 1023 or above 2048MB...HELP!

From: play@thebeach (S. Sandler)


I have installed Fixpack 12 and all the latest drivers.  I have a 8.5 GB hard
drive and once I have set up OS/2 for 1GB, I can't format the rest of the
drive for useage.

FDISK works fine but it won't format.

The problem error I get is

partition exceeds 2048 MB or is beyond cylinder 1023

How do I format the thing?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: news.sk.sympatico.ca (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           24-Dec-99 17:15:13
  To: All                                               26-Dec-99 03:27:00
Subj: Re: Can't format Drive, beyond cylindar 1023 or above 2048MB...HELP!

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Fri, 24 Dec 1999 16:49:24, play@thebeach (S. Sandler) wrote:

> 
> 
> I have installed Fixpack 12 and all the latest drivers.  I have a 8.5 GB
hard
> drive and once I have set up OS/2 for 1GB, I can't format the rest of the
> drive for useage.
> 
> FDISK works fine but it won't format.
> 
> The problem error I get is
> 
> partition exceeds 2048 MB or is beyond cylinder 1023
> 
> How do I format the thing?

This sounds like you are trying to format the disk as a
FAT file system (which is limited to 2048 MB)

Try formatting as HPFS

FORMAT X: /FS:HPFS

Where X is your drive letter...

--

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: merlins@ibm.net                                   24-Dec-99 04:20:01
  To: All                                               26-Dec-99 03:27:00
Subj: Re: Possible?IDE/SCSI with BootMgr

From: Meinolf Sondermann <merlins@ibm.net>

Hello Roland,

yyyc186.illegaltospam@flashcom.net wrote:
> 
> In <gunaalzrvfgrelnubbpbz.fn7n7q5.pminews@netnews.worldnet.att.net>, on
> 12/23/99
>    at 03:21 PM, "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>
> said:
> 

[...]

> 
> >Yes.  Boot Manager will load the boot sector of any drive that it can
> >see.
> 
> >I haven't booted OS/2 off the primary hard drive in over five years.
> 
> If boot manager could do this it would be quite a feat.  Normally boot
> device is controlled by your system BIOS.  If IDE is enabled as the boot
> controller in the BIOS I don't know how boot manager would be able to
> tweak the BIOS and change to the SCSI controller for booting.
> 
> Roland
> 
> --
> -----------------------------------------------------------
> yyyc186.illegaltospam@flashcom.net              To Respond delete
".illegaltospam"
>                             MR/2 Internet Cruiser 1.52
>                             For a Microsoft free univers
> -----------------------------------------------------------


no BootManager would be able to activate a SCSI controller . If any BM
started of a IDE drive is able to see SCSI drives or not, depends on the
type of SCSI controller. If it has its own BIOS to extend the system BIOS ,
then the BM would see some (again it depends on the controller how many)
drives
and be able to start a system from them. If the controller has no BIOS, then
it could be initialized by either another controller of the same manufacturer
( rare case ) or in most cases only by the appropiate driver loaded by the OS.

Bye/2
Meinolf

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       24-Dec-99 10:57:23
  To: All                                               26-Dec-99 03:27:00
Subj: Re: SCSI spindown?

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

On Thu, 23 Dec 1999 00:56:47 +0000 (GMT), Trevor-Hemsley@dial.pipex.com wrote:
>On Wed, 22 Dec 1999 21:51:28 GMT, Chris H Lindley wrote:
>
>->Hi all,
>->
>->having just upgraded to an all SCSI setup, I'm troubled
>->by noise!!!!
>->
>->The two drives are IBM 18ES 9.1gig LVD and a Seagate/IBM 
>->XP32150WD non-LVD drive on a non-LVD Tekram 390f.
>->
>->How do I get the SCSI drives to spindown?
>
>Go to hobbes and search for disksleep (dsksl196.zip?). According to its
>readme it will spin down SCSI drives. I haven't used it but I've thought
>about it ;-) You should also be aware that I have read that some SCSI
>drives are warranteed only for a certain number of powerdown/up cycles -
>in the case of some of the IBM 10k rpm drives this is something like 180
>spin down/up cycles!

Hi Trevor,

I have tried this since my orginla post. It seems to lock
up the machine on loading. I'll try it again now I have more
time with the holiday season!!!!

On the other hand, I think I'm more inclined now to try to deaden
the noise, and keep the discs spinning. I assume the weight of evidence
is in favour of "constant speed = less wear".

Cheers
Chris

-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: chris@scotgate2.demon.co.uk                       24-Dec-99 10:54:25
  To: All                                               26-Dec-99 03:27:00
Subj: Re: SCSI spindown?

From: chris@scotgate2.demon.co.uk (Chris H Lindley)

On Thu, 23 Dec 1999 17:17:10 +0000, 
c.k.christacopoulos_removeme@dundee.ac.uk wrote:
>
>
>John Poltorak wrote:
>
>> >My personnal reaction is (all be it expensive) look about replacing the
>> >noisiest of the drives
>>
>> I'm sure Chris will love that suggestion  :-).........

Aaarghh!! I've only just got them:-(

>>
>> (in the past I removed a Seagate 1 Gb).  I have
>> >about 15 Scsi drives around me (in 3 pcs) I get more noise from the fans
>> >than anything else.
>

>On a different note, I had (still have 2 of 3) very clunky 2.1 Gb IBM disks.  
One failed, and the other two I can
>only trust for material I can afford to loose.  Excessive noise esp. in more
modern, egg. 18Gb disks is not right.

I did try to put some rubber washers around teh discs to try to 
mount them and remove excess vibration. This was removed sharpish
when somebody on the os2-uk mailing list mentioned that the discs
needed grounding (earthing) which in my stupidity I forgot about.

In putting the discs back as they should have been, I have 
inadvertently altered the mounting, and the discs, although still
noisy, do not create the same resonance in the floor and case and so
are much more tolerable!!

I did try the disksleep filter that somebody mentioned. The m/c
failed to bootup. It seemed to freeze when loading some device
driver or something! I will spend some more time on it later.


Cheers
Chris


-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
  Chris H. Lindley                                  Yorkshire, UK  
  chris@scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  
  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  
  Molecular Biology & OS/2               www.scotgate.demon.co.uk  
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: yyyc186.illegaltospam@flashcom.net                24-Dec-99 10:14:11
  To: All                                               26-Dec-99 03:27:00
Subj: Re: Possible?IDE/SCSI with BootMgr

From: yyyc186.illegaltospam@flashcom.net

In <gunaalzrvfgrelnubbpbz.fn86b60.pminews@netnews.worldnet.att.net>, on
12/23/99 
   at 10:13 PM, "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>
said:

>On Thu, 23 Dec 1999 17:44:43 -0500, yyyc186.illegaltospam@flashcom.net
>wrote:

>>In <gunaalzrvfgrelnubbpbz.fn7n7q5.pminews@netnews.worldnet.att.net>, on
>>12/23/99 
>>   at 03:21 PM, "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>
>>said:
>>
>>>On Thu, 23 Dec 1999 14:36:10 GMT, skhalsa@my-deja.com wrote:
>>
>>>>I am currently running Boot Manager to boot to:
>>>>Boot Manager          Primary
>>>>Win31                 Primary
>>>>Win95                 Primary
>>>>OS/2 V3Con Blue Prod  Extended/Logical
>>>>OS/2 V3 Red Maint     Extended/Logical
>>>>
>>>>   all on a 8.4GB EIDE
>>>>
>>>>I have a SCSI adapter currently running a Zip drive only.
>>>>
>>>>Would it be possible to add a SCSI hard drive, add Linux, say, and add
>>>>that to Boot Manager?  Wouldn't the computer be booting first to the
>>>>Boot manager as usual then be directed to the SCSI?
>>>[snip]
>>
>>>Yes.  Boot Manager will load the boot sector of any drive that it can
>>>see.
>>
>>>I haven't booted OS/2 off the primary hard drive in over five years.
>>
>>If boot manager could do this it would be quite a feat.  Normally boot
>>device is controlled by your system BIOS.  If IDE is enabled as the boot
>>controller in the BIOS I don't know how boot manager would be able to
>>tweak the BIOS and change to the SCSI controller for booting.

>You're confused.

>The BIOS boots the Boot Manager partition.  Boot Manager then loads the
>boot sector code from whatever partition you choose from the list.  It
>doesn't care what kind of partition it is, or which drive it's on. 

I understand it can run a partition from whatever drive on the current
primary controller, but can switch primary controllers from IDE to SCSI? 
I know system commander cannot do this.

Roland


-- 
-----------------------------------------------------------
yyyc186.illegaltospam@flashcom.net              To Respond delete
".illegaltospam"
                            MR/2 Internet Cruiser 1.52
                            For a Microsoft free univers
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: gwwilk@!nospam!inebraska.com                      24-Dec-99 16:09:05
  To: All                                               26-Dec-99 03:27:00
Subj: Re: Installing NT with OS/2

From: gwwilk@!nospam!inebraska.com (Gerald W. Wilkins)

On Fri, 24 Dec 1999 01:28:14, Janne Ropponen <jrop@verso.st.jyu.fi> 
wrote:

> WJ Cordts <nets202c@netins.net> wrote:
> 
> > Janne Ropponen wrote:
> >> "STOP: c000021a (Fatal  System Error), Session manager
> >> initialisation process terminated unexpectedly with a status
> >> of 0x000003a"
> >> 
> >> error message after NT starts it's the boot process. No matter
> 
> > primary.  Current advice leaned toward installing and configuring the NT
> > "bastard child" before working with "THE REAL OPERATING SYSTEM" - OS/2. 
> 
> That was what I tried first, but without luck.
> 
> > The drive was a blank 12+ Gig WD.  NT installed OK on a FAT16 C: drive
> ---<stuff snipped>---
> > Partition (on a sliver just past 6 Gb) would work.  I proceeded to get
> > OS/2 onto the Internet and to bravely snatch service pack 6 for NT V 4
> 
> I tried service pack 6 also after I finally got NT installed, but
> NT would still crash after Boot Manager was activated.
> 
> > fine.  I certainly am thankful that OS/2 is such a strong and patient
> > BIG BROTHER!!
> 
> I absolutely agree. And I thought OS/2 was hard to install (I had
> some FDISK problems with OS/2's install some three years ag), but
> that is nothing compared to this NT roulette!
> 
> Ok, I finally found out that it seems to be NT itself that messes
> things up (surprise!). If I just set the Boot Manager partition
> active, and then immediately change the NT boot partition active
> again with ANY utility (including NT's own Disk Administrator), NT
> won't boot the next time I turn on my computer. This happens
> with two totally different computers. Weird. I'm suspecting the
> MBR gets somehow corrupted (at least NT thinks so). 
> 
> I just downloaded a bunch of disk/MBR utilities from the Net 
> and I'm going to try them. If those utils won't work, I'm going
> to try adding OS/2 to NT's boot manager so that I don't have to
> manually activate Boot MAnager at all and thus (hopefully) 
> preventing NT's boot problems. I'll post of my results.
> 
> > 	I hope this account of my recent hair loss is of some use to you.
> 
> Well, at least it is comfort to know that I'm not the only 
> one losing my sanity because of some M$ product. :) This whole
> install circus just makes me wonder how Windows ever got so popular?
> 

Your problems have to do with OS/2 seeing the NTFS partition as an 
HPFS partition if you install OS/2 first and then NT.  If you install 
NT first, then OS/2's manipulation of the MBR kills NT when you 
install OS/2.

I've got four computers with Windows 98, Windows NT and/or Windows 
2000, OS/2 (up to three bootable installations on two of the 
computers), and various Linux installations including Mandrake/Redhat,
and/or SuSE, and/or Caldera OpenLinux *ALL* coexisting and booting.  
How is that possible?  When I first installed NT 4.0 a couple of years
ago I ran into the problems you're having.  I was able to use 
Partition Magic to *hide* all of NT's partitions from OS/2, and like 
magic my OS/2 partitions again became bootable.  But that was a very 
cumbersome solution that required multiple boots just to go from NT to
OS/2 and back again.

Then I found PowerBoot.  This little gem (and I have nothing 
whatsoever to do with the company that makes it, I'm sorry to say) 
allows transparent booting of multiple operating systems by 
selectively hiding various partitions as you direct, keeping track of 
a 'Boot Profile' for each bootable partition as you direct, and the 
assignment of OS/2 drive letters at boot time, among other things.  It
resides in the MBR, and the latest version, 3.010, can memorize your 
PowerBoot settings so that if you do need to run Partition Magic or 
some such again which overwrites the MBR you can just restore it 
rather than trying to remember what every partition is and whether 
it's hidden or not to boot whatever OS.

The url is:
http://www.blueskyinnovations.com/welcome.html

It costs $25, but it is the best investment I've ever made for 
transparently installing and maintaining what would otherwise be 
incompatible operating systems, namely OS/2 and WinNT.

Hope this helps,

Jerry 

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: peter.stahl@abc.se                                24-Dec-99 15:49:11
  To: All                                               26-Dec-99 03:27:00
Subj: Long filenames and mkisofs

From: Peter Stahl <peter.stahl@abc.se>

I have a lot of *.jpg pictures and showfiles for
PMView to view them automaticly.

Now am I trying to write all pictures to a CDRW.

I would like to rund these shows without first
copying them to the disk (600 MB of images).

The problem is that several of them has names
longer than 32 characters.

When I first create a .zip file PMView can't
run the showfiles,

Is there a way to copy the files to the CD
and keep the long names ?

I use mkisofs and cdrecord with a Yamaha CDW6416SX.

BTW anybody managed to fast blanking a RW CD in above
CDRecorder ?


 


Peter Stahl
peter.stahl@abc.se

-----------------------------------------------------------
Disclaimer: Any errors in spelling, tact or fact are
            transmission errors. This message trans-
            mitted on 100% recycled electrons and
            printed on 100% recyclable phosphor :-)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ABC-Klubben (1:109/42)

+----------------------------------------------------------------------------+

From: play@thebeach                                     25-Dec-99 04:16:13
  To: All                                               26-Dec-99 03:27:01
Subj: Re: Can't format Drive, beyond cylindar 1023 or above 2048MB...HELP!

From: play@thebeach (S. Sandler)

Yes true but what I also have to add is that I use a boot manager so C: is
OS/2 or when I have to, windoze.  I then want my other part of the HD 8.5 GB
so I can put my wordperfect, spreadsheets etc. on so they can be accessed by
both operating systems.

HPFS will work for OS/2 but windoze won't reconize it.  

Why is it then that under windoze, I can format the D: for 8.5 GB and it looks
great but OS/2 won't reconize the format or D:?


-This sounds like you are trying to format the disk as a
-FAT file system (which is limited to 2048 MB)
-
-Try formatting as HPFS
-
-FORMAT X: /FS:HPFS

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: news.sk.sympatico.ca (1:109/42)

+----------------------------------------------------------------------------+

From: judithr@primenet.com                              23-Dec-99 20:27:18
  To: All                                               26-Dec-99 03:27:01
Subj: Re: Installing NT with OS/2

From: judithr@primenet.com

 
I did manage to set NT up with OS/2 with a  new 10+GB HD.   OS/2 was
first to install, and I used Boot Manager.  
OS/2 went on D:, the first of the logical partitions. HPFS.  C: was
saved and FAT for NT. (Give it 500 MB or defrag utilities might not
work well).  OS/2 was fine, also made some other partitions, but
left everything over 8GB unpartitioned.  Specifically, with OS/2's
fdisk:
C: NT 500MB  FAT - primary
Boot Manager - also primary
D: Warp HPFS -360MB - Logical - as are all the rest
E: NT maintenance FAT 300MB
F: Warp maintenance HPFS 250MB
x: Linux boot partition 15MB
G: Warp Apps HPFS 
H: NT Apps. FAT
I:J:etc. : more partitions for storage and Linux
NT, and the two OS/2 partitions and Linux are on Boot Manager.  Not
the NT maintenance as that is a choice from the NT boot loader if NT
is chosen on Boot Manager.  Boot Manager seems to be able to handle
this very well. 

OS/2 was installed and working well with everything after H:
unpartitioned at the beginning.   Installed NT on C:, it disabled
Boot Manager but I used NT's Disk Admin. re-enable it when the
install was complete and rebooted and everything was working. Boot
Manager can then be marked active.  Boot Manager worked just fine. 
After adding fixpak 3 or 4 you can see the rest of the HD with NT.
Installing an NT maintenance partition will again disable Boot
Manager, but NT's DiskAdministrator will re-enable. The maintenance
partition will load from NT's loader on C:  It appears to have to do
that, cannot be a totally independent installation.  Not sure how
useful it is as a maintenance partition since it requires files on
C: 

Things might work differently if you put NT on an NTFS  partition. 
I tried that but re-did it as FAT because OS/2 antivirus program
needed to put things on C: and could not when C: was NTFS. 

The nice thing about using NT is that it reminds me why my main OS
is OS/2.  One of those nasty little nits in NT is not being able to
have transparent backgrounds on the text of desktop icons. Just
makes a decent desktop picture look really ugly. Then there is
the.... no.  No time for that. 



>WJ Cordts <nets202c@netins.net> wrote:

>> Janne Ropponen wrote:
>>> "STOP: c000021a (Fatal  System Error), Session manager
>>> initialisation process terminated unexpectedly with a status
>>> of 0x000003a"
>>> 
>>> error message after NT starts it's the boot process. No matter

>> primary.  Current advice leaned toward installing and configuring the NT
>> "bastard child" before working with "THE REAL OPERATING SYSTEM" - OS/2. 

>That was what I tried first, but without luck.

>> The drive was a blank 12+ Gig WD.  NT installed OK on a FAT16 C: drive
>---<stuff snipped>---
>> Partition (on a sliver just past 6 Gb) would work.  I proceeded to get
>> OS/2 onto the Internet and to bravely snatch service pack 6 for NT V 4

>I tried service pack 6 also after I finally got NT installed, but
>NT would still crash after Boot Manager was activated.

>> fine.  I certainly am thankful that OS/2 is such a strong and patient
>> BIG BROTHER!!

>I absolutely agree. And I thought OS/2 was hard to install (I had
>some FDISK problems with OS/2's install some three years ag), but
>that is nothing compared to this NT roulette!

>Ok, I finally found out that it seems to be NT itself that messes
>things up (surprise!). If I just set the Boot Manager partition
>active, and then immediately change the NT boot partition active
>again with ANY utility (including NT's own Disk Administrator), NT
>won't boot the next time I turn on my computer. This happens with
>two totally different computers. Weird. I'm suspecting the MBR gets
>somehow corrupted (at least NT thinks so). 

>I just downloaded a bunch of disk/MBR utilities from the Net  and
>I'm going to try them. If those utils won't work, I'm going to try
>adding OS/2 to NT's boot manager so that I don't have to manually
>activate Boot MAnager at all and thus (hopefully)  preventing NT's
>boot problems. I'll post of my results.

>> 	I hope this account of my recent hair loss is of some use to you.

>Well, at least it is comfort to know that I'm not the only  one
>losing my sanity because of some M$ product. :) This whole install
>circus just makes me wonder how Windows ever got so popular?


> - Janne


Judith Russell       
judithr@primenet.com                    
Saugus Web Coordinator
http://www.hart.k12.ca.us/saugus



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: billyrowe@usa.net                                 24-Dec-99 05:59:23
  To: All                                               26-Dec-99 03:27:01
Subj: Adding a new IDE drive slaved off the master

From: Billy Rowe <billyrowe@usa.net>

I am running Warp 3, I am attempting to add a 730M drive.

My system already has a 340M hard drive as the Master and I
have connected the new 730M drive as the slave by placing the
jumper on the new drive in the slave position.

I have configured the new drive in my bios, but when OS/2 boots
it doesn't create a new drive icon for the new drive.

I can go into the IBM netfinity system information tool that came with
OS/2 and see the new drive under the IDE subsystem
information.

My IBM1S506.add statement is as follows:

BASEDEV=IBM1S506.ADD /A:0 /U:0 /SMS /V

Any help will be appreciated!!!!


TIA,

Billy
billyrowe@usa.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: Ted@see.my.sig                                    25-Dec-99 01:09:07
  To: All                                               26-Dec-99 03:27:01
Subj: Re: CHKDSK "minor system error"

From: Ted@see.my.sig (No spam, please)

On Fri, 24 Dec 1999 02:02:41 -0500, Bob Germer
<bobg.REMOVEME.@pics.com> wrote:

>On <3862de11.729678@news.access1.net>, on 12/24/99 at 02:47 AM,
>   Ted@see.my.sig (No spam, please) said:
>
>> I just ran CHKDSK on my main Warp 3 partition. It said it had  "found
>> and corrected a minor system error," and then it "corrected a file
>> allocation error." I have run this about a dozen times and received the
>> same messages. Everything otherwise seems to be running correctly. What
>> could this be?

>I assume you ran CHKDSK from either a Warp 4 partition or Warp 4
>installation disks. This was a known bug discovered the day of release and
>a replacement UPHFS.DLL was made available by IBM for download
>immediately. It is a harmless error caused by a last minute change in the
>drivers for ADP SCSI RAID controllers. --

Actually, I'm running Warp 3, FP35. And I neglected to mention that
the partition in question is HPFS. 


-----------------------------------------------------------
Non-Spam E-Mail: redbeard{AT}earthling{DOT}net
 Visit my Virtual Light Table: http://tmvlt.cjb.net
  Travel and Scenic Photography, Commentary, and more
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           25-Dec-99 08:32:00
  To: All                                               26-Dec-99 03:27:01
Subj: Re: Can't format Drive, beyond cylindar 1023 or above 2048MB...HELP!

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Sat, 25 Dec 1999 04:16:27, play@thebeach (S. Sandler) wrote:

> Yes true but what I also have to add is that I use a boot manager so C: is
> OS/2 or when I have to, windoze.  I then want my other part of the HD 8.5 GB
> so I can put my wordperfect, spreadsheets etc. on so they can be accessed by
> both operating systems.
> 
> HPFS will work for OS/2 but windoze won't reconize it.  
> 
> Why is it then that under windoze, I can format the D: for 8.5 GB and it
looks
> great but OS/2 won't reconize the format or D:?
> 
> 

When you are formating with Windows 95/98 you are
using the FAT32 format for the partition. This is a
Windows 95/98 only format (not recognized by anyone else
including Windows NT).

Real FAT will only work with a maximum of 2048 MB
and this is the only native file system that is native to
both OS/2 and Windows.

The FAT32 format can be recognized by OS/2 if you install
one of the FAT32 IFS (file system drivers). There
are two that I know of. They are available at

http://hobbes.nmsu.edu

Do a search for FAT32 and you should be able to
find them. These are third party file system drivers
and are not included with Warp.

--

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: maxikins@os2bbs.com                               25-Dec-99 11:32:29
  To: All                                               26-Dec-99 03:27:01
Subj: Re: Adding a new IDE drive slaved off the master

From: maxikins@os2bbs.com (Mark Klebanoff)

When OS/2 boots up, does IBM1S506 recognize both drives?  You've used 
the /v (verbose) switch, so you've told the driver to print to the 
screen when it loads.

Are you sure that drive 1 is jumpered as a master, and not as an 'only
drive'?

On Fri, 24 Dec 1999 05:59:47, Billy Rowe <billyrowe@usa.net> wrote:

> I am running Warp 3, I am attempting to add a 730M drive.
> 
> My system already has a 340M hard drive as the Master and I
> have connected the new 730M drive as the slave by placing the
> jumper on the new drive in the slave position.
> 
> I have configured the new drive in my bios, but when OS/2 boots
> it doesn't create a new drive icon for the new drive.
> 
> I can go into the IBM netfinity system information tool that came with
> OS/2 and see the new drive under the IDE subsystem
> information.
> 
> My IBM1S506.add statement is as follows:
> 
> BASEDEV=IBM1S506.ADD /A:0 /U:0 /SMS /V
> 
> Any help will be appreciated!!!!
> 
> 
> TIA,
> 
> Billy
> billyrowe@usa.net
> 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               26-Dec-99 00:01:07
  To: All                                               26-Dec-99 05:19:04
Subj: Re: Can't format Drive, beyond cylindar 1023 or above 2048MB...HELP!

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Fri, 24 Dec 1999 16:49:24 GMT, S. Sandler wrote:

>
>I have installed Fixpack 12 and all the latest drivers.  I have a 8.5 GB hard
>drive and once I have set up OS/2 for 1GB, I can't format the rest of the
>drive for useage.
>
>FDISK works fine but it won't format.
>
>The problem error I get is
>
>partition exceeds 2048 MB or is beyond cylinder 1023
>
>How do I format the thing?

format /fs:hpfs

You cannot create a FAT partition larger than 2GB.  If you do not
explicitly specify HPFS as the filesystem to use, it will assume you mean
FAT, for compatibility reasons.

I recommend the /L switch, even though it will take a long time.  That
will find any bad sectors that might be on the drive.


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               25-Dec-99 23:59:20
  To: All                                               26-Dec-99 05:19:05
Subj: Re: Adding a new IDE drive slaved off the master

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Fri, 24 Dec 1999 05:59:47 GMT, Billy Rowe wrote:

>I am running Warp 3, I am attempting to add a 730M drive.
>
>My system already has a 340M hard drive as the Master and I
>have connected the new 730M drive as the slave by placing the
>jumper on the new drive in the slave position.
>
>I have configured the new drive in my bios, but when OS/2 boots
>it doesn't create a new drive icon for the new drive.
>
>I can go into the IBM netfinity system information tool that came with
>OS/2 and see the new drive under the IDE subsystem
>information.
>
>My IBM1S506.add statement is as follows:
>
>BASEDEV=IBM1S506.ADD /A:0 /U:0 /SMS /V
>
>Any help will be appreciated!!!!

The Drives folder is for logical drives, not physical drives.  Run FDISK,
and create partitions on the new drive.


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               26-Dec-99 00:07:11
  To: All                                               26-Dec-99 05:19:05
Subj: Re: Possible?IDE/SCSI with BootMgr

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Fri, 24 Dec 1999 12:09:10 GMT, Dan Casey wrote:

>In article <gunaalzrvfgrelnubbpbz.fn86b60.pminews@netnews.worldnet.att.net>,
>"Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net> wrote:
>>>
>>>If boot manager could do this it would be quite a feat.  Normally boot
>>>device is controlled by your system BIOS.  If IDE is enabled as the boot
>>>controller in the BIOS I don't know how boot manager would be able to
>>>tweak the BIOS and change to the SCSI controller for booting.
>>
>>You're confused.
>>
>>The BIOS boots the Boot Manager partition.  Boot Manager then loads the
>>boot sector code from whatever partition you choose from the list.  It
>>doesn't care what kind of partition it is, or which drive it's on.
>
>I think the mitigating factor here is that in order for Boot Manager
>to start, the drive that it resides on must be handled by the system
>BIOS. System BIOS boots to the IDE drive, and Boot Manager comes up.
>
>In order to boot to the SCSI drive, the Onboard BIOS on the SCSI card
>must be active (enabled).
>
>If the System BIOS has SCSI as a Boot Option, it *might* be possible
>to set the boot sequence, in the System BIOS to C:, SCSI, A:.
>
>In theory, the system should then boot to Drive C: (IDE drive with
>Boot Manager) even though the BIOS on the SCSI adapter is enabled to
>allow booting from the SCSI drive.
>
>Choosing the SCSI drive from Boot Manager should then, in theory)
>allow you to boot Linux from the SCSI drive.
>
>But I've never tried booting a system with both the IDE drives defined
>in BIOS (necessary to boot from IDE) and the SCSI BIOS enabled to
>allow boot from SCSI. It works the other way around (booting  OS/2
>from a SCSI drive and *accessing* the IDE drive from OS/2 because OS/2
>doesn't need the system BIOS to operate the IDE hard drive. Of course,
>OS/2 needs to be fully booted in order to do this ... the IDE driver
>(IBM1S506.ADD) needs to be installed to access the IDE drive.

You seem to understand what's required, but you also seem to have some
desire to overcomplicate the issue.

What the BIOS is or is not capable of booting from is quite irrelevant,
since it's already been established that BM already exists and functions
on the machine in question.

For BM to boot a partition, it's only necessary that the drive can be
accessed through an int13 call, as would be the case with any SCSI card
that has a BIOS.  The main BIOS can be completely ignorant of the fact
that SCSI even exists, so long as the extensions on the card make int13
work on any attached drives.

From then on, only the same int13 restrictions apply (256 tracks per
cylinder, 63 sectors per track, 1024 cylinders).


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               26-Dec-99 00:13:01
  To: All                                               26-Dec-99 05:19:05
Subj: Re: Possible?IDE/SCSI with BootMgr

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Fri, 24 Dec 1999 10:14:23 -0500, yyyc186.illegaltospam@flashcom.net
wrote:

>In <gunaalzrvfgrelnubbpbz.fn86b60.pminews@netnews.worldnet.att.net>, on
>12/23/99 

[snip]

>>>>Yes.  Boot Manager will load the boot sector of any drive that it can
>>>>see.
>>>
>>>>I haven't booted OS/2 off the primary hard drive in over five years.
>>>
>>>If boot manager could do this it would be quite a feat.  Normally boot
>>>device is controlled by your system BIOS.  If IDE is enabled as the boot
>>>controller in the BIOS I don't know how boot manager would be able to
>>>tweak the BIOS and change to the SCSI controller for booting.
>
>>You're confused.
>
>>The BIOS boots the Boot Manager partition.  Boot Manager then loads the
>>boot sector code from whatever partition you choose from the list.  It
>>doesn't care what kind of partition it is, or which drive it's on. 
>
>I understand it can run a partition from whatever drive on the current
>primary controller, but can switch primary controllers from IDE to SCSI? 
>I know system commander cannot do this.

Your understanding is incomplete.  Boot Manager will load the boot sector
(that means pass execution control to the boot code contained therein)
from any partition on any drive which can be read using the int13 BIOS
interface.

Which controller the drive is attached to is entirely irrelevant, provided
either the main BIOS or the controller in question provides int13 access
to the drive.

My OS/2 boot partition is drive G:, which is the third partition on the
second physical drive.  It has been booting off of my second physical
drive for over five years (a game loading program called "Win95" resides
on the first physical drive, and part of the second).


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    26-Dec-99 11:53:00
  To: All                                               26-Dec-99 10:27:15
Subj: Re: Possible?IDE/SCSI with BootMgr

From: dcasey@ibm.net (Dan Casey)

In article <gunaalzrvfgrelnubbpbz.fnc0wb3.pminews@netnews.worldnet.att.net>,
"Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net> wrote:
>
>You seem to understand what's required, but you also seem to have some
>desire to overcomplicate the issue.
>
>What the BIOS is or is not capable of booting from is quite irrelevant,
>since it's already been established that BM already exists and functions
>on the machine in question.
>
>For BM to boot a partition, it's only necessary that the drive can be
>accessed through an int13 call, as would be the case with any SCSI card
>that has a BIOS.  The main BIOS can be completely ignorant of the fact
>that SCSI even exists, so long as the extensions on the card make int13
>work on any attached drives.
>
>From then on, only the same int13 restrictions apply (256 tracks per
>cylinder, 63 sectors per track, 1024 cylinders).

In effect, then, (if I were attempting this setup), I'd have the IDE
drives configured in System BIOS and the BIOS on the SCSI card
enabled. The Master IDE drive on the Primary port would be the first
drive that attempted to boot, and BM would come up. As long as the
SCSI drive is added to the BM menu selection, I can boot to it?

If this is correct, what problems am I likely to run into by enabling
boot from IDE and enabling the SCSI BIOS together?
(I once had a system booting and running off IDE drives, with a SCSI
card installed for a Scanner ... when the floppy port died on the MB,
I enabled the SCSI BIOS to use the floppy port on that card. The
system refused to boot until I disabled the SCSI BIOS, and the floppy
port wouldn't work without the BIOS enabled).



--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: mcmorran@norfolk.infi.net                         26-Dec-99 17:59:18
  To: All                                               26-Dec-99 21:26:25
Subj: Re: Long filenames and mkisofs

From: mcmorran@norfolk.infi.net (Peter McMorran)

In <84017h$52j$1@oden.abc.se>, on 12/24/99 
   at 03:49 PM, Peter Stahl <peter.stahl@abc.se> said:

>I have a lot of *.jpg pictures and showfiles for
>PMView to view them automaticly.

<snip>

>The problem is that several of them has names
>longer than 32 characters.
>Is there a way to copy the files to the CD
>and keep the long names ?

>I use mkisofs and cdrecord with a Yamaha CDW6416SX.

>BTW anybody managed to fast blanking a RW CD in above CDRecorder
>?

Hi, Peter,

Add -J ( for Joliet) to the mkisofs command line and you can
preserve up to 64-character filenames in the Joliet extension.
This can be read by the current OS/2 cdfs filesystem. Believe
that's the max right now for filenames on CD.

Cheers,
Peter

-- 
-----------------------------------------------------------
mcmorran@norfolk.infi.net (Peter McMorran)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: bogus.due2UCE@atlantic.net                        26-Dec-99 18:33:24
  To: All                                               26-Dec-99 21:26:25
Subj: Re: IDE/SCSI with BM, OS/2, & WinDOS

From: Felix Miata <bogus.due2UCE@atlantic.net>

Dan Casey wrote:

> In article <gunaalzrvfgrelnubbpbz.fnc0wb3.pminews@netnews.worldnet.att.net>,

> "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net> wrote:

> >You seem to understand what's required, but you also seem to have some
> >desire to overcomplicate the issue.

> >What the BIOS is or is not capable of booting from is quite irrelevant,
> >since it's already been established that BM already exists and functions
> >on the machine in question.

> >For BM to boot a partition, it's only necessary that the drive can be
> >accessed through an int13 call, as would be the case with any SCSI card
> >that has a BIOS.  The main BIOS can be completely ignorant of the fact
> >that SCSI even exists, so long as the extensions on the card make int13
> >work on any attached drives.

> >From then on, only the same int13 restrictions apply (256 tracks per
> >cylinder, 63 sectors per track, 1024 cylinders).
 
> In effect, then, (if I were attempting this setup), I'd have the IDE
> drives configured in System BIOS and the BIOS on the SCSI card
> enabled. The Master IDE drive on the Primary port would be the first
> drive that attempted to boot, and BM would come up. As long as the
> SCSI drive is added to the BM menu selection, I can boot to it?
 
> If this is correct, what problems am I likely to run into by enabling
> boot from IDE and enabling the SCSI BIOS together?
> (I once had a system booting and running off IDE drives, with a SCSI
> card installed for a Scanner ... when the floppy port died on the MB,
> I enabled the SCSI BIOS to use the floppy port on that card. The
> system refused to boot until I disabled the SCSI BIOS, and the floppy
> port wouldn't work without the BIOS enabled).
 
This thread has been messin' with my brain. Maybe what I'm missing has
to with the fact that I've never used anything made by Adaptec, limiting
myself mostly to HBA's that use NCR/Symbios/LSILogic chips.

With ALL the SCSI cards I've used, the SCSI BIOS decides completely on
its own whether it needs to be installed/enabled. If there are no ATA
HD's and no SCSI HD's, the BIOS flashes a message at boot "no SCSI hard
disks found, 'Yada' BIOS not installed" (or the like), and the system
BIOS proceeds to request a bootable floppy if one is not present.

If there is a bootable ATA HD, and the BIOS boot sequence is standard,
the system proceeds to boot it; whether any HD message flashes first
depends on the BIOS setting, if there is one to determine whether there
should be one. 

If there is a bootable SCSI HD, and no ATA HD, the SCSI BIOS displays
its installation message, the key sequence for the built-in SCSI
configuration program if it has one, and then the descriptive
information about the SCSI devices found; after which the system boots
from SCSI.

If there are both bootable ATA and SCSI hard disks, what happens next
depends on the system BIOS. WIth a newer BIOS, a full complement of
mixes of booting from SCSI or A: or CD or ATA or LS-120 or a network is
available. The choice of setting determines what gets booted from. With
an older BIOS, it may be impossible to boot from SCSI at all with any
ATA disk present. With others, the ATA interface must be enabled while
the BIOS is set to no HD's installed to boot from SCSI, but if that
option is used, there will be no access to the ATA disk unless the OS
booted uses a driver to locate and access any ATA drives physically
present (eg OS/2).

I took the opportunity of building my sister a new system to do
additional testing on the thread subject. With one of my spare but
recent systems with a Symbios 53c875 SCSI HBA and a functional SCSI Warp
4 Boot Manager bootable logical drive installation, I installed her new
20 Gb ATA drive. To do so I first unpowered all the SCSI HD's, since
neither FDISK nor Partition Magic v3 will install BM on any drive if it
finds BM already present on any other drive. Then I used PC DOS 7 and
Partition Magic to install BM.

Next I tried to use PM to create a maximum size FAT C:, but I wasn't
sure whether selecting the wrong number would leave me with a FAT32
partition instead, so I exited PM and used DOS FDISK to create a maximum
size FAT C: instead. Then I did a DOS FORMAT /S, followed by restarting
PM to put C: into the BM menu.

After testing for a successful DOS C: boot, I shut down and repowered
the bootable SCSI disk. On startup I entered the BIOS to select the
"SCSI, then A:, then IDE" boot sequence. On boot, the SCSI copy of BM
gave me the usual selection of choices available on the SCSI HD. I chose
my "maintenance" HPFS C: TSHELL partition to boot from. I edited
CONFIG.SYS to activate IBM1S506.ADD (1999/07/12). Then I rebooted again
and started up PM. I created an 18 Gb extended partition on the ATA
drive, then a one cylinder dummy logical at the beginning of the
extended. Next I created two FAT partitions matching the size of the 2Gb
primary.

Next I created a 1 Gb logical HPFS and rebooted once again. I then did
XCOPY /h/o/t/s/e/r/v from HPFS C: to the new HPFS ATA drive, followed by
SYSINSTX from C:. Then I had to edit CONFIG.SYS on the new HPFS
partition to place IBM1S506.ADD before SYM8XX.ADD.

Next I shut down, unpowered the SCSI HD, and booted DOS to again run PM,
this to assure that the correct BM acquired the two bootable ATA
partitions to select from. Then I booted once more, only to find BM was
assigning the wrong drive letter, F:, to what should be G:. I shut down
and selected OS/2 on reboot, with OS/2 dutifully reporting "the system
is unable to access . . . the system is stopped . . . correct the error
. . .". Next I did my first OS/2 maintenance diskettes boot of the day
to run OS/2 FDISK to fix the drive letters in BM. I then rebooted and BM
was fixed, so I proceeded to boot successfully to G:.

Next I fired up PM once again to try to devote the rest of the extended
partition to FAT32. No go. It wouldn't let me into the space beyond 8 Gb
with FAT, and didn't offer an explicit FAT32 option. I shut down OS/2
and booted DOS. DOS PM gave me the same problem. I then booted a WinDOS
7.x floppy. PM still wouldn't let me have a 12 Gb FAT32. I then tried M$
FDISK, but it *also* refused to give me a 12 Gb FAT32 option.

I was sure I knew why, so next I fired up the PM partition table editor
and changed the extended partition type from 05h to 0Eh. On rebooting
WinDOS, FDISK told me something was different. When I asked it to create
a logical drive, it took *much* longer to verify the available space,
and then gave me the desired 12 Gb logical partition. On exit I
formatted the new G: FAT32 and took the opportunity to SYS C: with
WinDOS.

I expected what happened next. On reboot, OS/2 was missing from BM. G:
was now the FAT32 drive. Again I started the partition table editor,
this time changing from 0Eh to 05h. On reboot, OS/2 remained missing
from BM, so I again started PM, and added OS/2 back to BM. On next boot,
BM was back where it needed to be. I selected OS/2 and installed Henk's
FAT32 for OS/2 drivers.

Next boot gave me an OS/2 boot error message scrolling off the screen
without being able to read it. There resulted no accessible FAT32
partition. I had to hunt down PAUSE.SYS to install into CONFIG.SYS to
learn I had botched an input parameter on one of Henk's drivers. That
fixed, the next boot produced OS/2 access to FAT32.

FWIW: To this point, I've written about my *first ever* experiences
creating three things: 1- any HD installation of >8 Gb per disk; 2- a
new FAT32 partition; and, 3- OS/2 access to FAT32. Heretofore, I've
never even touched any system with both OS/2 and FAT32 installed. Even
the biggest HD was been a "mere" 4 Gb.


Back to the original thread subject:

Next was to shutdown to restore SCSI HD power. Next followed several
unintended reboots, as I forgot to remove the one cylinder placeholder
partition and the ATA OS/2 G: partition had the wrong drive assignment.
To fix it, I changed the BIOS to boot first from SCSI. I used the SCSI
maintenance C: to run PM to delete the placeholder partition, but I
forgot to use FDISK to exit OS/2 by setting the FAT primary to C:. When
I exited to change BIOS back to boot IDE before SCSI, the primary on
SCSI was missing for a DOS ATA boot, which somehow mixed up BM with the
second copy on the second drive. Attempting IDE reboot brought up OS/2
at F: again, so I had to go back to SCSI boot and run OS/2 FDISK to set
the FAT primary as C:, which fixed the incorrect BM assignment for the
ATA BM.

Now, with BIOS back to ATA before SCSI boot, BM comes up correctly with
ATA OS/2 as bootable G:. BM also shows the SCSI OS/2 partition, but that
isn't bootable because it is an F: installation that doesn't work as I:
as assigned with the ATA boot. ;-) Booting C: assigns the FAT32
partition G:. Booting HPFS G: assigns the FAT32 partition K:.

Switching BIOS to SCSI before ATA boot, BM comes up correctly with SCSI
PC DOS 7 C:, SCSI HPFS F:, and ATA HPFS J:. As long as I remember
beforehand to switch this last choice's CONFIG.SYS to a version that
substitutes "J" for each instance of "G", it boots fine from the SCSI
BM, and the FAT32 partition still gets the K: assignment because I've
installed the OS/2 FAT32 ADD as the last ADD in CONFIG.SYS.

So, get everything right, which is no small task, and you can mix OS/2
and SCSI and WinDOS and ATA in the same machine and have it all work.
With the right choice of hardware, the only SCSI issues are: 1- boot
order selection in the system BIOS; and, 2- making sure the SCSI and ATA
ADD drivers are in the right postition in relation to each other within
CONFIG.SYS after copying partitions between drive types.

Here's a summary of the ultimate physical partitions seen in the above
narrative:

20 Gb ATA
1- Boot Manager (from PM v3.05)
2- 2 Gb FAT16 primary (WinDOS) bootable
3- (Extended)
4- 7 Mb (1 cylinder) freespace
5- 2 Gb FAT16 logical
6- 2 Gb FAT16 logical
7- 1 Gb HPFS logical bootable
8- 12 Gb FAT32

4 Gb SCSI
1- 1/2 Gb FAT16 primary (PC DOS 7) bootable
2- (Extended)
3- ~300 Mb freespace
4- 1/4 Gb FAT16 logical
5- 800 Mb HPFS logical bootable
6- 1.6 Gb HPFS logical
7- ~700 Mb freespace (IIRC)
8- 94 Mb HPFS primary bootable
9- Boot Manager (from PM v3.05)
-- 
He who despises his neighbor sins, but blessed is he who is kind to the
needy.                Proverbs 14:3 NKJV

 Team OS/2

Felix Miata  ***  http://mrmazda.members.atlantic.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://www.mcsr.olemiss.edu/~mudws/font.html (1:109/42)

+----------------------------------------------------------------------------+

From: jrop@verso.st.jyu.fi                              27-Dec-99 00:38:25
  To: All                                               26-Dec-99 21:26:25
Subj: Re: Installing NT with OS/2

From: Janne Ropponen <jrop@verso.st.jyu.fi>

Hello all,

I _finally_ got NT to install almost the way I wanted it and
preserving the drive letters in OS/2. Thank you all for your
help.

Here's how I made it (I really should learn to write more 
concisely):

At first I thought of installing NT on my 9 GB hard drive, but
apparently NT's install has a bug which prevents installing it
above 2 GB without a patch (which can be found from
http://www.masterbooter.com/program/ntfix.zip) what is exactly
what I tried to do originally. As I'm out of town for the
holidays, I grabbed the "old" 6.5 GB disk with me and I've been
trying to install NT on it. The disks on the computer I'm 
working with now (not exactly the same as on my other computer,
but the same thing _should_ work) are partitioned this
way:

Primary Master (6.5 GB)
 -0.5 GB (Primary, DOS boot, FAT, c:)
 -3.0 GB (Primary, NT boot & data, NTFS, c:)
 -1.5 GB (Logical, DOS data, FAT, d:)
 -1.5 GB (Logical, OS/2 boot, HPFS, e:)
 -Boot Manager (dos,NT,os/2)
Primary Slave (2.5 GB)
 -2.5 GB (Logical, OS/2 data, HPFS, f:)
Secondary Master (ZIP, g:)
Secondary Slave (CD-ROM, h:)

The drive letters are as OS/2 sees them. I had everything else
installed before I started installing NT. Before starting the
actual install, I marked the NT primary partition as active
with OS/2's FDISK and added the NT partition to Boot Manager. 
Then I started the NT install, which  disabled Boot Manager. 
Immediately, during the first boot after the install diskettes, 
I threw in a DOS boot floppy and  activated Boot Manager again. 
Then I rebooted and chose NT from the Boot Manager (which showed 
the DOS boot partition as hidden) and NT installed just fine
and kept on working ever since, because I didn't have to
use fdisk or Disk Administrator anymore to activate anything.

Now I can straight to DOS, NT and OS/2 with Boot Manager. The
only downside is that NT can't see the DOS primary partition
and OS/2 sees  only the NT partition, which it can't access,
if I boot straight from NT to OS/2 without activating the DOS
partition first. However, this is not a problem for me, because
I rarely use the first DOS partition from OS/2 anyway.

Ok. The two mistakes I made when first installing NT were:

1) I didn't mark the NT primary partition active BEFORE I
started the NT install program. It would install fine, boot
fine, but when the time came to reactivate Boot Manager, NT
wouldn't boot anymore (don't ask me why). The funny thing
was that NT could see and access both the DOS and NT 
primary partitions simultaneously when I installed NT this way.

2) I followed the install program's instructions and let it
disable my Boot Manager. I should have reactivated it manually
right after the first boot in the first place.

Well, now it works and I can finally get on using my OS/2 as
before. :) What is still left to do is to install NT the same
way on my other computer with the 9 GB/20 GB disk configuration
and multiple boots for DOS/NT/OS2/BeOS. Well, I don't expect
it to be too much of a problem now that I know what went 
wrong in the first place. 

Thanks again for all your tips!


- Janne


PS. I _WON'T_ bore you anymore by telling what happened after 
I applied NT Service Pack 6, and NT screwed up my drive 
lettering when it happily decided that my ZIP drive must be at 
letter F: and nothing else.



Janne Ropponen <jrop@verso.st.jyu.fi> wrote:

> I currently have Warp 4 (FP12), DOS and BeOS installed on two disks
> with the following configuration (the drive letters refer to how
> OS/2 sees them):

> Primary Master (6.5 GB):
>  -   boot manager
>  -c: 1 GB FAT (DOS boot)
>  -d: 2 GB FAT
>  -   2 GB BeOS
>  -e: 1.5 GB HPFS (OS/2 boot)
> Secondary Master (9 GB):
>  -f: 9 GB HPFS (data)
> Primary Slave (ZIP-100) g:
> Secondary Slave (CD-ROM) h:
> SCSI: (CD-R/W) i:

> I bought a new 20 GB disk and I'd like to replace the 6.5 GB one with
> the 9 GB and use the new 20 GB disk to replace the former 9 GB one.
> I also have to install NT 4.0 on the 9 GB disk.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Jyvaskyla, Finland (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               26-Dec-99 22:16:25
  To: All                                               27-Dec-99 11:16:04
Subj: Re: Possible?IDE/SCSI with BootMgr

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Sun, 26 Dec 1999 11:53:00 GMT, Dan Casey wrote:

>In article <gunaalzrvfgrelnubbpbz.fnc0wb3.pminews@netnews.worldnet.att.net>,
>"Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net> wrote:
>>
>>You seem to understand what's required, but you also seem to have some
>>desire to overcomplicate the issue.
>>
>>What the BIOS is or is not capable of booting from is quite irrelevant,
>>since it's already been established that BM already exists and functions
>>on the machine in question.
>>
>>For BM to boot a partition, it's only necessary that the drive can be
>>accessed through an int13 call, as would be the case with any SCSI card
>>that has a BIOS.  The main BIOS can be completely ignorant of the fact
>>that SCSI even exists, so long as the extensions on the card make int13
>>work on any attached drives.
>>
>>From then on, only the same int13 restrictions apply (256 tracks per
>>cylinder, 63 sectors per track, 1024 cylinders).
>
>In effect, then, (if I were attempting this setup), I'd have the IDE
>drives configured in System BIOS and the BIOS on the SCSI card
>enabled. The Master IDE drive on the Primary port would be the first
>drive that attempted to boot, and BM would come up. As long as the
>SCSI drive is added to the BM menu selection, I can boot to it?

Yes.

>If this is correct, what problems am I likely to run into by enabling
>boot from IDE and enabling the SCSI BIOS together?
>(I once had a system booting and running off IDE drives, with a SCSI
>card installed for a Scanner ... when the floppy port died on the MB,
>I enabled the SCSI BIOS to use the floppy port on that card. The
>system refused to boot until I disabled the SCSI BIOS, and the floppy
>port wouldn't work without the BIOS enabled).

You probably had a port address conflict.  SCSI cards have BIOS
extensions, not replacements.  There should be no conflict, provided you
don't take the port address of another adapter.


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: ek332@columbia.edu                                27-Dec-99 10:27:10
  To: All                                               27-Dec-99 14:32:17
Subj: Re: HPFS and NTFS drivers?

From: Eyal Kattan <ek332@columbia.edu>

This is a multi-part message in MIME format.
--------------2405F0D4898EDCC0D395D3FD
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit

Thanks, but this seem to not be working. It hangs when trying to load the
vfat-os2.ifs driver.
Any hints ?

Thanks,

Eyal

Vlad Berditchevskiy wrote:

> On Tue, 7 Dec 1999 16:30:34, Eyal Kattan <ek332@columbia.edu> wrote:
>
> > Is there an IFS driver for OS/2 to read or read/write from/to NTFS ? where
> > can it be found ?
>
> There is a VFAT IFS driver which should also support NTFS in read only
> mode. It can be found here:
> http://www.dsteiner.com/products/software/os2/vfat.htm
>
> Unfortunately this driver does not seem to work on WSeB because of LVM.
> :-( If anyone knows the solution, please let me know!
>
> --
> cul8r_______________________________________________________________
>                                         e-mail: vlad@mail.netwave.de
> \  /                                            vlad@tzi.org
>  \/lad                                  fido:   2:2426/3190.26

--------------2405F0D4898EDCC0D395D3FD
Content-Type: text/x-vcard; charset=us-ascii;
 name="ek332.vcf"
Content-Transfer-Encoding: 7bit
Content-Description: Card for Eyal Kattan
Content-Disposition: attachment;
 filename="ek332.vcf"

begin:vcard 
n:Kattan;Eyal
x-mozilla-html:FALSE
org:Columbia University
version:2.1
email;internet:ek332@columbia.edu
adr;quoted-printable:;;475 Riverside Drive=0D=0ASuite 522;New
York;NY;10115;USA
x-mozilla-cpt:;0
tel;work:(212) 870-3582
fn:Eyal Kattan
end:vcard

--------------2405F0D4898EDCC0D395D3FD--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Columbia University (1:109/42)

+----------------------------------------------------------------------------+

From: peterh@nautixsystems.com                          27-Dec-99 19:43:14
  To: All                                               27-Dec-99 22:22:29
Subj: Warp4 4GB IDE Install Problem

From: Peter Hollenbeck <peterh@nautixsystems.com>

Get a message like "Not enough space to install networking".
The drive is a Seagate 4110MB.
Install disk 1 has:
   ibm1s506.add  date 7/12/99   size 55658
   os2dasd.dmd   date 5/03/99   size 40876
Line 1 of config.sys on Install disk 1 is "set copyfromfloppy=1"

With the partition set to 4094MB (instead of 4110MB) the install works.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nautix Systems LLC (1:109/42)

+----------------------------------------------------------------------------+

From: lsunley@mb.sympatico.ca                           27-Dec-99 21:06:25
  To: All                                               27-Dec-99 22:22:29
Subj: Re: Warp4 4GB IDE Install Problem

From: lsunley@mb.sympatico.ca (Lorne Sunley)

On Mon, 27 Dec 1999 19:43:28, Peter Hollenbeck 
<peterh@nautixsystems.com> wrote:

> Get a message like "Not enough space to install networking".
> The drive is a Seagate 4110MB.
> Install disk 1 has:
>    ibm1s506.add  date 7/12/99   size 55658
>    os2dasd.dmd   date 5/03/99   size 40876
> Line 1 of config.sys on Install disk 1 is "set copyfromfloppy=1"
> 
> With the partition set to 4094MB (instead of 4110MB) the install works.

Sounds like a bug in the network installation code.

I usually reserve a 500 MB to 1000 MB partition for
the OS install, so I've never seen the problem.
(that's a lot of help isn't it :-)))

--

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: fo7y029@public.uni-hamburg.de                     27-Dec-99 23:06:13
  To: "comp.os.os2.setup.storage@list.d..               27-Dec-99 22:22:29
Subj: Re: PCMCIA Card for USB Zip 250 Drive

To: "comp.os.os2.setup.storage@list.deja.com" 
From: Michal Jerabek <fo7y029@public.uni-hamburg.de>

Hello,

I just want to ask - 1)Is it the PCMCIA USB Card from IOmega (designed for ZIP
250 USB) what you mean?
2) Did you succeed in making it work?
I have just seen the card in the local PC shop. The small USB ZIP 250 looks
well, so does it work with OS/2

Many thanks
Michal Jerabek
fo7y029@public.uni-hamburg.de

James Adams wrote:

>  Message from the Deja.com forum:
>  comp.os.os2.setup.storage
>  Your subscription is set to individual email delivery
> >
> I tried the Dani drivers but still no luck.  There seems to be a resource
> conflict of
> some type.  Does anyone know what resources the ZIP250 PCMCIA card wants to
> use?
>
> "William L. Hartzell" wrote:
>
> > Dear James:
> > Try the Dani drivers found on Hobbes.  She has said that she has them
> > working in the configuration that you got.
> >
> > "James F. Adams" wrote:
> >
> > > Does anyone have any experiences with the PCMCIA USB to ATAPI card for
> > > the
> > > ZIP 250 drive.  In my setup, in recognizes the card as a hard disk and
> > > the the card
> > > is inserted.  It wont make it ready however.  This is Warp 4, current
> > > drivers, fix pack
>



 Sent via Deja.com http://www.deja.com/
 Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy (1:109/42)

+----------------------------------------------------------------------------+

From: Trevor-Hemsley@dial.pipex.com                     27-Dec-99 21:40:01
  To: All                                               27-Dec-99 22:22:29
Subj: Re: Warp4 4GB IDE Install Problem

From: "Trevor Hemsley" <Trevor-Hemsley@dial.pipex.com>

On Mon, 27 Dec 1999 19:43:28 GMT, Peter Hollenbeck wrote:

->Get a message like "Not enough space to install networking".
->The drive is a Seagate 4110MB.
->Install disk 1 has:
->   ibm1s506.add  date 7/12/99   size 55658
->   os2dasd.dmd   date 5/03/99   size 40876
->Line 1 of config.sys on Install disk 1 is "set copyfromfloppy=1"
->
->With the partition set to 4094MB (instead of 4110MB) the install works.

Add SET CONNECT_DASD=NO to CONFIG.SYS as well.


Trevor Hemsley, Brighton, UK
(Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com)



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: play@thebeach                                     28-Dec-99 04:31:16
  To: All                                               28-Dec-99 02:36:14
Subj: Re: Can't format Drive, beyond cylindar 1023 or above 2048MB...HELP!

From: play@thebeach (S. Sandler)

Oh thank you so verry much.  It solved my problem immensly.  It works
perfectely now and it is even better that windoze is taken down another notch
that OS/2 still works.  HA HA.

Please let me know if there is anything I can do for you in return.  Just ask.
Now I have to get back to trying to get my ADSL to work under OS/2 like I have
in windoze.

Thank you again.

-Real FAT will only work with a maximum of 2048 MB
-and this is the only native file system that is native to
-both OS/2 and Windows.
-
-The FAT32 format can be recognized by OS/2 if you install
-one of the FAT32 IFS (file system drivers). There
-are two that I know of. They are available at
-
-http://hobbes.nmsu.edu

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: news.sk.sympatico.ca (1:109/42)

+----------------------------------------------------------------------------+

From: dmhills@attglobal.net                             28-Dec-99 15:14:29
  To: All                                               28-Dec-99 10:22:00
Subj: Re: Warp4 4GB IDE Install Problem

From: dmhills@attglobal.net (Don Hills)

In article <qpkdVVNoMoTk-pn2-xEdjIdBnInNJ@tcpserver>,
lsunley@mb.sympatico.ca (Lorne Sunley) wrote:
>On Mon, 27 Dec 1999 19:43:28, Peter Hollenbeck
><peterh@nautixsystems.com> wrote:
>
>> Get a message like "Not enough space to install networking".
>
>Sounds like a bug in the network installation code.

Yes, it's a bug. The fix is to temporarily reduce the partition free
space. One way is temporarily increase the size of SWAPPER.DAT by
setting the initial swapper size to a large enough figure (last number
on the SWAPPATH line in CONFIG.SYS) and another is to use a program such
as BALLOON which writes a big file.

--
Don Hills    (dmhills at attglobaldotnet)     Wellington, New Zealand

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: peter.stahl@abc.se                                28-Dec-99 21:17:16
  To: All                                               28-Dec-99 19:59:15
Subj: Yamaha CDW6416S and os2cdrom.dmd

From: Peter Stahl <peter.stahl@abc.se>

I can't get my Yamaha CD-Writer CDW6416S to
read multisession CDs.
When I peeked into the new os2cdrom.dmd I
can't find any Yamaha CDROM modell only a lot
of other brands.

What to do ?
Is Yamaha such a rare CDRW ?





Peter Stahl
peter.stahl@abc.se

-----------------------------------------------------------
Disclaimer: Any errors in spelling, tact or fact are
            transmission errors. This message trans-
            mitted on 100% recycled electrons and
            printed on 100% recyclable phosphor :-)


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ABC-Klubben (1:109/42)

+----------------------------------------------------------------------------+

From: flywheel@image.dk                                 28-Dec-99 21:44:06
  To: All                                               28-Dec-99 19:59:15
Subj: Re: Problem with FAT32

From: Peter Jespersen <flywheel@image.dk>

Peter Jespersen wrote:

Damn!!!
Well..then I must reparttion the damn ting, using FDISK!

Happy new year everyone!!!

-- 
Live long and prosper...

Out of my mind. Back in five minutes.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: pjfloyd@my-deja.com                               29-Dec-99 08:53:15
  To: peter.stahl@abc.se                                29-Dec-99 05:08:07
Subj: Re: Yamaha CDW6416S and os2cdrom.dmd

To: peter.stahl@abc.se
From: pjfloyd@my-deja.com

In article <84b5u8$n9s$1@oden.abc.se>,
  Peter Stahl <peter.stahl@abc.se> wrote:
> I can't get my Yamaha CD-Writer CDW6416S to
> read multisession CDs.
> When I peeked into the new os2cdrom.dmd I
> can't find any Yamaha CDROM modell only a lot
> of other brands.

> What to do ?
> Is Yamaha such a rare CDRW ?

Wait a bit and I'll send you a copy of os2cdrom.dmd.
I've compiled a version that includes the crw6416,
but I haven't fully tested it yet. It seems to work,
at least in a basic fashion.

Hwyl
Paul

--
Paul Floyd
Is atrophy a shiny cup?


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: istephan@NOSPAMaranea.de                          29-Dec-99 09:04:14
  To: All                                               29-Dec-99 05:08:07
Subj: Re: Problem with FAT32

From: istephan@NOSPAMaranea.de (Ingo Stephany)

hello,
maybe to late, but you may check "partition magic". The program 
is able to handle many file-system-formats without loosing data.

You may check their site at : http://www.powerquest.com

Regards
Ingo Stephany


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Unspecified Organisation (1:109/42)

+----------------------------------------------------------------------------+

From: maxikins@os2bbs.com                               29-Dec-99 11:24:11
  To: All                                               29-Dec-99 10:21:28
Subj: Re: Help !!! Which ide disk I can use in OS/2 Warp now ?

From: maxikins@os2bbs.com (Mark Klebanoff)

Any one, provided you have the most recent version of the IDE drivers.

On Wed, 29 Dec 1999 01:15:59, "Troy Chang" <troy@tcts.seed.net.tw> 
wrote:

> As title.
> 
> Thanks.
> 
> 
> 


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: zeppelin@gte.net                                  29-Dec-99 18:27:23
  To: All                                               30-Dec-99 00:54:07
Subj: Re: CHKDSK "minor system error"

From: zeppelin <zeppelin@gte.net>

Redbeard,

I've had the same "problem" since I first unwrapped warp 4. I've got an
Adaptec
2940 UW, and only get the message when running chkdsk on a system startup
(either a "dirty" restart, or from a maintenance partition  prior to system
maintenance.

I don't get it when running pmchkdsk, or chkdsk from a command line from my
main system. I also run warp v4 on an old microchannel 486 with the correl
scsi
controller on the mobo, and have never seen it on that machine.

Awhile back, when the 32 bit version of chkdsk was released, it was touted to
have eliminated this problem, but my studied experiences indicate otherwise.

Since IBM has it's"knowledge is power, and power is money, so if you want any
meaningful answers, have your credit card ready for  our fee based support
lines" head in a very intimate location, )o(   I suspect that the problem is
so
minor that they don't need our help to solve it. ;-)  (and to think of all the
questionnaires and forums I've participated in  gratis, thinking I was helping
the OS/2 cause)

I just regard the issue as a first good sign that chkdsk has in fact found the
file system, which is a very good thing, compared to the times that it
doesn't.
I'd much rather see this problem than "chkdsk has  repaired the following
files: 0000.chk  -  0674.chk" nosir, it's never a good day after that happens.

"No spam, please" wrote:

> On Fri, 24 Dec 1999 02:02:41 -0500, Bob Germer
> <bobg.REMOVEME.@pics.com> wrote:
>
> >On <3862de11.729678@news.access1.net>, on 12/24/99 at 02:47 AM,
> >   Ted@see.my.sig (No spam, please) said:
> >
> >> I just ran CHKDSK on my main Warp 3 partition. It said it had  "found
> >> and corrected a minor system error," and then it "corrected a file
> >> allocation error." I have run this about a dozen times and received the
> >> same messages. Everything otherwise seems to be running correctly. What
> >> could this be?
>
> >I assume you ran CHKDSK from either a Warp 4 partition or Warp 4
> >installation disks. This was a known bug discovered the day of release and
> >a replacement UPHFS.DLL was made available by IBM for download
> >immediately. It is a harmless error caused by a last minute change in the
> >drivers for ADP SCSI RAID controllers. --
>
> Actually, I'm running Warp 3, FP35. And I neglected to mention that
> the partition in question is HPFS.
>
> -----------------------------------------------------------
> Non-Spam E-Mail: redbeard{AT}earthling{DOT}net
>  Visit my Virtual Light Table: http://tmvlt.cjb.net
>   Travel and Scenic Photography, Commentary, and more
> -----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: flywheel@image.dk                                 29-Dec-99 23:07:12
  To: All                                               30-Dec-99 00:54:07
Subj: Re: Problem with FAT32

From: Peter Jespersen <flywheel@image.dk>

Ingo Stephany wrote:
> 
> hello,
> maybe to late, but you may check "partition magic". The program
> is able to handle many file-system-formats without loosing data.
> 
> You may check their site at : http://www.powerquest.com

Thanks...I will try that!

Happy New Year :-)

-- 
Live long and prosper...

Out of my mind. Back in five minutes.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: jpolt@bradnet.legend.co.uk                        30-Dec-99 01:39:08
  To: All                                               30-Dec-99 03:28:09
Subj: Installable File Systems

From: jpolt@bradnet.legend.co.uk (John Poltorak)

I'm collating some inormation on Installable File System and would be
interested in any uncommon FS's that anyone has come across...

In particularly I'd be interested in anything about AFS (Andrew File System)
or DFS (Distributed File System).

I don't suppose anyone has ever written a Tape File System...

--
John

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Legend Internet Ltd (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               29-Dec-99 23:43:16
  To: All                                               30-Dec-99 03:28:09
Subj: Re: Installable File Systems

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On 30 Dec 1999 01:39:16 GMT, John Poltorak wrote:

>I'm collating some inormation on Installable File System and would be
>interested in any uncommon FS's that anyone has come across...
>
>In particularly I'd be interested in anything about AFS (Andrew File System)
>or DFS (Distributed File System).

You might try looking into TVFS (Toronto Virtual File System), and EXT2-FS,
for reading Linux drives.

>I don't suppose anyone has ever written a Tape File System...

That wouldn't work very well at all.  A tape device would spend all day
winding tape if accessed as a file system.  To be at all practical, access
must be serialized on a large scale (i.e. complete operations, not just
partial reads).  Basically, you'd need to have a FS that doesn't function
unless the drive is locked.  It would make backup software a bit easier to
write, but that's about it.  Normal file system commands wouldn't be
appropriate.


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: jmandres@carbon.icb.csic.es                       30-Dec-99 09:57:07
  To: All                                               30-Dec-99 06:31:09
Subj: Re: Installable File Systems

From: jmandres <jmandres@carbon.icb.csic.es>

Mike Ruskai escribi:

> On 30 Dec 1999 01:39:16 GMT, John Poltorak wrote:
>
> >I'm collating some inormation on Installable File System and would be
> >interested in any uncommon FS's that anyone has come across...
> >
> >In particularly I'd be interested in anything about AFS (Andrew File
System)
> >or DFS (Distributed File System).
>
> You might try looking into TVFS (Toronto Virtual File System), and EXT2-FS,
> for reading Linux drives.
>
> >I don't suppose anyone has ever written a Tape File System...
>
> That wouldn't work very well at all.  A tape device would spend all day
> winding tape if accessed as a file system.  To be at all practical, access
> must be serialized on a large scale (i.e. complete operations, not just
> partial reads).  Basically, you'd need to have a FS that doesn't function
> unless the drive is locked.  It would make backup software a bit easier to
> write, but that's about it.  Normal file system commands wouldn't be
> appropriate.
>
> --
>  - Mike
>
> Remove 'spambegone.net' and reverse to send e-mail.

About the tape IFS, I don't agree. There are several examples in Win9x or NT,
even in DOS (DATMAN is one for DOS or Win9x, Columbia Data Products can do de
same with NT) that allow the use of a tape as a slow disk. Of course this is
not
for continuous use, but can be useful for storing those web downloads or old
archives before deciding to keep  or to discard. In addition, SCSI DAT tapes
are
relatively fast.
Just wishing a knowledgeable programmer decides to do that.

--
Jos Manuel Andrs
Instituto de Carboqumica, CSIC
Mara de Luna 12
50015 - Zaragoza
ESPAA / SPAIN
jmandres@carbon.icb.csic.es or jmandres@tornado.icb.csic.es


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universidad de Zaragoza (1:109/42)

+----------------------------------------------------------------------------+

From: pfitzsim@NOSPAMBASTARDS!home.com                  30-Dec-99 11:35:06
  To: All                                               30-Dec-99 10:25:03
Subj: Re: Installable File Systems

From: Peter Fitzsimons <pfitzsim@NOSPAMBASTARDS!home.com>

Mike Ruskai wrote:
> 
> On 30 Dec 1999 01:39:16 GMT, John Poltorak wrote:
> 
> >I'm collating some inormation on Installable File System and would be
> >interested in any uncommon FS's that anyone has come across...
> >
> >In particularly I'd be interested in anything about AFS (Andrew File
System)
> >or DFS (Distributed File System).
> 
> You might try looking into TVFS (Toronto Virtual File System), and EXT2-FS,
> for reading Linux drives.
> 
> >I don't suppose anyone has ever written a Tape File System...
> 
> That wouldn't work very well at all.  A tape device would spend all day

I tape IFS similar to RSJ's cdr IFS would work well (where data is
cached on the hard disk).

A friend and I had the idea many years ago; he went on to write
"fastback for os/2", which the vendor abandoned shortly after release,
and killed both of our motivation.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: alex@nukunuku.queensu.ca                          30-Dec-99 14:33:03
  To: All                                               30-Dec-99 14:30:05
Subj: Re: Warp4 4GB IDE Install Problem

From: alex@nukunuku.queensu.ca (Alex Taylor)

On Mon, 27 Dec 1999 19:43:28 GMT, Peter Hollenbeck <peterh@nautixsystems.com>
wrote:
>Get a message like "Not enough space to install networking".
>The drive is a Seagate 4110MB.
>Install disk 1 has:
>   ibm1s506.add  date 7/12/99   size 55658
>   os2dasd.dmd   date 5/03/99   size 40876
>Line 1 of config.sys on Install disk 1 is "set copyfromfloppy=1"
>
>With the partition set to 4094MB (instead of 4110MB) the install works.

Section 10.0 of the file "README.INS" on the Warp 4 CD discusses the
workaround for this.

In short, you need to add the line 
    CONNECT_DASD=NO
to CONFIG.SYS on the Install disk 1.

-- 
Alex Taylor
alex@eddie.cis.uoguelph.ca

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Queen's University, Kingston (1:109/42)

+----------------------------------------------------------------------------+

From: flywheel@image.dk                                 30-Dec-99 13:24:10
  To: All                                               30-Dec-99 16:33:21
Subj: Re: Problem with FAT32

From: Peter Jespersen <flywheel@image.dk>

Peter Jespersen wrote:
> 
> Ingo Stephany wrote:
> >
> > hello,
> > maybe to late, but you may check "partition magic". The program
> > is able to handle many file-system-formats without loosing data.
> >
> > You may check their site at : http://www.powerquest.com
> 
> Thanks...I will try that!
> 
> Happy New Year :-)

Tried it (version 3.0)...no luck, PQMagic was unable to convert
to FAT32 and delete/create it....When trying to re-format it, my
choices was HPFS and NTFS

Well I.. believe that we can conclude that the LVM, might be
magic but it does things in its own way!

It seems like I have to continue to rely on the fickle VFAT
driver, a while!

-- 
Live long and prosper...

Out of my mind. Back in five minutes.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: spamtrap@cds-inc.com                              30-Dec-99 20:45:11
  To: All                                               30-Dec-99 19:59:12
Subj: Re: Installable File Systems

From: spamtrap@cds-inc.com (Brad Benson)

"Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net> wrote:
] That wouldn't work very well at all.  A tape device would spend all day
] winding tape if accessed as a file system.  To be at all practical, access
] must be serialized on a large scale (i.e. complete operations, not just
] partial reads).  Basically, you'd need to have a FS that doesn't function
] unless the drive is locked.  It would make backup software a bit easier to
] write, but that's about it.  Normal file system commands wouldn't be
] appropriate.

It could be done, and on a device with a relatively fast seek time, it
might even be practical for some applications.  I looked into this a
few years ago and came to the conclusion that it wouldn't be terribly
difficult to do but would be a major project.  The big headache is the
16-bit driver model and lack of modern development tools, although
ICAT is available now whereas it wasn't then.  

There are products like that available for DOS and Win95/98, but after
talking with them we concluded there wouldn't be a viable market for
it, on either OS/2 or Win9x.  

As you alluded to, the idea definately has drawbacks :
  - Definately slower than DASD.
  - Definately more expensive (how much does a 2GB DAT cost?  how much does a
2GB Jaz cost?)
  - Definately a miniscule market (how many users have tape drives?  Out of
those, how many have DAT?)


Cheers,

Brad
replace "spamtrap" with "benson" in my reply address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDS, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               30-Dec-99 16:17:28
  To: All                                               30-Dec-99 19:59:12
Subj: Re: Installable File Systems

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Thu, 30 Dec 1999 09:57:15 +0100, jmandres wrote:

>Mike Ruskai escribi:
>
>> On 30 Dec 1999 01:39:16 GMT, John Poltorak wrote:
>>
>> >I'm collating some inormation on Installable File System and would be
>> >interested in any uncommon FS's that anyone has come across...
>> >
>> >In particularly I'd be interested in anything about AFS (Andrew File
System)
>> >or DFS (Distributed File System).
>>
>> You might try looking into TVFS (Toronto Virtual File System), and EXT2-FS,
>> for reading Linux drives.
>>
>> >I don't suppose anyone has ever written a Tape File System...
>>
>> That wouldn't work very well at all.  A tape device would spend all day
>> winding tape if accessed as a file system.  To be at all practical, access
>> must be serialized on a large scale (i.e. complete operations, not just
>> partial reads).  Basically, you'd need to have a FS that doesn't function
>> unless the drive is locked.  It would make backup software a bit easier to
>> write, but that's about it.  Normal file system commands wouldn't be
>> appropriate.

>About the tape IFS, I don't agree. There are several examples in Win9x or NT,
>even in DOS (DATMAN is one for DOS or Win9x, Columbia Data Products can do de
>same with NT) that allow the use of a tape as a slow disk. Of course this is
not
>for continuous use, but can be useful for storing those web downloads or old
>archives before deciding to keep  or to discard. In addition, SCSI DAT tapes
are
>relatively fast.
>Just wishing a knowledgeable programmer decides to do that.

What happens if you access the "slow disk" from two different programs?  

1)  It becomes unusable, for all practical intents and purposes.

2)  You can't access from more than one program at a time, which satisfies
the requirements I laid out.

DAT drives are fast in data transfer rate, primarily because of how the
data is written (in diagonal lines, increasing the length of the data area
under the head for a given linear tape velocity).  They are not faster in
moving the tape, by any significant measure.

What Peter mentioned sounds like a reasonable approach, but I'd still
question the usefulness.


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

From: spamtrap@cds-inc.com                              30-Dec-99 22:13:23
  To: All                                               30-Dec-99 19:59:12
Subj: Re: Installable File Systems

From: spamtrap@cds-inc.com (Brad Benson)

"Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net> wrote:

] 
] What happens if you access the "slow disk" from two different programs? =
]  
] 
] 1)  It becomes unusable, for all practical intents and purposes.
] 
] 2)  You can't access from more than one program at a time, which satisfi=
] es
] the requirements I laid out.
] 
] DAT drives are fast in data transfer rate, primarily because of how the
] data is written (in diagonal lines, increasing the length of the data ar=
] ea
] under the head for a given linear tape velocity).  They are not faster i=
] n
] moving the tape, by any significant measure.

Actually, they are significantly faster  in moving the tape.   An old
DDS-1 unit that can't do more than about 12MB minute raw transfer rate
still has a seek time several times faster than an NS20, which has a
raw transfer rate of over 60MB/min.


Cheers,

Brad
replace "spamtrap" with "benson" in my reply address

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CDS, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: rde@tavi.co.uk                                    30-Dec-99 23:04:21
  To: All                                               30-Dec-99 19:59:12
Subj: Re: Installable File Systems

From: rde@tavi.co.uk (Bob Eager)

On Thu, 30 Dec 1999 04:43:33, "Mike Ruskai" 
<retsiemynnaht@spammoc.beoohaygone.net> wrote:

> >I don't suppose anyone has ever written a Tape File System...
> 
> That wouldn't work very well at all.  A tape device would spend all day
> winding tape if accessed as a file system.

I've used (years ago) systems that did exactly that. I once set up a 
PDP-11 (16 bit machine) with operating system and swap area (process 
roll-out really) on one drive and user files on the other. Each tape 
had 360KB capacity and and end to end time of about 90 seconds AFAIR.

The trick is directory caching, free block list caching, general 
caching (of course) and a careful on-media file system layout.

I'm not pretending it was fast. But for some systems it's fine. The 
tapes I used were individually block-addressable at the hardware 
level...

-- 
Bob Eager
rde at tavi.co.uk
PC Server 325; PS/2s 8595*3, 9595*3 (2*P60 + P90), 8535, 8570, 9556*2,
8580*6,
8557*2, 8550, 9577, 8530, P70, PC/AT..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tavi Systems (1:109/42)

+----------------------------------------------------------------------------+

From: timurkz@saxz.mmbankz.ruz                          31-Dec-99 03:04:05
  To: All                                               30-Dec-99 21:20:01
Subj: Re: Installable File Systems

From: "Timur Kazimirov" <timurkz@saxz.mmbankz.ruz>

On Thu, 30 Dec 1999 11:35:12 GMT, Peter Fitzsimons wrote:

>I tape IFS similar to RSJ's cdr IFS would work well (where data is
>cached on the hard disk).

I agree. The speed of access depends from the directory/file index
table (with offsets on the tape). If there will be a such good table
stored in memory after first access and there will be a mechanizm
to update this table in memory, caching accessed files and
periodically update one at the beginning, I see no reason why this
FS won't work.

Some years ago we have used a tape backup program for Novell
NeWare (I forgot it's name). This program allowed to mount a tape
as an usual NeWare volume, so dirs/files on tape could be
accessed from any program. Of course, it was slow for the first time

With best regards,
Timur Kazimirov

-- Remove all "z" from my address to reply



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Bank of Moscow, Sakhalin Branch (1:109/42)

+----------------------------------------------------------------------------+

From: mcmorran@norfolk.infi.net                         30-Dec-99 20:08:16
  To: All                                               30-Dec-99 23:19:05
Subj: Re: Yamaha CDW6416S and os2cdrom.dmd

From: mcmorran@norfolk.infi.net (Peter McMorran)

In <84chm3$df1$1@nnrp1.deja.com>, on 12/29/99 
   at 08:53 AM, pjfloyd@my-deja.com said:

>In article <84b5u8$n9s$1@oden.abc.se>,
>  Peter Stahl <peter.stahl@abc.se> wrote:
>> I can't get my Yamaha CD-Writer CDW6416S to
>> read multisession CDs.
>> When I peeked into the new os2cdrom.dmd I
>> can't find any Yamaha CDROM modell only a lot
>> of other brands.

>> What to do ?
>> Is Yamaha such a rare CDRW ?

>Wait a bit and I'll send you a copy of os2cdrom.dmd. I've
>compiled a version that includes the crw6416, but I haven't
>fully tested it yet. It seems to work, at least in a basic
>fashion.

>Hwyl
>Paul

Hi, Paul,

I think a lot of folks (including myself) would be interested in
this, especially if it handles the CRW4416S as well. It would be
great if you could post it on Hobbes and announce it here when
it's ready.

Cheers,
Peter

-- 
-----------------------------------------------------------
mcmorran@norfolk.infi.net (Peter McMorran)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: aaronl@clear.net.nz                               31-Dec-99 15:52:22
  To: All                                               30-Dec-99 23:19:06
Subj: How big is ">8.4GB" ... IDE drivers?

From: Aaron Lawrence <aaronl@clear.net.nz>

Hi all,

I'm considering a new 20 or 28GB IDE drive. Are these OK with the latest
IDEDASD.EXE? - Sorry I couldn't see anyone mentioning such sizes
recently - just checking...

TIA

Aaron

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CLEAR Net New Zealand (1:109/42)

+----------------------------------------------------------------------------+

From: wwiv@pppproject.org                               30-Dec-99 21:25:00
  To: All                                               31-Dec-99 03:17:19
Subj: Re: Installable File System

From: "Dilbert Firestorm" <wwiv@pppproject.org>

RE: Re: Installable File Systems
BY: Peter Fitzsimons <pfitzsim@NOSPAMBASTARDS!hom

>A friend and I had the idea many years ago; he went on to write
>"fastback for os/2", which the vendor abandoned shortly after release,
>and killed both of our motivation.

Pretty much what'd you expect from Symantec after they bought out the company
that made the fastback products and killed their product line.....



Origin: Nuclear Wasteland * 504-394-0509


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Nuclear Wasteland * 504-394-0509 (1:109/42)

+----------------------------------------------------------------------------+

From: bogus.due2UCE@atlantic.net                        30-Dec-99 17:38:08
  To: All                                               31-Dec-99 05:16:12
Subj: Re: Problem with FAT32

From: Felix Miata <bogus.due2UCE@atlantic.net>

Peter Jespersen wrote:
 
> Peter Jespersen wrote:

> > Ingo Stephany wrote:

> > > maybe to late, but you may check "partition magic". The program
> > > is able to handle many file-system-formats without loosing data.

> > > You may check their site at : http://www.powerquest.com

> > Thanks...I will try that!

> > Happy New Year :-)
 
> Tried it (version 3.0)...no luck, PQMagic was unable to convert
> to FAT32 and delete/create it....When trying to re-format it, my
> choices was HPFS and NTFS

It's possible to use PM v3.05 and the freely downloadable PowerQuest
partition table editor in conjunction to get all the partitions created,
but you need to finish the process by booting M$ WinDOS 7+ to do the
FAT32 format. Key is understanding when to use the standard 06h and 0Fh
primary or 05h and 0Eh extended partition types. How I did it is
detailed in a post to this newsgroup this past Sunday.
-- 
He who despises his neighbor sins, but blessed is he who is kind to the
needy.                Proverbs 14:3 NKJV

 Team OS/2  ***  Rotary ONLY since 1973

Felix Miata  ***  http://mrmazda.members.atlantic.net <- Not just a FAQ

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://www.mcsr.olemiss.edu/~mudws/font.html (1:109/42)

+----------------------------------------------------------------------------+

From: pjfloyd@my-deja.com                               31-Dec-99 09:03:00
  To: mcmorran@norfolk.infi.net                         31-Dec-99 05:16:12
Subj: Re: Yamaha CDW6416S and os2cdrom.dmd

To: mcmorran@norfolk.infi.net
From: pjfloyd@my-deja.com

In article <386c02ab$1$zpzbeena$mr2ice@news.norfolk.infi.net>,
  mcmorran@norfolk.infi.net (Peter McMorran) wrote:
> I think a lot of folks (including myself) would be interested in
> this, especially if it handles the CRW4416S as well. It would be
> great if you could post it on Hobbes and announce it here when
> it's ready.

I probably will do that in the medium term. At the
moment I don't have outgoing FTP (firewall at work
and too lazy/mean too plug in my modem at home -
not a problem that can't be easily solved).

Adding the 4416 should be easy enough.

Hwyl
Paul

> Cheers,
> Peter
--
Paul Floyd
Is atrophy a shiny cup?


Sent via Deja.com http://www.deja.com/
Before you buy.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Before you buy. (1:109/42)

+----------------------------------------------------------------------------+

From: dcasey@ibm.net                                    31-Dec-99 11:40:19
  To: All                                               31-Dec-99 16:05:18
Subj: Re: How big is ">8.4GB" ... IDE drivers?

From: dcasey@ibm.net (Dan Casey)

In article <386C1A7C.2A48C294@clear.net.nz>,
Aaron Lawrence <aaronl@clear.net.nz> wrote:
>Hi all,
>
>I'm considering a new 20 or 28GB IDE drive. Are these OK with the latest
>IDEDASD.EXE? - Sorry I couldn't see anyone mentioning such sizes
>recently - just checking...

Just heard from a user last night that said he had 20+Gb IDE drive
working fine in OS/2 ... even though his system BIOS only reported it
as 8.4Gb.


--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: icedancer-zamboni@ibm-zamboni.net                 31-Dec-99 17:21:16
  To: All                                               31-Dec-99 16:54:16
Subj: Re: Problem with FAT32

From: icedancer-zamboni@ibm-zamboni.net (Ken Walter)

On Thu, 30 Dec 1999 22:38:16, Felix Miata <bogus.due2UCE@atlantic.net>
wrote:

[...]
>It's possible to use PM v3.05 and the freely downloadable PowerQuest
>partition table editor in conjunction to get all the partitions created,
Where is this partition table editor?
I went to their site and I couldn't find it.



Ken Walter

Remove -zamboni to reply
All the above is hearsay and the opinion of no one in particular

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Solution Technology (1:109/42)

+----------------------------------------------------------------------------+

From: retsiemynnaht@spammoc.beoohaygon...               31-Dec-99 15:44:09
  To: All                                               31-Dec-99 16:54:16
Subj: Re: Installable File Systems

Message sender: retsiemynnaht@spammoc.beoohaygone.net

From: "Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net>

On Thu, 30 Dec 1999 22:13:46 GMT, Brad Benson wrote:

>"Mike Ruskai" <retsiemynnaht@spammoc.beoohaygone.net> wrote:
>
>] 
>] What happens if you access the "slow disk" from two different programs? =
>]  
>] 
>] 1)  It becomes unusable, for all practical intents and purposes.
>] 
>] 2)  You can't access from more than one program at a time, which satisfi=
>] es
>] the requirements I laid out.
>] 
>] DAT drives are fast in data transfer rate, primarily because of how the
>] data is written (in diagonal lines, increasing the length of the data ar=
>] ea
>] under the head for a given linear tape velocity).  They are not faster i=
>] n
>] moving the tape, by any significant measure.
>
>Actually, they are significantly faster  in moving the tape.   An old
>DDS-1 unit that can't do more than about 12MB minute raw transfer rate
>still has a seek time several times faster than an NS20, which has a
>raw transfer rate of over 60MB/min.

That's significant for when you're waiting on a tape rewind during a
restore session, but it's hardly significant when talking about a
direct-access file system.  

Tapes simply aren't direct access devices, and any file system you create
for one will have to take this into account, by serializing operations on
a large scale.  The type of FS mentioned by Peter Fitzimmons, which used a
hard drive for cache, is about the only practical solution.  

That doesn't sound like what the person who first mentioned the idea of a
tape file system had in mind.


--
 - Mike

Remove 'spambegone.net' and reverse to send e-mail.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TLF (1:109/42)

+----------------------------------------------------------------------------+

+============================================================================+
